ID: 1038771407

View in Genome Browser
Species Human (GRCh38)
Location 8:30485189-30485211
Sequence CCTAACTTGCACAGGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038771407_1038771410 15 Left 1038771407 8:30485189-30485211 CCTGACAGCCTGTGCAAGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1038771410 8:30485227-30485249 ATTTGTACAGCTTGTGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038771407 Original CRISPR CCTAACTTGCACAGGCTGTC AGG (reversed) Intronic
901431087 1:9215382-9215404 CCTACCTTGGACGGGCTGTTGGG - Intergenic
904503152 1:30929350-30929372 CCTAACACACACAGGGTGTCAGG - Intergenic
905000638 1:34665895-34665917 ACTAATTTCCAGAGGCTGTCTGG + Intergenic
905450253 1:38051569-38051591 CCTAAGATACACAGCCTGTCCGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
906365743 1:45207992-45208014 CCTATGTTGCCCAGGCTGGCTGG + Intronic
907799327 1:57749237-57749259 CCTTAGTTTCACTGGCTGTCGGG - Intronic
908239675 1:62178290-62178312 CAAAACTTGCAGAGGATGTCTGG - Intergenic
908322893 1:62995089-62995111 CCTGACTTGCACAGACTCTCAGG - Intergenic
909443001 1:75718511-75718533 CCTAAAATACACATGCTGTCTGG + Intergenic
909514312 1:76490077-76490099 CCTAACTCCCAGAGGCTGTCGGG - Intronic
909531430 1:76686046-76686068 GTTAACTTGCACAGGGTGCCTGG - Intergenic
910327534 1:86027586-86027608 CCTAGATTTCACAGGATGTCAGG + Intronic
919006764 1:191908936-191908958 CCTAAATTGCAGAGGATGTATGG - Intergenic
921805818 1:219453805-219453827 CCTACCTGGCACAGGCAGTGAGG - Intergenic
1062783336 10:237960-237982 GCTAAATTGCCCAGGCTGTAAGG - Intronic
1062856279 10:781016-781038 CCGTACTTGCACACGCTGTTGGG + Intergenic
1063036130 10:2288595-2288617 CCTAGCTTCCATGGGCTGTCAGG - Intergenic
1067056553 10:43056014-43056036 CCTGGTCTGCACAGGCTGTCAGG - Intergenic
1069862608 10:71481035-71481057 CCCAAGTTTCCCAGGCTGTCAGG - Intronic
1070048713 10:72865736-72865758 CCTATGTTGCCCAGGCTGTGTGG + Intronic
1072317294 10:94215225-94215247 CCTTACTTGCCCAGGGTATCTGG - Intronic
1073925609 10:108511721-108511743 CTTAAATTGCACAGTCTGTTTGG + Intergenic
1075353603 10:121749269-121749291 CTTAATTTGCACATTCTGTCAGG + Intronic
1075760846 10:124855141-124855163 CCTATGTTGCCCAGGCTGGCTGG + Intergenic
1079267802 11:18951748-18951770 CGTAAATTTCTCAGGCTGTCAGG + Intergenic
1080652920 11:34236825-34236847 CCCAAGCTGCAGAGGCTGTCTGG - Intronic
1084695468 11:70751548-70751570 CCTGACTTTCAAAGGCTCTCTGG - Intronic
1086162367 11:83736379-83736401 CCTAACTTGGTCAGGCCATCTGG - Intronic
1088807198 11:113363439-113363461 ACTGACTTGCTAAGGCTGTCAGG - Intronic
1095810719 12:46371702-46371724 CCAAACTTGCACAGGCACTCAGG + Intronic
1103749184 12:123147850-123147872 CCTACCCTGCACAGTGTGTCAGG + Intronic
1104255211 12:127130154-127130176 CCTAATTAGCATAGGATGTCCGG + Intergenic
1104569401 12:129911726-129911748 CCCAACATGCACACGTTGTCAGG + Intergenic
1106846454 13:33742793-33742815 ACTAACTTGGAAATGCTGTCAGG - Intergenic
1108103536 13:46983752-46983774 CCTATCATGCACATGCTGTAAGG + Intergenic
1108796176 13:54033432-54033454 CCTAGCTTTCACAGGATGTATGG - Intergenic
1108930108 13:55807334-55807356 CCTAAATTTCACAGGATGTATGG - Intergenic
1110726215 13:78827595-78827617 CCTGAGTTCCACGGGCTGTCAGG - Intergenic
1112154623 13:96803926-96803948 CCTTACTTCCACAGTCTGTCTGG - Intronic
1112238788 13:97660670-97660692 CCTGCCTTGCACCGGCTCTCTGG - Intergenic
1112334932 13:98506935-98506957 GCTAATTTGCTCAGGCTTTCAGG + Intronic
1114318950 14:21530810-21530832 ACTATGTTGCCCAGGCTGTCTGG + Intronic
1120661658 14:87257860-87257882 CCTAAGTTTCACAGGATGTATGG + Intergenic
1122408780 14:101515504-101515526 CCTAACTAGCAGAGACTGCCAGG - Intergenic
1202842254 14_GL000009v2_random:132510-132532 CTTAACTTTCAGAGTCTGTCAGG - Intergenic
1202911640 14_GL000194v1_random:122743-122765 CTTAACTTTCAGAGTCTGTCAGG - Intergenic
1124442014 15:29692551-29692573 CCCAGCTTTCACAGTCTGTCAGG - Intergenic
1128426060 15:67543136-67543158 CCGAGCCTGCCCAGGCTGTCGGG - Exonic
1128480678 15:68035276-68035298 CCTATGTTGCCCAGGCTGGCTGG + Intergenic
1142703538 17:1679368-1679390 CCTCACTTTCACAGGCTGCCCGG + Exonic
1143039467 17:4022981-4023003 TCTAACTTCCAAAAGCTGTCTGG + Intronic
1144779486 17:17800680-17800702 CCCTAGTTGCGCAGGCTGTCAGG - Intronic
1147607055 17:41779865-41779887 GCTATGTTGCACAGGCTGGCAGG + Intronic
1148050268 17:44766686-44766708 CTCAACGTGCCCAGGCTGTCTGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1151168059 17:72221709-72221731 CCTACCTGGCACTGGCTTTCTGG - Intergenic
1151620833 17:75243902-75243924 TCTAACTTGCCCAGGGTGTAAGG + Intronic
1152782933 17:82234395-82234417 CCCAACCTGCACTGGCTCTCTGG - Exonic
1156165879 18:34420839-34420861 CTCAACTTGCACAGAGTGTCCGG + Intergenic
1157533460 18:48441505-48441527 CCAAACTGGCACAGGATGTCCGG + Intergenic
1160586194 18:79914867-79914889 CCTGCCTTGCCCAGGCTGCCAGG + Intronic
1160947868 19:1651990-1652012 CCTAAGTTGCACAGCCCGTCCGG + Intronic
1161584612 19:5098490-5098512 CCTGACTTGCCCAGCCTGTGGGG + Intronic
1165226708 19:34360006-34360028 CCTAACTTGCCTCTGCTGTCAGG + Intronic
924992085 2:320968-320990 GCTACCTCGCACTGGCTGTCAGG - Intergenic
930703586 2:54483495-54483517 CCTCACGTGGAGAGGCTGTCTGG + Intronic
932044190 2:68330790-68330812 ACTCATTTGCACTGGCTGTCTGG + Intergenic
938173645 2:129104610-129104632 CCTAACTTGTGCTGTCTGTCTGG + Intergenic
938757474 2:134393968-134393990 CCTAACTTTGAGAGGCTGGCAGG + Intronic
948368638 2:237474194-237474216 CCCAAGTTGGTCAGGCTGTCAGG + Intergenic
1172055288 20:32150517-32150539 CCCACCTTGGACAGGCTGACAGG - Intronic
1176631002 21:9137412-9137434 CTTAACTTTCAGAGTCTGTCAGG - Intergenic
1178746843 21:35259915-35259937 CCTAACTTGGACCTGCTCTCTGG - Intronic
1178780898 21:35602879-35602901 CCTAACTTGCACAGCCCTGCCGG - Intronic
1183469961 22:37999965-37999987 CCTAGCGGGCACAGGCTGCCAGG - Intronic
1185103547 22:48854532-48854554 CCTAACATGCACAGGCTCAAAGG - Intergenic
950365898 3:12483966-12483988 CCTTAACTGCACAGGCAGTCTGG + Intergenic
955435947 3:58899241-58899263 CCTTCCTTGTCCAGGCTGTCTGG + Intronic
957391232 3:79573245-79573267 CCTATCTTGCCCATGCTGGCTGG + Intronic
963024487 3:140905321-140905343 CTTACATAGCACAGGCTGTCAGG - Intergenic
966526369 3:180923784-180923806 CCTATGTTGCCCAGGCTGGCTGG + Intronic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
968434293 4:576697-576719 CATAACTTCCACAGGCTTCCCGG - Intergenic
972832702 4:42832906-42832928 CCTAAATTGCAGAGGATGTATGG + Intergenic
973140203 4:46757622-46757644 CCCAAAATGCACAGGCTGTATGG - Intronic
975766705 4:77676187-77676209 CCTAACCTGCACAGTCTGGGGGG - Intergenic
976242362 4:82971607-82971629 CCTAACTGATCCAGGCTGTCAGG + Intronic
981555702 4:145991165-145991187 CTTAACTTTCACAAGCTGTGAGG + Intergenic
984707096 4:182855595-182855617 CCAAGCTTGGCCAGGCTGTCAGG - Intergenic
986146872 5:5086293-5086315 CCCAACTTAAACAGGCAGTCTGG + Intergenic
993530400 5:89017551-89017573 ACTAAGTGGCACAGGCTGTTTGG - Intergenic
995478598 5:112572669-112572691 GTTAACTTACACAGGATGTCAGG + Intergenic
999623376 5:153494335-153494357 CCTACCTTGCAGAGGTTTTCTGG + Intronic
999882023 5:155875939-155875961 CCCAATTTGCACAGGGTGTTAGG - Intronic
1013364996 6:109430381-109430403 CCCCACTGGCACAGCCTGTCTGG + Intronic
1015578073 6:134693830-134693852 CCTAGCTTACTCAGGTTGTCTGG - Intergenic
1017351508 6:153448130-153448152 GCTACCTGGCACAGGGTGTCAGG + Intergenic
1018748922 6:166784983-166785005 CCCAGCTTGCCCTGGCTGTCAGG + Intronic
1019268123 7:130389-130411 CCTGCCTTGCACAAGATGTCAGG + Intergenic
1022094119 7:27128237-27128259 CCAAACTTGGCCAGGCTTTCAGG - Intronic
1023795056 7:43784991-43785013 CCTGGCTTGCACAGTGTGTCAGG - Intronic
1026666233 7:72342054-72342076 CCTATGTTGCCCAGGCTGGCTGG - Intronic
1038771407 8:30485189-30485211 CCTAACTTGCACAGGCTGTCAGG - Intronic
1042691583 8:71505548-71505570 CCTAACTTTCACAGTCTTTTTGG - Intronic
1045545103 8:103121561-103121583 TCTCACTGGCACAGGCTGCCTGG - Intergenic
1048267683 8:133001845-133001867 CCACACCTGCACAGGCTGGCTGG - Intronic
1048704642 8:137139389-137139411 TCAAAGTTGAACAGGCTGTCAGG - Intergenic
1049112554 8:140656815-140656837 GCTAACTTGGACAGGTTTTCAGG + Intergenic
1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG + Intergenic
1053437911 9:38089413-38089435 CAAAGCTTGCACAGGCTCTCAGG - Intergenic
1056691045 9:88808969-88808991 CCTAACTTCAACAGGCTCTGGGG - Intergenic
1058579443 9:106439319-106439341 CCTATCTTGCACACGTTGGCAGG - Intergenic
1059435180 9:114271720-114271742 GCTGACTTGCACAGGGTGACCGG - Intronic
1061324627 9:129856134-129856156 CCTAATTTGGACAGGAAGTCTGG + Intronic
1062169818 9:135128863-135128885 CCTCACTAGCACAGGCTTTTGGG + Intergenic
1203753831 Un_GL000218v1:105115-105137 CTTAACTTTCAGAGTCTGTCAGG - Intergenic
1193712207 X:84893844-84893866 ACTAACTTGCAAAAGCAGTCTGG + Intergenic
1200123999 X:153804716-153804738 CCAAACTTGCGCAGGCTTCCCGG + Exonic
1200206971 X:154323549-154323571 CCTGACTGAGACAGGCTGTCAGG - Intronic
1201167477 Y:11222673-11222695 CTTAACTTTCAGAGTCTGTCAGG - Intergenic
1202190005 Y:22231775-22231797 ACTAACTTGAACAGGCTGTGAGG - Intergenic