ID: 1038774609

View in Genome Browser
Species Human (GRCh38)
Location 8:30517351-30517373
Sequence CAGAATGAAAAGAAGGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 2, 3: 86, 4: 960}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038774609_1038774617 26 Left 1038774609 8:30517351-30517373 CCCTTATCCTTCTTTTCATTCTG 0: 1
1: 0
2: 2
3: 86
4: 960
Right 1038774617 8:30517400-30517422 GCTATACTGAGATACAGTGGAGG No data
1038774609_1038774612 -3 Left 1038774609 8:30517351-30517373 CCCTTATCCTTCTTTTCATTCTG 0: 1
1: 0
2: 2
3: 86
4: 960
Right 1038774612 8:30517371-30517393 CTGTGCTTCGTGTAGCCACTAGG No data
1038774609_1038774616 23 Left 1038774609 8:30517351-30517373 CCCTTATCCTTCTTTTCATTCTG 0: 1
1: 0
2: 2
3: 86
4: 960
Right 1038774616 8:30517397-30517419 CTAGCTATACTGAGATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038774609 Original CRISPR CAGAATGAAAAGAAGGATAA GGG (reversed) Intronic
900595904 1:3480077-3480099 CAGAATCAAAAGCAGGTTCATGG + Intronic
901198762 1:7454936-7454958 CAGAATGAAAATAATAGTAATGG - Intronic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
902076913 1:13794315-13794337 CAGAATGTACAGAAGGCTTAAGG - Intronic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
902342007 1:15789904-15789926 AGGAATGAAAAGAAGAATGAAGG - Intergenic
902727866 1:18349342-18349364 CAGAAGAAAAATAAGGATGATGG + Intronic
903000992 1:20265729-20265751 CAAAATGAAAAGAAAAATAATGG - Intergenic
904099810 1:28015422-28015444 AAACATGAAAAGAAGGAGAATGG + Intronic
904700759 1:32356743-32356765 AAGAAAGAAAAGAGAGATAAAGG - Intronic
905003638 1:34693364-34693386 CAGAGTGAAGGGATGGATAAAGG - Intergenic
905155950 1:35981875-35981897 GAGAATGACAAGAAGTATAAAGG - Intronic
905316530 1:37085109-37085131 CAGAAGGACATGAAGGGTAAAGG + Intergenic
905501815 1:38445577-38445599 CAGAAAGACAAGAAGGCCAATGG + Intergenic
905520057 1:38590662-38590684 CAAATTGAAAAGAAGTAAAAAGG + Intergenic
905619198 1:39427268-39427290 CAGAATGAGAATAAGGTTAATGG + Intronic
905995209 1:42375554-42375576 AAGAAAGAAAAGAAGGAAATGGG - Intergenic
906816918 1:48888664-48888686 TATAATGAAAATAAGGTTAATGG - Intronic
906942090 1:50264381-50264403 TAGAATGAAAAGCAGAAAAAGGG + Intergenic
907234348 1:53031502-53031524 CAGAATTCAAAGAAGGGCAATGG - Intronic
908333691 1:63097936-63097958 AAGAAGGAAAAGAAGGATGGGGG + Intergenic
908407223 1:63827046-63827068 CATTATGAAAAAAAGGATAACGG - Intronic
908647041 1:66289450-66289472 TAGAAAGATAAGAAGGAAAAAGG + Intronic
908714876 1:67058914-67058936 AAGAAGGATAAGCAGGATAAAGG + Intergenic
908849336 1:68359013-68359035 GAGAATTAAAAGGGGGATAAAGG - Intergenic
908986486 1:70029960-70029982 TTGAATGAAATGGAGGATAATGG - Intronic
909176773 1:72371347-72371369 CAGAATGACAAGAAGCTCAATGG + Intergenic
909225004 1:73008295-73008317 CAGCATGAAAAGAGGTATAATGG + Intergenic
909298038 1:73976109-73976131 CAGAATGAAAAAGAATATAAAGG - Intergenic
909410222 1:75341480-75341502 GAGAAAGAAAAGAAAGAGAAAGG + Intronic
909488713 1:76202653-76202675 CAGCATGAAAAGCAGGCTATTGG - Intronic
909655486 1:78027338-78027360 CATTAAGAAAAGAATGATAACGG + Intronic
909714288 1:78689155-78689177 TAGAATGAAAAGAAAGAAGAAGG - Intergenic
909937180 1:81565612-81565634 CAGCATGAAATGAAGGAAAATGG - Intronic
910171330 1:84380477-84380499 AAGAAAGAAAAGAAGGAAGAAGG + Intronic
910898534 1:92094358-92094380 CTGTATGAAAAGAAGGCAAAAGG + Intronic
911332791 1:96544534-96544556 CAGAGGGAAAACAAGGGTAAAGG - Intergenic
911580010 1:99623246-99623268 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
911709607 1:101054830-101054852 AAGAATGAAGAGAAGGGCAAAGG - Intergenic
911975458 1:104489046-104489068 AAGAATCAAAAGAAGCAAAATGG - Intergenic
912120057 1:106460447-106460469 GGGTATGAAAAGAATGATAAAGG + Intergenic
912193431 1:107368225-107368247 GAGAAGGAAAAGAAGGAAGAGGG - Intronic
912254988 1:108049156-108049178 CAGCCTGCAAAGAAGGACAAGGG + Intergenic
912275810 1:108256982-108257004 AAGAATGAAAACAAACATAATGG - Intergenic
912292417 1:108437372-108437394 AAGAATGAAAACAAACATAATGG + Intronic
912969363 1:114266086-114266108 CAGGAAGAAGAGAAGGAAAAAGG + Intergenic
913088920 1:115463106-115463128 CAGAAGGAAAAGATGGAAAGAGG + Intergenic
913133558 1:115864656-115864678 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
913630972 1:120709549-120709571 CAGAAGGAACATAAGGAGAATGG + Intergenic
914002588 1:143704641-143704663 CAGAAAGAAAAGAAAGAAAAAGG + Intergenic
914227459 1:145732845-145732867 AAGAATGCAGAGAAGGAAAATGG + Intronic
914720512 1:150285073-150285095 AGAAATGAAAAGAAGGAGAAGGG - Intronic
914903602 1:151726436-151726458 CAAAATGAATTGAAGGAGAAGGG + Intronic
915174631 1:154004641-154004663 AAGAAAGAAAAGAGGAATAACGG - Intronic
915537984 1:156549022-156549044 CAGCTTGAACAGAAGCATAAAGG + Intronic
915845053 1:159254005-159254027 CAGAAATAAAAGAATGTTAAAGG + Intergenic
915968594 1:160335083-160335105 CAGAAAGAAAAAAAGCAGAAAGG + Intronic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916224883 1:162479598-162479620 CAAAAAAAAAAAAAGGATAAAGG + Intergenic
916386403 1:164276573-164276595 AAGAAAGAAAAGAAAGAGAAAGG + Intergenic
916879199 1:169002625-169002647 CAGAAGGAGAAAAAGGCTAAAGG + Intergenic
917013435 1:170501806-170501828 TAGAAACAAAAGAATGATAAAGG + Intergenic
918391750 1:184071933-184071955 CAGAAGGAAAGGAAAGAGAATGG - Intronic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
918915166 1:190626160-190626182 CAGAACGAAAAAAAAGAAAAAGG - Intergenic
919060901 1:192631372-192631394 CAGAATGGGAAGAAGAACAACGG - Intergenic
919272444 1:195365689-195365711 ATGAATGAAAACAATGATAAAGG + Intergenic
919401721 1:197126724-197126746 CAGAAAGAAAAGAATGTTCATGG + Intronic
919696960 1:200587376-200587398 CAGAAAAAAAAGAAGAAAAAAGG + Intronic
920280660 1:204841108-204841130 CAGAATAACAAGAAGGCTATGGG + Intronic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920700596 1:208215561-208215583 AAGAATGAAGGGAAGGATCAGGG + Intronic
920752392 1:208691560-208691582 CAAGATTAAAAGAAGGAAAATGG + Intergenic
921072244 1:211670797-211670819 GAAAATGAAAAGAAGAACAAAGG + Intronic
921372174 1:214435196-214435218 CAGGATGAAAAGAAGTAAAATGG + Intronic
921493351 1:215806230-215806252 GAGAAAGAAAAGAAAAATAAAGG - Intronic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
921691316 1:218154059-218154081 CAGCAACAAAAGAAAGATAATGG + Intergenic
921797700 1:219366575-219366597 CAGAAAGAAAAGAATGATGGTGG + Intergenic
922708580 1:227807757-227807779 CAAAAAGAAAAGAAAAATAAAGG + Intergenic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
923120393 1:230984701-230984723 AAGAATCAAAAGAAGCAAAATGG + Intronic
923566564 1:235080873-235080895 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
923878604 1:238077746-238077768 CAAAATAAAAAGAAGTAAAAGGG - Intergenic
924413903 1:243837161-243837183 AAAAATAAAAATAAGGATAAGGG + Intronic
924866132 1:247983302-247983324 TGGCATGAAAGGAAGGATAATGG - Intronic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063571802 10:7221987-7222009 GAGAATATAAAGAAAGATAAAGG - Intronic
1063585006 10:7344457-7344479 CAGAAGGCAAAGGAGGAGAAAGG - Intronic
1063621021 10:7649182-7649204 GAGAATGAAAAGAAGGGAGAAGG - Intronic
1063750163 10:8935094-8935116 AAGAAAGAAAAGAAAGAAAAAGG - Intergenic
1063852203 10:10205710-10205732 CAGAAAGAAAGCAAGGGTAAAGG - Intergenic
1064409312 10:15091607-15091629 TAAAAAGAAAAGAAGGAAAAGGG - Intergenic
1064414889 10:15140494-15140516 AAGAAAGAAAAGAAAGAAAAGGG - Intronic
1064624782 10:17251239-17251261 CAAAAAGAAAAAAAAGATAATGG - Intergenic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065337259 10:24665604-24665626 CAGAATAAAAAGGAGCACAAGGG + Intronic
1065510720 10:26475786-26475808 CAGAATGAAAAGCAGTAGCAGGG - Intronic
1066130164 10:32385430-32385452 CAGACTGAAAGCAAGGACAAGGG + Intergenic
1066585631 10:36931492-36931514 CAGAAGGAAAATAAGGGAAAAGG + Intergenic
1066765325 10:38797391-38797413 CAGAATGGAATGGAGGGTAATGG - Intergenic
1067255744 10:44638211-44638233 CAGGAGAAAAAGAAGAATAAAGG - Intergenic
1068059467 10:52049381-52049403 CAGAATCACAAGAGTGATAATGG + Intronic
1068581290 10:58742856-58742878 CTGAATGACAATAATGATAATGG - Intronic
1069196476 10:65556955-65556977 CAGAATGAAAAGCAGGAAAAGGG + Intergenic
1069339660 10:67395641-67395663 CAGAACTAACAGAAGCATAATGG + Intronic
1069356358 10:67590707-67590729 CAAAATGAACAAAAGGAAAATGG - Intronic
1069683538 10:70301552-70301574 CAGACAGAAAAGAAGGACAATGG + Intronic
1070461786 10:76677690-76677712 GAGAATGAGGAGAAGGCTAAGGG - Intergenic
1070729264 10:78814033-78814055 CAGAATGAAGAGCAGGTCAATGG + Intergenic
1070887922 10:79921142-79921164 CAGCAGGAGAAGAAGGAAAAGGG - Intergenic
1070949155 10:80417134-80417156 AAGAATCAAAAGAAGCAAAATGG + Intronic
1071346298 10:84697032-84697054 GAGAAAAAAAAGGAGGATAACGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071751536 10:88482953-88482975 AGGAAGGAAAAGAAGGAGAAAGG - Intronic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1072831207 10:98660696-98660718 CAGAAGGAAAGGAAAGATGAAGG - Intronic
1073626169 10:105099761-105099783 TAGGAAGAAAAGAAGGCTAAGGG + Intronic
1073651847 10:105369067-105369089 GAGAAGGAAGAGAAGGACAAAGG + Intergenic
1073779307 10:106819764-106819786 CAGGAAGAACAGAAAGATAAGGG + Intronic
1073920850 10:108457006-108457028 TAGAAGGATAAGAAGGTTAAGGG + Intergenic
1074094715 10:110301229-110301251 CAGAAGGCAGAGAAGGAAAAAGG + Intronic
1074461350 10:113640338-113640360 CAGGAAGAAAAGAAGAAGAATGG + Intronic
1074570866 10:114622782-114622804 CATAAAGACAAGGAGGATAAAGG + Intronic
1074616792 10:115077674-115077696 CAGAAAGAGAAGAATGATAGAGG - Intergenic
1074841632 10:117358563-117358585 CAGAGGGAAGAGAAAGATAAGGG - Intronic
1074942417 10:118248384-118248406 AAGAAAGAAAAGAAAGAGAAAGG + Intergenic
1075293692 10:121253553-121253575 AAGAATGAAAAGTGGGAAAATGG + Intergenic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1076676756 10:132151094-132151116 GAGAATGAATAGATGGATTATGG - Intronic
1076873921 10:133206757-133206779 CAGAAGGAAAAGAGGAACAAAGG + Exonic
1077627547 11:3786415-3786437 CATAAAGAAAAAAAGGAGAAAGG - Intronic
1077892281 11:6427924-6427946 CAGCATGAAAAGGGGGAAAATGG + Intergenic
1078090456 11:8261779-8261801 TAGAATGAAAAGGAGAAGAAGGG - Intronic
1078153610 11:8779482-8779504 AAGAAAGAAAAGAAAGAAAAAGG - Intronic
1078834727 11:15016395-15016417 CAGAATGGCAAGCTGGATAAAGG + Intronic
1078949378 11:16112281-16112303 CAGAATGCAAAGCAGGTGAAAGG - Intronic
1078982105 11:16547647-16547669 CAGAATGAGAAGTTGGTTAATGG + Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079384514 11:19966916-19966938 CGGAATGAAAAGAGAGAGAAAGG + Intronic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080159783 11:29159951-29159973 GAGAAGGAGAAGAAGGAGAATGG + Intergenic
1080346099 11:31327553-31327575 CATAATGATAATAACGATAATGG - Intronic
1080715375 11:34795086-34795108 CAGTATTAAAAAAAGAATAATGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081295129 11:41377193-41377215 AAGAATGAAAGGAAGAAAAAAGG - Intronic
1081318016 11:41655194-41655216 CAGAAAGAAAAAAAGGAAAGAGG - Intergenic
1081374074 11:42338821-42338843 AAGAAAGAAAAGAAGGAGAGGGG - Intergenic
1081473177 11:43396227-43396249 CAGAAAAAAAAAAAGGAAAAAGG - Intronic
1081674488 11:44960531-44960553 CAGAAGGAAGAGAAAGAAAAAGG - Intergenic
1081828235 11:46079981-46080003 CAGAAGAATATGAAGGATAAAGG + Intronic
1082596090 11:55084348-55084370 CAGAATGAAAAGAAAGGTTTAGG + Intergenic
1082672801 11:56056288-56056310 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1082699234 11:56407624-56407646 AAGAATGAAGATAAGAATAAAGG + Intergenic
1082706727 11:56501512-56501534 GGGAATGAAAAGAAAGACAAAGG - Intergenic
1082720912 11:56675364-56675386 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083060663 11:59867505-59867527 GAGAATGAAAAGATGGTTACTGG + Intergenic
1083422458 11:62562163-62562185 AAGAATCAAAAGAAGCAAAATGG - Intronic
1083816081 11:65133214-65133236 CAGAAGGAAGACAAGGACAAAGG + Exonic
1084348603 11:68576338-68576360 CAGAATGAAAGGAAGGCAAGAGG - Intronic
1084525255 11:69693602-69693624 CAGAAAGGAAAGAAGAATATCGG + Intergenic
1085014503 11:73164180-73164202 AAGAAAGAAAAGCAGGATAAAGG + Intergenic
1085137216 11:74102603-74102625 CAGAAGGAAAACTAGGAAAAGGG - Intronic
1085807663 11:79651078-79651100 GAGAAGGAGAAGAAGGAAAAAGG - Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086726978 11:90198459-90198481 CAAAATGAAGAAAAGGATCAGGG + Intergenic
1086747835 11:90452708-90452730 AAGAATGGAAATCAGGATAAAGG - Intergenic
1086862077 11:91936226-91936248 CTGAATGAAAAAAAGGGAAAAGG + Intergenic
1087315287 11:96595344-96595366 GAAAATGAAATGAAGGAGAAGGG - Intergenic
1087429808 11:98038608-98038630 TAGAATGAAAGGAAGGAGAAAGG - Intergenic
1087458340 11:98415863-98415885 AAGACTGAAAAGAAGGCTTAGGG - Intergenic
1087524251 11:99287991-99288013 CAAAGTGAAGAGGAGGATAAGGG - Intronic
1087623211 11:100565966-100565988 CAGAATGAAGAGATAGAAAAAGG - Intergenic
1087890967 11:103537524-103537546 CAGAAAAAAAAAAGGGATAATGG + Intergenic
1087982580 11:104634361-104634383 TAGAAGGAAAAGAATGAGAAAGG + Intergenic
1088838396 11:113600084-113600106 AAGAAAGAAAATAAAGATAAAGG + Intergenic
1089079917 11:115767018-115767040 AACAAAGAAAAGAAGGATAGGGG + Intergenic
1089101378 11:115965435-115965457 GAAAAAGAAAAAAAGGATAATGG + Intergenic
1089202531 11:116733037-116733059 GCGAATGAAAAGTAGGGTAAAGG - Intergenic
1090031365 11:123209424-123209446 CAGGATGACAAGAAGAATTATGG + Intergenic
1090061742 11:123469695-123469717 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1090399887 11:126442448-126442470 GAAAATGAAAACCAGGATAAAGG + Intronic
1090548025 11:127787050-127787072 TAGAATGAAAAGAACTATCATGG + Intergenic
1092225134 12:6743507-6743529 CAGAATGAAAACAAAGCAAAAGG - Intergenic
1092310770 12:7349571-7349593 GAGAATGAAAAGATGTATAAGGG + Intronic
1092514541 12:9195415-9195437 GAAAAGGAAAAGAAGGAAAAAGG - Intronic
1092697107 12:11184630-11184652 CAGATTGTAAATAAGGCTAAGGG - Intergenic
1093058256 12:14576699-14576721 TAAAATGAAAAGGAAGATAAAGG + Intergenic
1093215110 12:16352858-16352880 AAGAAGGAGAAGCAGGATAATGG - Intronic
1093305461 12:17512252-17512274 CAGAAGGAAAAGAAGTGAAATGG - Intergenic
1093568414 12:20636023-20636045 AAGAAAGAAAAGAAAGATGAAGG + Intronic
1093764619 12:22948625-22948647 CAGAATGTAAAGCTGGATAAGGG + Intergenic
1093914486 12:24786135-24786157 CACAATGAAAAGAAGTATCCTGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094035719 12:26068357-26068379 TAGAAGAAAAAGAAGGAAAAGGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094306955 12:29031088-29031110 CAGAATGAACAAAAGCATAGAGG + Intergenic
1094430302 12:30360974-30360996 CACAATAAAAAGAAGAATATAGG - Intergenic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1094613275 12:32013947-32013969 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1094719509 12:33049019-33049041 CAGGAGGAAAAGAAAGAGAAAGG - Intergenic
1094799051 12:34008867-34008889 CAGTATGCTAAGAAGAATAATGG - Intergenic
1095111803 12:38302993-38303015 CAGTATGCTAAGAAGAATAATGG - Intergenic
1095429646 12:42119427-42119449 CAGAAAGAGAAGAAAGAGAAAGG + Intronic
1095647110 12:44560471-44560493 CATAATTAAAAAAATGATAAAGG + Intronic
1095996049 12:48085490-48085512 CAAAATGTAAAGAAGGCTGATGG - Intronic
1096356955 12:50949293-50949315 AAGAAGAAAAAGAAGGACAAAGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1096985796 12:55756163-55756185 CAGACAGAAAAGAGGGAAAAGGG + Exonic
1097132528 12:56823169-56823191 AAGAAAGAAAAGAAAGAAAAAGG - Intergenic
1097586467 12:61521842-61521864 CAGAATGAAAAGCAGGACACTGG + Intergenic
1097734707 12:63168954-63168976 CAAAATAAAAAGAATGATAGAGG - Intergenic
1097861222 12:64520718-64520740 CATAATGGAAAGAAGGACATTGG + Intergenic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1097913853 12:64999315-64999337 CAGCATGAAAAAAATGTTAAGGG + Intergenic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098367898 12:69724561-69724583 GAGAAAGAAAAGAAACATAAGGG - Intergenic
1098530326 12:71534452-71534474 CCAAATGGAAATAAGGATAATGG - Intronic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1098811599 12:75101267-75101289 CAGTGTGAAAAGAAGTTTAATGG - Intronic
1099074687 12:78091957-78091979 CATAATGGAAAGAACGAAAATGG + Intronic
1099109036 12:78533762-78533784 AAGAAAAAAAAAAAGGATAATGG + Intergenic
1099344255 12:81478259-81478281 CACAATAAAAAAAATGATAAAGG - Intronic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099798492 12:87428125-87428147 CTGAATGAAAAAAAGTATTAGGG + Intergenic
1100095220 12:91025748-91025770 AAGAATGAAAAGATGCAGAATGG + Intergenic
1100445791 12:94658241-94658263 CAGAAAGAAGACAAGGAAAAGGG + Intergenic
1100469197 12:94874510-94874532 CAGAATCTAAAGAATGGTAAAGG - Intergenic
1100711011 12:97256998-97257020 AGGGATGAAAAGAAGGATAATGG - Intergenic
1100745149 12:97637422-97637444 AAGAATGAAAAGAAGAAGGAAGG - Intergenic
1100936093 12:99668283-99668305 GAGAATGAATAGAATAATAAAGG - Intronic
1101746710 12:107547198-107547220 AAGAAGGAGAAGAAGGAGAAGGG + Intronic
1102012772 12:109628781-109628803 CAGAGAGAAAAGAAAGAAAAAGG - Intergenic
1102667081 12:114583777-114583799 CAGGAGGAAAAGAAAGAAAAGGG - Intergenic
1102755827 12:115339423-115339445 GAGAAAGAAAAGAAGGAAACTGG - Intergenic
1103079721 12:118014171-118014193 GAGAATGAAAAGAATTATAAAGG - Intronic
1103698217 12:122834298-122834320 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
1103802869 12:123550763-123550785 GCAAAGGAAAAGAAGGATAAAGG + Intergenic
1104301961 12:127572372-127572394 GAGAAGGAGAAGAAGGAGAAGGG + Intergenic
1104739410 12:131162061-131162083 CAGAAGGTAGAGAAGGATAATGG - Intergenic
1106041487 13:26097644-26097666 AAGAATGAAAAGCAGGGCAATGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106947082 13:34840395-34840417 AAGGAGGAAGAGAAGGATAAAGG + Intergenic
1106972515 13:35159529-35159551 AAAAATGAAGAAAAGGATAATGG + Exonic
1107170477 13:37336239-37336261 CAGCATGTAAAGAATAATAATGG - Intergenic
1107270086 13:38605890-38605912 AATAATGAAAAGAATGATAGAGG - Intergenic
1107731607 13:43354839-43354861 CAGGATAAAAAGAGGCATAAAGG - Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1107904908 13:45052924-45052946 CAGAATGAAAAGGAGGACATAGG + Intergenic
1108334400 13:49424160-49424182 CAGCATGAAAAGAGGGGTAATGG + Intronic
1108686009 13:52819065-52819087 AAGAAAGAAAAGAAGGAGAAGGG - Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1109033458 13:57224226-57224248 AAGAATGAAAGGAGGGAGAAAGG + Intergenic
1109246310 13:59957949-59957971 CAAAAAGAAAAGAAGATTAAAGG + Intronic
1109405288 13:61890058-61890080 CACAATGAAAAGAAATATCATGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109847613 13:68016380-68016402 CATAAAGAGAAGAAGGAAAAAGG - Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1109971750 13:69779417-69779439 GAGAAAGGAAAGAAGGAAAAAGG - Intronic
1110583025 13:77154353-77154375 GAGGAAGAAAAGAAGGAAAAAGG + Intronic
1110590287 13:77249073-77249095 CAGAAAGAAAACAAGAATAGTGG + Intronic
1110602625 13:77393212-77393234 CAGAATGAAAAGCAATGTAAAGG - Intergenic
1110958860 13:81594650-81594672 CAGATTGAGAAGAAGTATACTGG + Intergenic
1111034204 13:82649658-82649680 CAAAATGAAAAGCAAGTTAAAGG - Intergenic
1111076073 13:83237227-83237249 CAGAAAGAAAGGTATGATAAAGG - Intergenic
1111116683 13:83787523-83787545 CAGAATGAAACGAGAGAGAAAGG - Intergenic
1111353794 13:87070324-87070346 AAGAAGGAGAAGAAGGAGAAGGG - Intergenic
1111513075 13:89291739-89291761 CAGATTGAAAATAAGGGTATGGG - Intergenic
1111973823 13:94945100-94945122 AAGAAAGAAAAGAAAAATAAGGG - Intergenic
1111988255 13:95087662-95087684 CAGGATGAATAGAAGCAAAAGGG + Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112182867 13:97102613-97102635 CAGAAGGAAAGGAAGGACAGGGG + Intergenic
1112301877 13:98238549-98238571 CAGAAGGCAAAGGAGGAGAAAGG + Intronic
1112474667 13:99720058-99720080 TACAATGAAAAGCAGGAAAAGGG - Intronic
1112779826 13:102887669-102887691 AAGAATGAATAGCAGGAAAATGG + Intergenic
1112883127 13:104133971-104133993 CAGAGTGTAAAGAAGGAGATGGG + Intergenic
1113387816 13:109866738-109866760 AAGAAAGAAAAGAAGGAAAGAGG + Intergenic
1113865700 13:113521620-113521642 GAGAATGAAAAGAAGGATCGGGG - Intronic
1114821521 14:26025756-26025778 GAGAATGAAAAAAAGGTTAAGGG - Intergenic
1115293384 14:31798126-31798148 CAGGATGGTAAGAAAGATAAGGG - Intronic
1115560564 14:34578995-34579017 CAGAATGACAAAAATTATAAAGG + Intronic
1115593422 14:34886170-34886192 CAGAATCAAAAGCAGGTTCAGGG - Intergenic
1115634277 14:35276321-35276343 AAGAATGAGAAGAAGGAACAGGG + Intronic
1115903790 14:38184536-38184558 CAGAATGGAAATGAGGAAAATGG - Intergenic
1116232722 14:42237847-42237869 AAAAAAGCAAAGAAGGATAAAGG - Intergenic
1116487163 14:45463894-45463916 CATTATGAAAAGTAGGATAAAGG - Intergenic
1116830953 14:49719130-49719152 CAGAAGGAAGAAAATGATAAAGG - Intronic
1116965614 14:51011647-51011669 AAAAATGAAAAGAAGGAACAAGG - Intronic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117042954 14:51784424-51784446 CAGGAAGGAAATAAGGATAAAGG + Intergenic
1117452815 14:55867349-55867371 CAGTATCAAAAGAACAATAAGGG - Intergenic
1117896589 14:60493998-60494020 CACAATGAAAAGAGGGACACTGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118579561 14:67280879-67280901 AAGAAAGAAAAGAAAGAAAAGGG - Intronic
1118636932 14:67756499-67756521 CAGATAGAAAATAAGGATCAAGG - Intronic
1119123018 14:72097567-72097589 AAGAATGAAGAGGAGGAGAAGGG + Intronic
1119727024 14:76927631-76927653 CAGAAAGAAAAGAAGCAAAAAGG - Intergenic
1119926988 14:78504001-78504023 CAGAATGAAAGGAAGTTTAATGG + Intronic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1120170417 14:81243518-81243540 CAGAAGGAAAAGAAGAGAAAAGG - Intergenic
1120546004 14:85812296-85812318 CAGACAGAAATGAAGCATAAAGG - Intergenic
1120696522 14:87650906-87650928 CAGAATGAAGGGAAGAAGAAGGG - Intergenic
1121058686 14:90883228-90883250 CAGAAGGAGAAGAAAGAGAAAGG - Intronic
1121448116 14:93991031-93991053 CAGCATGAAAAGAACACTAATGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121806882 14:96835348-96835370 CAGAAAGAAAACTAGGAAAAAGG - Intronic
1121925703 14:97925505-97925527 CAGAATGAACAGATGGGTAATGG - Intergenic
1121932793 14:97988409-97988431 CAGAATGTAAAGGAGGCAAAAGG + Intergenic
1122013684 14:98774753-98774775 AAGAAAGAAAAGAAAGAAAAAGG - Intergenic
1122187180 14:100008553-100008575 CAGAAGAAAAAGAAGGGTAAAGG - Intronic
1122298464 14:100718624-100718646 CAGAAGGAAAAGAGAGAGAAAGG - Intergenic
1123153983 14:106207022-106207044 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1123627033 15:22234354-22234376 AAGAATGAGAAGATGGATATTGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124083773 15:26526799-26526821 CAGAAATAAAAGAATTATAAAGG - Intergenic
1124427477 15:29574044-29574066 CAGAAAGAAGGGAAGGAGAAAGG + Intergenic
1124442135 15:29693736-29693758 CAGAAGGAAAAGAGAGAAAAGGG + Intergenic
1125190093 15:36981817-36981839 CAGAATGAAAAGGCAGAGAATGG + Intronic
1125602777 15:40924628-40924650 CAGAAGGAAATGAAGGAAAAAGG - Intergenic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1126219412 15:46195592-46195614 CAGAATGGGAAGCTGGATAAAGG - Intergenic
1126412232 15:48384203-48384225 CAGAATGAAGAAACTGATAATGG + Intergenic
1126494548 15:49276441-49276463 CATAAAGAAAAGAAGCATACTGG - Intronic
1126822191 15:52515296-52515318 AAGAAAGAAAAAAAAGATAAGGG + Intronic
1126838330 15:52690832-52690854 CAGACTGAAAATAAAGATACAGG + Intronic
1126862278 15:52897137-52897159 AGGAATGAAATGAAGGATCAAGG - Intergenic
1128830955 15:70768069-70768091 TAGAATGAGAAGAAGAAAAAGGG + Intergenic
1128950502 15:71875802-71875824 AAGAAAGAAAAGAAGGAAAAAGG - Exonic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129955536 15:79633406-79633428 CAGAAAGAAAATAATGACAAGGG - Intergenic
1131072549 15:89475217-89475239 AGGAAAGAAAAGAAGGAAAAAGG - Intronic
1131412319 15:92220121-92220143 CAGGAAGAAAGGAAGGTTAAGGG - Intergenic
1131950340 15:97674543-97674565 CAGAAGGAAAAGAAAGACAAAGG - Intergenic
1132329957 15:101005387-101005409 CAGATTAAAAACAATGATAATGG + Intronic
1133126354 16:3648925-3648947 CAAAATGAAAAGAAGAAGAGAGG - Intronic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133534000 16:6682813-6682835 CAGAATTGAAAACAGGATAAAGG + Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1135149064 16:19989503-19989525 GAGAAAGAAAAGAAGGAGAGAGG - Intergenic
1135177574 16:20244372-20244394 AAGAATGAAAGGAAGGAAAGAGG - Intergenic
1135502324 16:23007312-23007334 AAGAATGAATAGAAGGACATTGG + Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1136714314 16:32264613-32264635 CCAACTGAAAAGGAGGATAATGG - Intergenic
1136753576 16:32664804-32664826 CCAACTGAAAAGGAGGATAATGG + Intergenic
1136814537 16:33205561-33205583 CCAACTGAAAAGGAGGATAATGG - Intronic
1136821013 16:33315641-33315663 CCAACTGAAAAGGAGGATAATGG - Intergenic
1136827576 16:33372180-33372202 CCAACTGAAAAGGAGGATAATGG - Intergenic
1136832642 16:33470951-33470973 CCAACTGAAAAGGAGGATAATGG - Intergenic
1136923686 16:34351492-34351514 CATAATGAATAAAAGGAAAATGG - Intergenic
1136948915 16:34691272-34691294 GAGAATGATAAAAAGGATGAAGG + Intergenic
1136980887 16:35060314-35060336 CATAATGAATAAAAGGAAAATGG + Intergenic
1137218732 16:46426862-46426884 GAGAAAGAAAAGAAAGAAAAAGG - Intergenic
1137259798 16:46816578-46816600 CAGAAAGTAAAGAAAAATAAAGG + Intronic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138032153 16:53568099-53568121 AAGAAAGAAAAGAAGAAAAAAGG - Intergenic
1138600533 16:58051510-58051532 AAGAAGGGAAAGAAGGAGAAAGG + Intergenic
1139162503 16:64528074-64528096 CAGAAATAAAATAAGGTTAAGGG - Intergenic
1139592123 16:67938997-67939019 CAGAGTGACAAGAAGAGTAATGG - Intergenic
1139792488 16:69450829-69450851 AAGAAGGAGAAGAAGGAAAATGG - Intronic
1140100242 16:71910075-71910097 GACAATGAAAACATGGATAAGGG - Intronic
1140350672 16:74259351-74259373 CAGAATGAAAAGAAAAAAACAGG - Intergenic
1141833870 16:86525460-86525482 CTGAAAGGAAAGAAGGCTAAGGG + Intergenic
1142098224 16:88256855-88256877 AAGAAAGAAAGGAAGGAAAAAGG - Intergenic
1202993113 16_KI270728v1_random:28535-28557 CCAACTGAAAAGGAGGATAATGG - Intergenic
1203055735 16_KI270728v1_random:925156-925178 CCAACTGAAAAGGAGGATAATGG + Intergenic
1142768432 17:2079364-2079386 GAGCAAGAAAAGAAGCATAAGGG + Intronic
1142904611 17:3033645-3033667 CAGGATGAATAGGATGATAAAGG - Exonic
1143112739 17:4561521-4561543 GAGAAAGAAAAGAAAGGTAAAGG - Intergenic
1143208060 17:5160117-5160139 AGGAATCAAAAGAAAGATAATGG - Intronic
1143520446 17:7441363-7441385 GAGAATGAAAGGAAGGAAGAGGG - Intronic
1143967991 17:10770647-10770669 CAGAATGGAAAGATGGATTCGGG - Intergenic
1144404459 17:14939460-14939482 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
1145184947 17:20785951-20785973 CAAAGTGAAAAGGAGGACAATGG - Intergenic
1145333063 17:21889097-21889119 CAGAATGGAAAGGAGTGTAATGG + Intergenic
1145696018 17:26788524-26788546 CAGAATGGAATGGAGGGTAATGG + Intergenic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1146061233 17:29608416-29608438 CAGAGTGAAGAGAATAATAATGG - Intronic
1146175452 17:30663465-30663487 CAGAAGGAAAAGAAGGTTGAGGG - Intergenic
1146203449 17:30881083-30881105 AAGAATGAAAAAAAAGAAAAAGG - Intronic
1146348903 17:32079511-32079533 CAGAAGGAAAAGAAGGTTGAGGG - Intergenic
1146433758 17:32823166-32823188 CAGAAAGAAAACGAGGAAAAGGG - Intronic
1146503836 17:33387461-33387483 CAGAAAGAGAAAAATGATAAAGG - Intronic
1146564597 17:33901480-33901502 CAGAATGAAAAAGAGGAATAAGG - Intronic
1146827136 17:36032624-36032646 GAGAAAGTAAAGAAGGATATTGG - Intergenic
1147179610 17:38675826-38675848 CAGAAACTAAAGAAGGTTAAGGG - Intergenic
1148194044 17:45700465-45700487 CAGACTGGGAAGCAGGATAAGGG - Intergenic
1148370382 17:47095335-47095357 CAAAATGAAAAAAAAGAAAAAGG + Intergenic
1149028760 17:52061049-52061071 AAGTATGAAAAAAAGAATAATGG + Intronic
1149095442 17:52834627-52834649 AAGAAAGAAAACAAGGAAAAAGG + Intergenic
1149259320 17:54861705-54861727 ATGAATGAAATGAAGGAAAATGG - Intergenic
1149436515 17:56638214-56638236 TGGAAAGAAAAGAAGTATAAGGG + Intergenic
1149662464 17:58341992-58342014 GAGAAAGAAAAGAAAGAAAAAGG + Intergenic
1149872308 17:60193894-60193916 AGGAATCAAAAGAAAGATAACGG + Intronic
1149912003 17:60575346-60575368 CAGCAAGAAAATAAGAATAAAGG - Intronic
1150522914 17:65888314-65888336 TAGCATGATAAGTAGGATAAAGG - Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150555893 17:66253724-66253746 CAAAAAGAAAAAAAAGATAAAGG + Intronic
1150670090 17:67187252-67187274 CAGAATAAAAACAAGTAAAAGGG + Intronic
1151205743 17:72505454-72505476 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
1203199072 17_KI270729v1_random:258910-258932 CAGAATGAAATGGAGTGTAATGG + Intergenic
1203208673 17_KI270730v1_random:59650-59672 CAGAATGAAATGGAGTGTAATGG + Intergenic
1153289749 18:3489127-3489149 AAGAAAGAAAAGAAAGAAAAAGG - Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153443507 18:5147201-5147223 CAGAAGGAAAAGAAGGAGCTTGG + Intronic
1153480392 18:5542650-5542672 CAGAACAAATAGAATGATAAAGG - Intronic
1154062919 18:11080506-11080528 CAGAATGAATAAAGGAATAAAGG + Intronic
1155000597 18:21682137-21682159 CAAAAGGAAATGAGGGATAATGG + Intronic
1155156092 18:23158889-23158911 CAGAAGGAAAGGAAGGGAAATGG - Intronic
1156052022 18:32948597-32948619 CAGATTGCAAAGAAGTAAAATGG - Intronic
1156249068 18:35333488-35333510 CATAATTAAAAAAAGGAAAATGG + Exonic
1156662645 18:39364771-39364793 CAGAATCTTAAGAAGGATGATGG - Intergenic
1156666892 18:39419695-39419717 CACAATAAAAAGAAAAATAATGG - Intergenic
1156759677 18:40573199-40573221 CAGAAAGAAAGGAAACATAAAGG + Intergenic
1156797771 18:41069089-41069111 CAGTATTAAAAAGAGGATAAAGG + Intergenic
1156942382 18:42784294-42784316 TAAAATGAAATGAAAGATAAAGG + Intronic
1157013651 18:43682627-43682649 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1157017943 18:43741808-43741830 CAGAATAAAAAAAAGGATCTTGG + Intergenic
1157442525 18:47721686-47721708 CAGAATAAAAGGAAGGAAAGAGG + Intergenic
1157956900 18:52108783-52108805 CAGAATGAAAAAAACAAAAAAGG + Intergenic
1158238542 18:55349546-55349568 AAGAATGAAAAAAAGGAGGAAGG + Intronic
1158276071 18:55768930-55768952 GAGAATGAAAAGAAAGATGGTGG - Intergenic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158431510 18:57391564-57391586 CAGAAAGAAAAGGATGCTAATGG + Intergenic
1158983093 18:62784486-62784508 CAGAAGGAAGAGAAGTTTAAGGG + Intronic
1159335631 18:67061874-67061896 CAGAATGCAAAGACAGATTATGG + Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159719221 18:71865457-71865479 CACAATGAAAAGAAAACTAAAGG - Intergenic
1159759079 18:72402289-72402311 AAGAATGAAAGGAAGGAAATGGG - Intergenic
1160406164 18:78647734-78647756 CAGAATGAAGAATAAGATAATGG + Intergenic
1161277606 19:3427447-3427469 TAGAAAGAAAAGAAGGAGAGAGG + Intronic
1161449433 19:4336614-4336636 AAAAAAGAAAAGAAAGATAATGG - Intronic
1162131847 19:8530736-8530758 CATAAAGAAAAGAAGAAAAAGGG + Intronic
1162262909 19:9547144-9547166 TAGAATTAATATAAGGATAAAGG - Intergenic
1162299950 19:9838810-9838832 CAGATGGAAAAGAAAGAGAATGG - Intronic
1162673568 19:12279885-12279907 CAGAAAGAAAAAAATGATATGGG + Intronic
1162803424 19:13123552-13123574 AAGAATGAAAAGAATGAAGAAGG + Intronic
1162983519 19:14254446-14254468 CAGAAGGAAAAGAAGGTTGAGGG + Intergenic
1163543573 19:17927025-17927047 CAGAAAGAAAAGAAAGGGAAAGG + Intergenic
1163781495 19:19251716-19251738 AAGATTGAAGACAAGGATAAGGG - Exonic
1164628951 19:29748703-29748725 AAGAAAGAAAAGAAAGAAAATGG + Intergenic
1164800675 19:31073653-31073675 GAGAAAGAGAAGAAGGAAAAAGG - Intergenic
1164913338 19:32029772-32029794 CAGAAGCAAAAGAAGATTAAGGG + Intergenic
1165398048 19:35577963-35577985 CAGATTGAATATAAGTATAATGG + Intergenic
1165572523 19:36787423-36787445 CAAAAAGAAAAGAAAGAAAATGG - Intergenic
1165897900 19:39154572-39154594 GAGAAGGAAAAGAAGGAAAAGGG + Intronic
1166171689 19:41032158-41032180 CAGAGTGATGACAAGGATAAAGG + Intergenic
1167077492 19:47258300-47258322 CAGAGGGAAAAAAAGGACAAAGG - Intronic
1167230970 19:48283014-48283036 CTTAATGAAAAGAAAAATAAAGG - Intronic
1167590945 19:50403918-50403940 CATAAGGAAAAGAATCATAATGG + Intronic
1167715387 19:51139666-51139688 GAGAATTAAAAGTTGGATAAAGG + Intergenic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167980599 19:53272099-53272121 CAAAGTGAGAAGAAGTATAAAGG - Intergenic
1168359307 19:55725500-55725522 CAGAATCAAAACACAGATAAGGG + Intronic
925021967 2:577574-577596 CAGGATGATTAAAAGGATAAAGG - Intergenic
925205547 2:2002908-2002930 CAGAAGGTAAAGAAGGAGCAAGG - Intronic
925218272 2:2116210-2116232 CAGAAGGCAAACAAGGACAAAGG - Intronic
925256202 2:2490784-2490806 TAGAAAGAAAAGAAGTTTAATGG + Intergenic
925467279 2:4118026-4118048 CACAATAAAAAAAATGATAATGG - Intergenic
925473697 2:4189589-4189611 CATACTGAAATGAAGGACAAGGG + Intergenic
926072636 2:9911536-9911558 CATAATGAAAAGAACAAAAAAGG + Exonic
926188740 2:10711577-10711599 CACCATAAAAAGAAGGGTAAAGG + Intergenic
926537526 2:14131583-14131605 CAAAATGAAGGTAAGGATAATGG + Intergenic
926539899 2:14163013-14163035 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
926862333 2:17322185-17322207 CAGAAGGCAAAGGAGGAGAAAGG - Intergenic
926919690 2:17928169-17928191 CATAATGAAAAGAACTATAAAGG - Intronic
927005575 2:18844494-18844516 CAGAATAATAAGCAGGATAAGGG - Intergenic
927079836 2:19616473-19616495 CAGAAAGGAAGGAAGGACAATGG + Intergenic
927503765 2:23599951-23599973 CAGAATGAAAAGGGGGATGGGGG - Intronic
927740887 2:25568821-25568843 CAGAATGAAGGGGAGGAGAACGG - Intronic
927890674 2:26746225-26746247 CAAAATGATAAGCAGAATAAAGG - Intergenic
928498610 2:31862984-31863006 AAGAAAGAAAAGAGGGAAAAAGG + Intergenic
928583835 2:32737354-32737376 CAGAATTTTAAGAAGAATAAGGG + Intronic
928591214 2:32817264-32817286 AAGAAGAAGAAGAAGGATAAAGG + Intronic
928674368 2:33635998-33636020 CAACATGAACAGAAGCATAAAGG - Intergenic
929179604 2:39022226-39022248 AAGAAAGAAAAAAAAGATAAAGG + Intronic
929892622 2:45930981-45931003 CAGGAGGAAATGAAGGATCAGGG - Intronic
929964336 2:46522284-46522306 CAAAAAAAAAAAAAGGATAATGG + Intronic
931733039 2:65170000-65170022 AAGAAGAAAAAGAAAGATAAAGG + Intergenic
931809775 2:65843544-65843566 CAAAATGGAAAGAAAGAAAAAGG - Intergenic
931873278 2:66484388-66484410 GAGAATGAATAGAAAAATAAAGG - Intronic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932034426 2:68227922-68227944 CAGATTGGAAAGAAGAAAAACGG - Intronic
932320046 2:70815343-70815365 CAGAACAAAAAGAAGGGAAAAGG - Intronic
932372477 2:71202624-71202646 TAAAATGAATATAAGGATAAAGG + Intronic
932750815 2:74370614-74370636 GAGATTGAAGAGAAGGGTAAGGG - Exonic
933013619 2:77094726-77094748 CAGAATCAAAAGAATGAAATTGG + Intronic
933449301 2:82426208-82426230 GGGAAAGAAAAGAAGGATGATGG + Intergenic
933460739 2:82581196-82581218 TAGAAAGAAAAGAAGAAAAATGG - Intergenic
933503202 2:83142869-83142891 CAGTATGGAAAGAAGGGAAATGG + Intergenic
933798833 2:85943496-85943518 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
934192470 2:89812312-89812334 CAGAATGGAAAGAAGTGTAATGG - Intergenic
934668877 2:96195009-96195031 TAGAATGAAAAGAAAGAATAAGG + Intronic
934918639 2:98322126-98322148 CAGAAAGGAAAGAAGTGTAATGG - Intergenic
934996469 2:98966068-98966090 CAAAATGAAAAAAAAGTTAAAGG - Intergenic
935182178 2:100701143-100701165 CCCAATGAAGAGAAGGATCAAGG - Intergenic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935458747 2:103302410-103302432 GAGAGTGAAAGGAAGGAAAAAGG + Intergenic
935539827 2:104336213-104336235 GAGCATGAAAAGAAGAAAAAGGG - Intergenic
936028359 2:109051650-109051672 AAGAAAGAAAAGAAGGAAAAAGG + Intergenic
936225536 2:110646340-110646362 CAGAAAGAAAAGAAGGGGAGGGG + Intronic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936735708 2:115440683-115440705 AAGAATCAAAAGAAGCAAAATGG + Intronic
936801173 2:116268588-116268610 AAGAATCAAAAGAAGCAAAATGG - Intergenic
936995393 2:118409030-118409052 CAGAATTAGAAGAAGCAAAATGG - Intergenic
937006647 2:118522584-118522606 CAGAAAGAAAAGAAGGCACAAGG + Intergenic
937777488 2:125797057-125797079 CACAATAAAAAGAATCATAAAGG + Intergenic
937792188 2:125973622-125973644 CAGAATGGAAAAAAAAATAATGG - Intergenic
938320672 2:130360163-130360185 AAGAAGGAAAAGTAGGACAAGGG - Intronic
938323532 2:130381687-130381709 CACAGTGAAAAGACGGACAAGGG + Intergenic
938594405 2:132772739-132772761 ACGAATGAAAAGAATAATAATGG + Intronic
938652861 2:133401711-133401733 CATAATTAAAAAAAGGATATTGG + Intronic
939183736 2:138835039-138835061 CTGAATGAAAAGAAAGGAAATGG + Intergenic
939285098 2:140119217-140119239 TAGATTGAAAAGAAAGAAAAAGG - Intergenic
939290431 2:140187501-140187523 CAGAAAGAAAAAAATGAAAATGG - Intergenic
939451798 2:142384004-142384026 AAGAAGGAAAAGAAGGAGAAAGG - Intergenic
939472385 2:142640115-142640137 TAGAAAGAAAAGAAGGAAGAAGG - Intergenic
939569295 2:143821563-143821585 CATAATGAAAGAAAGGAAAAGGG + Intergenic
939688480 2:145228147-145228169 AATAAAGAAAAGAAGGTTAATGG + Intergenic
939947279 2:148425177-148425199 CACAATAAAAAAAATGATAAAGG + Intronic
940090194 2:149906904-149906926 TTGACTGAAGAGAAGGATAATGG - Intergenic
940264571 2:151822875-151822897 CAAAAGGAAATGAAGGAAAAGGG - Intronic
941255282 2:163221738-163221760 GAAAATTAAAAGAAGGAAAAGGG - Intergenic
941388343 2:164880669-164880691 AAAAATTAAAAGAAGGATAATGG + Intergenic
941390674 2:164910122-164910144 CAGAATGAAGAGTAAGAGAAGGG + Intronic
941706669 2:168665563-168665585 GAAAATGAAGAGAAGGTTAAGGG - Intronic
941774087 2:169373011-169373033 CAGAATGAAAAGGAAGAAAACGG - Intergenic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942275815 2:174322695-174322717 CAGGAAGAAAAGAAGAAAAAGGG + Intergenic
942644265 2:178094048-178094070 CAGAAGGAAAATAAGGATGATGG - Intronic
942678054 2:178449774-178449796 CAGAATCAAAAGTAGCACAATGG + Intronic
942944569 2:181658220-181658242 CATATTGAAAAGAAGGAGTAGGG + Intronic
942978963 2:182055429-182055451 CAGGAAGAAAAGAAGAATAATGG - Intronic
943424035 2:187706995-187707017 CAGAAAGAAACCATGGATAAAGG + Intergenic
943467450 2:188245945-188245967 CAGAAAGACAGGAATGATAAAGG - Intergenic
943825028 2:192379257-192379279 CAAAATGGAAAGAAAGAGAAAGG - Intergenic
943826857 2:192405805-192405827 AATAATGGAAAGAAGAATAAGGG - Intergenic
943994862 2:194749737-194749759 CACGATGGAAAGAAGGATATTGG + Intergenic
944039568 2:195338520-195338542 GAGAAAGAAAAGAGGGAAAAAGG - Intergenic
944094436 2:195950458-195950480 CACAATAAAAAAAATGATAAAGG - Intronic
944162887 2:196685179-196685201 CAGAATAAAAGAAATGATAAGGG - Intronic
945094938 2:206209946-206209968 AAGAAAGAAAAGAAAGAAAAGGG - Intronic
945145082 2:206729566-206729588 CAAAAAGTAGAGAAGGATAAAGG + Intergenic
945483943 2:210371962-210371984 AAGAATAAAAAGAATTATAATGG - Intergenic
945609119 2:211976020-211976042 AAGAATGAAATGAACTATAATGG - Intronic
945668105 2:212767330-212767352 AAGAAAGATAAGAAAGATAAAGG + Intergenic
947048880 2:226019712-226019734 CAGAATGAGAACAAAGAGAAGGG + Intergenic
947069573 2:226272696-226272718 AATAATGAAATAAAGGATAAAGG + Intergenic
947227085 2:227851023-227851045 CATAATGAAAGGAAGGATGAAGG - Intergenic
947576678 2:231280796-231280818 CCAATCGAAAAGAAGGATAAAGG + Intronic
947861106 2:233358162-233358184 TAGAATGGAAAGAAAGAAAATGG + Intronic
948543631 2:238708857-238708879 GAGAAGGAAAAGGAAGATAAAGG - Intergenic
1168735071 20:127725-127747 CAGAAGGAGAAGAAAGAGAAAGG + Intergenic
1168826994 20:820449-820471 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1169129422 20:3157521-3157543 CAGAATGGCAAGAAGGATGTGGG + Intronic
1169185974 20:3617676-3617698 CACAATGAAAAGAATAATACAGG + Intronic
1169575686 20:6958200-6958222 CTGACTGAAAAGAAGTAGAAAGG - Intergenic
1169688296 20:8301621-8301643 CAGCATGACCAGAAGGACAATGG - Intronic
1169690099 20:8320859-8320881 GAGAAAGAAAAGAAAGAAAAAGG + Intronic
1170056242 20:12207390-12207412 CAGAAAGAAAAGAGAGATTAAGG - Intergenic
1170994633 20:21340641-21340663 CAGAAAGGAAAGAAGGGCAATGG - Intronic
1172529072 20:35618040-35618062 CAGAAGGAAAAGGAAGAGAATGG - Intronic
1173185422 20:40836590-40836612 CAGAGTGTAGAGGAGGATAAAGG - Intergenic
1173564949 20:44032036-44032058 AAGAAAGAACAGAAGCATAATGG + Intronic
1173736456 20:45364871-45364893 AAGAATTAAAAGAAGAAGAATGG + Intronic
1174289176 20:49495350-49495372 CATAATTAAAAACAGGATAATGG + Intergenic
1174598321 20:51702676-51702698 CAGAATGAAAAAATCGGTAAGGG + Intronic
1175124231 20:56739603-56739625 CAGAAACAAAAGGAGGACAAAGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175658417 20:60792051-60792073 GAGAATGAAGAAAAGGAAAAGGG - Intergenic
1176219261 20:63962295-63962317 AAGAATGAAGTGAAGGAGAAAGG - Exonic
1176358916 21:5976185-5976207 CAGAATGAAGGGAAGAATAAAGG - Intergenic
1176685282 21:9842816-9842838 CTGAAGAAAAATAAGGATAAGGG + Intergenic
1177101600 21:16903859-16903881 TAGTATGAAAATAAGGAAAATGG + Intergenic
1177223524 21:18223700-18223722 CATAATTAAAAAAAGGAGAAAGG + Intronic
1177253704 21:18631407-18631429 CAGAATGAAAAAAAATAAAAAGG - Intergenic
1177437213 21:21070967-21070989 CAGAAGGAAAAGAAGGCAAATGG + Intronic
1177618094 21:23551191-23551213 CAGAATGAAAAATAGAATATTGG - Intergenic
1178058962 21:28830905-28830927 CAGAAAGAATAGAAGGTGAAAGG + Intergenic
1178076492 21:29017666-29017688 GAAAAAGAAAACAAGGATAAGGG + Intronic
1178125845 21:29514866-29514888 CACATTCAAAAGAAGGAAAATGG - Intronic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1179142510 21:38738542-38738564 CAGAAGGCAAAGGAGGAGAAAGG - Intergenic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1179764602 21:43562365-43562387 CAGAATGAAGGGAAGAATAAAGG + Intronic
1180340350 22:11613011-11613033 GAGAAAGAAAAGAAAGAAAATGG - Intergenic
1180607078 22:17066999-17067021 AAGAAAGAAAAGAAAGAAAACGG + Intergenic
1180884304 22:19229595-19229617 CACAATGAAAAAAAGAAGAAAGG + Intronic
1181507202 22:23367617-23367639 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1181529050 22:23505782-23505804 AAGAATGAAAAAACAGATAAGGG - Intergenic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1182818685 22:33193011-33193033 TAAAATGAAAAGTAGGACAATGG - Intronic
1183148265 22:36015850-36015872 AAGAAGGAAAAGAAAGAAAAAGG + Intronic
1183169540 22:36176475-36176497 TGGTATAAAAAGAAGGATAAGGG - Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1185174230 22:49311261-49311283 TAGAAAGAAAACAAAGATAAAGG + Intergenic
1203306805 22_KI270736v1_random:114929-114951 TATAATGAAAAGGAGTATAATGG + Intergenic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949865421 3:8543110-8543132 CAGAATCTAAAGAAGGATTTCGG - Intronic
950354967 3:12399606-12399628 AAGAAAGAAAAGAAAGAGAAAGG + Intronic
950358687 3:12434484-12434506 AAGAAAGAAAAGAAAAATAAAGG - Intergenic
950432800 3:12960727-12960749 CAGAATGAAAATGATGATACTGG - Intronic
950528682 3:13539968-13539990 CAGATGGAAATGAAGGATCAAGG + Intergenic
950896085 3:16452185-16452207 GAAAATGAAACCAAGGATAAGGG + Intronic
951206641 3:19932960-19932982 GAAAATGAAATGAAGGTTAAAGG + Intronic
951534185 3:23726531-23726553 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
952261481 3:31744559-31744581 AAGAAAGAAAAGAAGGAGAGTGG + Intronic
952503430 3:33986031-33986053 CACAATAAAAAAAATGATAAAGG - Intergenic
952787892 3:37174237-37174259 CAGAAGGAAAAGAAAAACAAGGG + Intronic
953097594 3:39793919-39793941 CAGAAAGATAAGAAGGAAAAGGG + Intergenic
953731460 3:45453125-45453147 AAGAAAGAAAAGAAAGAAAAAGG - Intronic
953819026 3:46188335-46188357 AAGAAAGAAAGGAAGGAGAAAGG - Intronic
954404801 3:50339669-50339691 CAGAATGCAAAGAATGAACAAGG - Intronic
954667456 3:52264451-52264473 CAGCAGGGAATGAAGGATAAAGG + Intronic
954764776 3:52904780-52904802 CAGAATGAAAACAACCAAAAGGG + Exonic
955067568 3:55546139-55546161 TACAATGAAAAGAAGAATAACGG + Intronic
955467344 3:59250903-59250925 CACAAAGAAAAGAAGGAGAGAGG + Intergenic
955656742 3:61251848-61251870 CATAAAGAAAAGAAGGCTTAAGG - Intergenic
955774907 3:62422485-62422507 AAGAAAGAAAAGAAAGAGAAAGG - Intronic
955812762 3:62808560-62808582 CAGAAGGAAAACCAGGAGAATGG - Intronic
956096136 3:65718305-65718327 GATGATGAAAAAAAGGATAACGG + Intronic
956105703 3:65815939-65815961 CAGAATTCAAAGGAGGACAAAGG + Intronic
956179373 3:66502762-66502784 CAGAAGGGGAAGAAGGAAAAAGG - Intergenic
956637467 3:71380507-71380529 CAGAGTGAAAAGAAAGCAAAGGG - Intronic
956647350 3:71469289-71469311 CAGATTTCAAAGAAGGAAAAAGG + Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956925332 3:73980875-73980897 CAGAAGAAAAAGCAGGTTAAGGG + Intergenic
957107517 3:75909210-75909232 AAGAAAGAAAAGGAGGAAAAAGG - Intronic
957157388 3:76562468-76562490 CACAATGAAAAGAATGGAAAAGG - Intronic
957261080 3:77902073-77902095 AATAAAGAAAAGAAGGAGAAAGG + Intergenic
957640209 3:82843967-82843989 CACAATGAAAAAAATGATATAGG + Intergenic
957812249 3:85238923-85238945 GAGAAAGAGAAGAAAGATAATGG - Intronic
957944361 3:87043704-87043726 CAGAATGTAAAGAAGAATTCAGG - Intergenic
958173338 3:89964316-89964338 CAGAAAGAAAATAATGATACAGG - Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958615741 3:96491821-96491843 CAGAGTGGAAAGTTGGATAAAGG - Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959111657 3:102130031-102130053 TAAAAAGAAAAGAAGGATATTGG + Intronic
959502923 3:107127247-107127269 CAGAATGAAAGGGTGGAGAAAGG - Intergenic
959741976 3:109730978-109731000 CAGAAGGCAAAAAAGGAGAAAGG + Intergenic
959757294 3:109914050-109914072 CACAATGAAAAGAAGTATTCAGG - Intergenic
959913131 3:111787665-111787687 CAGAAGGAAAAAGAGGAAAAAGG - Intronic
960016871 3:112901082-112901104 CAGAATCAAGCAAAGGATAAAGG + Intergenic
960190600 3:114700574-114700596 TAGAATGGAAAGAAAGAAAAGGG - Intronic
960255242 3:115504885-115504907 CGGAATGCAAAGGAGGAGAAAGG - Intergenic
960551659 3:118982541-118982563 GACAATAAAAAGAAGGACAAAGG + Intronic
960820729 3:121728136-121728158 CAAAAGGAAAAGAAGGATCAAGG + Intronic
960828920 3:121823483-121823505 GAGAATGACAAGAAGAATGAAGG + Intronic
961548090 3:127650136-127650158 CAGAATTAAAACAGGCATAAGGG - Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
963131090 3:141858501-141858523 TAGAAAGAAAAGAAAGATGATGG + Intergenic
963273978 3:143312554-143312576 TAGAAAGAAAAGCAGGATGATGG - Intronic
963757668 3:149252550-149252572 CAGAATGAAAATGAGTTTAAAGG + Intergenic
963810632 3:149773133-149773155 CAGAAAGGAAAGAAAGAGAAAGG - Intronic
964193098 3:154029101-154029123 TAGACTGAAAAGAAGTATCAGGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964954835 3:162340554-162340576 CAGAAAGACAACAAGGAAAATGG + Intergenic
965002435 3:162971710-162971732 CAAAAAGAAAAGAAGGAAATTGG - Intergenic
965066543 3:163857451-163857473 CAGAAAGACAGGAAGGATGATGG - Intergenic
965081721 3:164041354-164041376 AATAAAGAAAAGAAGGACAAAGG + Intergenic
965161339 3:165137227-165137249 CACAATAAAAAAAATGATAAAGG - Intergenic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
965749429 3:171960812-171960834 AAGAAAGAAAAGAAAGAGAAAGG + Intergenic
966063336 3:175786426-175786448 ATGAATGAAATGAAGGAGAAGGG - Intronic
966266222 3:178047709-178047731 CGAAAGGAAAAGAAGGAGAAAGG + Intergenic
966547358 3:181165514-181165536 CAGAAGGAAAAGAGAGAGAAAGG - Intergenic
967410444 3:189161611-189161633 AAGAGTGAAAAAATGGATAAAGG - Intronic
967595761 3:191325447-191325469 CAGTAGGAAAAGAAGGGAAAGGG + Intronic
968685262 4:1953695-1953717 TAGGATGGAAAGAAGGAAAAGGG - Intronic
969205162 4:5638426-5638448 AAGAATCAAAAGAGAGATAATGG + Intronic
970187837 4:13481896-13481918 CACAAAGAAAAGAACAATAAAGG + Intronic
970369312 4:15391808-15391830 GAGAAGGAAAAGGAGGAAAAGGG + Intronic
970719696 4:18971916-18971938 GAGAAAGAAAAGGAGCATAATGG - Intergenic
970905352 4:21209434-21209456 CAGAATAAAAAGTAGAACAAAGG - Intronic
971120568 4:23699853-23699875 AAGAAAGAAAAGAAAGAAAAGGG + Intergenic
971184492 4:24360436-24360458 CAGAATGAAAGACAGGATGAGGG - Intergenic
971307141 4:25493144-25493166 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
971517863 4:27511389-27511411 CATAAAGAAAATAAGGATAAGGG + Intergenic
971676894 4:29642958-29642980 TAGAATCAAAAGAAAGATCAAGG - Intergenic
971713234 4:30144205-30144227 GAGAATGATAAGAAGAACAAGGG + Intergenic
971787240 4:31120247-31120269 AAGAATGGAAAGATGTATAAGGG - Intronic
972306949 4:37839902-37839924 CACAATCCAAAGCAGGATAATGG + Exonic
972653584 4:41044266-41044288 CAGTATGAAGAAAAGGTTAATGG - Intronic
972788870 4:42351605-42351627 GAGAAAGAAAAGCAGGGTAAGGG - Intergenic
972820919 4:42701015-42701037 ATGAATGAAATGAAGCATAAAGG - Intergenic
973019659 4:45186748-45186770 GAGAAAGAAAAGAAGGAAAGAGG - Intergenic
973259235 4:48144473-48144495 CAGAAGGAAAAGAAGAATGGAGG + Intronic
973910526 4:55575470-55575492 GAGAGAGAAAAGAAGCATAAAGG + Intronic
974180020 4:58372360-58372382 CAGAATGAAAATAAGCAAACTGG - Intergenic
974295463 4:59993671-59993693 CAGTATGAAAAGTAACATAAAGG + Intergenic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
974589651 4:63927878-63927900 CAAAATGAAAACAAATATAAAGG + Intergenic
974638332 4:64594751-64594773 GAGAAGGAAAAGAAAGTTAATGG + Intergenic
974725487 4:65793884-65793906 AAGAAAGAAAGGAAGGAAAAGGG - Intergenic
975048364 4:69830030-69830052 GAGAATGATAACAAGGAGAATGG - Intronic
975312883 4:72923328-72923350 CAGAAAGAAAAGGATGTTAATGG - Intergenic
975375272 4:73636715-73636737 AAGAAAGAAAAGAAAGAAAAGGG + Intergenic
975479618 4:74863115-74863137 CACAATAAAAAAAATGATAAAGG + Intergenic
976576314 4:86676431-86676453 CACAATGGAAAGCAGTATAAAGG + Intronic
976718383 4:88147039-88147061 AAGAAAGAAAAGAAAGGTAAAGG + Intronic
976780097 4:88749193-88749215 CCAAATATAAAGAAGGATAATGG - Intronic
976926729 4:90507069-90507091 AAGAATTAAATGAAGCATAAAGG + Intronic
977035628 4:91948837-91948859 CATAATGAAAAGCAGATTAATGG - Intergenic
977047191 4:92082256-92082278 CACAATAAAAAAAATGATAAAGG + Intergenic
977056042 4:92192009-92192031 CAGAAGGAACAGAAGTGTAAAGG - Intergenic
977266378 4:94860874-94860896 CAGAATAAAATGAAAGAAAATGG - Intronic
977266389 4:94861029-94861051 CAGAATAAAATGAAAGAAAATGG - Intronic
977377388 4:96223266-96223288 CAGGATGAAACCAAGGATATTGG - Intergenic
977638064 4:99323468-99323490 CACAATGAAAAGACGGAGTAGGG - Intergenic
977899999 4:102411462-102411484 CAAAAAGAAAAAAAGGAAAAAGG - Intronic
978169056 4:105647302-105647324 AAGTATGGAAAGAAGGAAAAGGG - Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978968894 4:114777581-114777603 CAGAATAAAAAGAATCATTACGG - Intergenic
979199732 4:117962647-117962669 AAGAAAGAAAAGAAAAATAATGG + Intergenic
979469838 4:121082404-121082426 CACAATAAAATGAAGGATAAAGG + Intergenic
979588287 4:122446706-122446728 AAGAATGAAGAGAGGAATAAAGG - Intergenic
979731338 4:124026702-124026724 AAGAAGGCAAAGTAGGATAAGGG + Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980197246 4:129605779-129605801 TAGAATGAAAATATGGGTAAAGG - Intergenic
981432720 4:144680351-144680373 CAGAATGAACAGCATGACAAGGG - Intronic
982285479 4:153729227-153729249 CAGAATGAACATAAGGGGAACGG + Intronic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982929303 4:161382269-161382291 CAGAATGAAGACATGGATAAGGG - Intergenic
983156851 4:164358570-164358592 CAGAATGAAGAGAAAGTGAAAGG + Intronic
983435112 4:167704283-167704305 GAGGATGAAAAGCAGGACAAAGG + Intergenic
983647543 4:170007018-170007040 TAGAATGAAATGGAGGATAGAGG - Intronic
983830332 4:172318755-172318777 CTGAATGAGGACAAGGATAAGGG + Intronic
983901471 4:173139886-173139908 CAGAATGCAAAGGAGGTCAAGGG - Intergenic
984330497 4:178309325-178309347 CCAAAAGAAAAGGAGGATAACGG + Intergenic
984330743 4:178313445-178313467 CCAACTGAAAAAAAGGATAAAGG - Intergenic
984538852 4:181011944-181011966 CAGAATGAGAGAAAGGAAAAAGG - Intergenic
985554285 5:548779-548801 CAGAATGTGAAGATGGATTAAGG - Intergenic
985554317 5:549075-549097 CAGAATGTGAAGACGGATCAAGG - Intergenic
985554325 5:549149-549171 CAGAATGTGAAGACGGATCAAGG - Intergenic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986596646 5:9429714-9429736 CAGAATGAAAAGACTGAGCAAGG + Intronic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
987269971 5:16297150-16297172 CAGAGTGACAAGGTGGATAAAGG - Intergenic
988080295 5:26405862-26405884 CAAAATGAAAAAAAAGATAATGG + Intergenic
988098077 5:26643210-26643232 CAGAATCAAATGAAAGATAAAGG - Intergenic
988975109 5:36507858-36507880 CAGAATGAAAGAAATGACAAAGG + Intergenic
989182758 5:38595168-38595190 CAGAGTGAAAAGAAATCTAAAGG + Intronic
989208825 5:38839251-38839273 CAAAAAGATAAGAAAGATAATGG + Intergenic
989690754 5:44141284-44141306 CAGACAGAAAAGGAGGTTAATGG - Intergenic
989989496 5:50744297-50744319 CAGAAGGAAAAGGATGGTAATGG + Intronic
989995752 5:50828577-50828599 CACAATGAAAAGAAAAAGAAAGG + Intronic
990096813 5:52125032-52125054 CAAAAAAAAAAGAAGCATAATGG + Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
990537286 5:56735211-56735233 CAAAATGAACAGAAGCATATTGG - Intergenic
990625155 5:57602157-57602179 CAAAAGGAAAAGGAGGAGAAGGG + Intergenic
990681606 5:58250850-58250872 AAGAAAAAAAAGAAAGATAATGG + Intergenic
990698094 5:58445398-58445420 CATAATGAAATTTAGGATAAAGG - Intergenic
991676964 5:69097464-69097486 CAGAAAGAAAAGAAAGGGAAGGG - Intronic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993138832 5:84003870-84003892 CAGAATGGCAAGTTGGATAAAGG + Intronic
993280267 5:85916834-85916856 CAGAATGACAACAAAGAAAATGG - Intergenic
993884161 5:93396867-93396889 CAGAAGGGAAAGAAAGACAAAGG + Intergenic
994499036 5:100551036-100551058 GAGAATGAAGGGAAGGTTAATGG + Intronic
994632889 5:102307982-102308004 AAGAAGGAAAAGAATGAAAAAGG + Intergenic
994858138 5:105152322-105152344 CAGAAGGAGAAGAAAGAGAAAGG - Intergenic
994869036 5:105319960-105319982 TAGAACAAAAAGAAAGATAATGG + Intergenic
994905612 5:105838461-105838483 CAGAAGGTGAAGGAGGATAAAGG + Intergenic
995908203 5:117152539-117152561 GAGAAGGAAAAGAAGGAGAAAGG - Intergenic
996150921 5:120033745-120033767 AAAAATTAAAAGTAGGATAAAGG - Intergenic
996437149 5:123447240-123447262 TAGGATGAAAAAAAGCATAAGGG + Intergenic
997054007 5:130418906-130418928 CATAATGAAAAAAATGATAAAGG + Intergenic
997063206 5:130531741-130531763 CAGCATAAAAAGAACGCTAACGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
998178312 5:139915751-139915773 TAAAATGAAAGGAAGGATCATGG + Intronic
998305991 5:141077733-141077755 GAGGATGAAAAGAAGGGAAAGGG - Intergenic
998533408 5:142906538-142906560 GACAATGGAAAGATGGATAACGG - Intronic
998578237 5:143341183-143341205 AAGAATGAACAATAGGATAATGG + Intronic
998699230 5:144678697-144678719 CAGGATGAAAGGCAGGAAAAAGG + Intergenic
998826082 5:146102981-146103003 CAGAAACAAAGGAAGGAGAAAGG + Intronic
998992465 5:147832994-147833016 GAAAAGGACAAGAAGGATAAGGG + Intergenic
999266973 5:150272882-150272904 AAAAAGGAAAAGAAGGAAAAAGG + Intronic
999292704 5:150437211-150437233 AAGAAAGAAAAGAAGGAAGAAGG + Intergenic
999632497 5:153585271-153585293 GAGAAAGAAAAGAAAAATAAAGG - Intronic
999998629 5:157116454-157116476 GAAAATGAAAAGAATGAAAAGGG + Intronic
1000118549 5:158175760-158175782 AAGAAGGAAAACAAAGATAAGGG + Intergenic
1000166708 5:158656881-158656903 CAGAATGAATCTAAGGATAATGG - Intergenic
1000811210 5:165864148-165864170 TAGAAAGAAAAGAAAAATAAAGG + Intergenic
1001172689 5:169435796-169435818 CAGACAGAAAAGAATGAGAAGGG - Intergenic
1001194238 5:169656903-169656925 CAGAACCAAAGAAAGGATAAAGG - Intronic
1001866638 5:175111785-175111807 GGGAATGAAAAGAAGGCCAAGGG + Intergenic
1002003294 5:176211395-176211417 CAAAATAAAAAGAATTATAAGGG - Intergenic
1002223159 5:177699546-177699568 CAAAATAAAAAGAATTATAAGGG + Intergenic
1002420256 5:179142606-179142628 CAGAATGACCAGAAGCTTAATGG + Intronic
1004111440 6:12722556-12722578 GAGAAGAAAAAGAAGGAAAAAGG + Intronic
1004145350 6:13060862-13060884 TAGAAAGAAAAGGAGGACAAGGG + Intronic
1004652006 6:17618935-17618957 AAGAAGGAAAGGAAGGATTAGGG + Intronic
1005074330 6:21891657-21891679 CATGAAGAAAAGCAGGATAAAGG - Intergenic
1005272941 6:24185760-24185782 CAGTCTGCAAAGAAGGAAAAGGG + Intronic
1005695043 6:28343938-28343960 AAGCATGAAAAGATGGACAAAGG + Intronic
1005750597 6:28878632-28878654 CAGAAATAAAAGAAGGAAAATGG + Intergenic
1006237061 6:32642816-32642838 CAGTATGAAAGGAAGGAAAGTGG + Intronic
1006371027 6:33643617-33643639 GAGGAGGAAAAGAAGGAAAAAGG - Intronic
1007115010 6:39337143-39337165 AAGAAAGAAAAGAAAGAGAAAGG - Intronic
1007212148 6:40202618-40202640 CAGAAATAAAAGAATCATAAGGG - Intergenic
1007330657 6:41104940-41104962 GAAAATGAAAAGAAGGAAGAAGG + Intergenic
1007773291 6:44208330-44208352 CAAATTGAAAAGAGGTATAAAGG + Intergenic
1008261782 6:49375009-49375031 CAGCATGAAAAGAAGGAAACTGG - Intergenic
1008877416 6:56344795-56344817 CAGGAGGAAAAGAAAGAGAAGGG - Intronic
1009387900 6:63109160-63109182 CAGAAAGGAAGGAAGGAAAAAGG - Intergenic
1009544238 6:65003992-65004014 CAGGAAGAAAAGAAGGAAAGAGG - Intronic
1009773984 6:68180928-68180950 AAGAATCAAAAGAAGCAAAATGG + Intergenic
1009938792 6:70265305-70265327 CATCATCAAAAGAAGGAGAAAGG + Intronic
1010150306 6:72723646-72723668 AAGAAAGAAAGGAAGGAAAAAGG - Intronic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011992443 6:93539719-93539741 CAGAATGGAAAGCCGAATAAAGG + Intergenic
1012030061 6:94048429-94048451 CAGAAGGGAAAGAAGAATATGGG + Intergenic
1012319285 6:97822942-97822964 AAGAAAGAAAAGAAGGAGAAAGG + Intergenic
1012494280 6:99817222-99817244 CAGCATGGAAAGAGGGAAAAAGG - Intergenic
1012752950 6:103185662-103185684 CAGAAAGGAAAGAAAGAGAAAGG + Intergenic
1013093995 6:106927664-106927686 CAGAAGGCAAAGAAGAACAATGG - Intergenic
1013423347 6:109986936-109986958 TAGAATGAAGAAAAGGAAAAGGG + Intergenic
1013550162 6:111199908-111199930 CAGAAGGAAGAGATGGCTAATGG - Intronic
1013620719 6:111885899-111885921 GAGCTTGAAAAGATGGATAAGGG + Intergenic
1013876155 6:114831774-114831796 CACAATGAAAAAAAGGAATATGG + Intergenic
1014187156 6:118447894-118447916 CGGAATGCAAAGGAGGAGAAAGG + Intergenic
1014467337 6:121772608-121772630 CAGAATGAAATGTAGTATAGTGG - Intergenic
1014755122 6:125294039-125294061 CAGAAATAAAGGAAGGATACTGG - Intronic
1015059820 6:128949504-128949526 AAGAAAGACAAGAAGGATAGGGG + Intronic
1015138786 6:129906471-129906493 CAGAATGAAAAATGAGATAATGG + Intergenic
1015704367 6:136072071-136072093 CTGAATGAAAAAAATGTTAAAGG - Intronic
1015765703 6:136713728-136713750 CCAAATGAAAAGAAGTGTAAGGG + Intronic
1016816412 6:148307012-148307034 AAGAAAGAAAAGAAAGAGAAAGG - Intronic
1017381667 6:153838311-153838333 CAGAATGACAAGGAGGATCAGGG + Intergenic
1017402526 6:154080625-154080647 CAGAATGGAAAGAATGCTGAAGG - Intronic
1017870853 6:158485467-158485489 CAGGATGAAAGGAAGGAGAGAGG + Intronic
1018300851 6:162401723-162401745 CAAAATTAAAATAAGGAGAATGG + Intronic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1019096178 6:169581618-169581640 CAGACTGAAAAGATGAATTAGGG + Intronic
1019690542 7:2408536-2408558 TAAAATGAAAAGAAGCAGAAGGG + Intronic
1019952837 7:4387729-4387751 CAGATTGAACAGAGGGCTAAAGG + Intergenic
1020416409 7:7951168-7951190 CAGAAGGAAAAGAGAGATAGCGG + Intronic
1020503487 7:8953332-8953354 TGGAAGGAAAAGAAAGATAATGG - Intergenic
1020591373 7:10142128-10142150 CAGAAAGAAAAGCAGAAAAAAGG - Intergenic
1020732426 7:11898421-11898443 CAGAATGCAAAGTAAGAAAAGGG - Intergenic
1020859150 7:13466787-13466809 CAGAATGAGAAGTAAGACAAAGG + Intergenic
1020907788 7:14086280-14086302 AAGAAATAAAAAAAGGATAAAGG + Intergenic
1021161198 7:17274933-17274955 AAGAAAGGAAAGAAGTATAATGG - Intergenic
1021391591 7:20099903-20099925 GAGAAAGAAAAGAAGAATCAAGG + Intergenic
1021454158 7:20811351-20811373 TAGAAAGAAAAAAAGGAAAAAGG - Intergenic
1022055536 7:26729687-26729709 CAGATAGAAAATAAGAATAAGGG + Intronic
1022313807 7:29224938-29224960 GAGAGAGAAAATAAGGATAAAGG + Intronic
1022873949 7:34508647-34508669 CAGAGAGAAAAGAACCATAAGGG - Intergenic
1024352351 7:48379590-48379612 CGGATTTAAAAGAAGGAGAAAGG + Intronic
1024533763 7:50413252-50413274 CATAATGCAAAAAAGGAGAATGG + Intergenic
1024837033 7:53533344-53533366 TAGAATGAAAAGAAAGGAAAAGG - Intergenic
1025276946 7:57591010-57591032 CAGAGAGTAAAGAAGGACAAGGG + Intergenic
1026326756 7:69317219-69317241 AAGAATAAAAAGAAGTTTAATGG - Intergenic
1027386340 7:77662923-77662945 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
1027493756 7:78861653-78861675 CAAAATAAAAATAATGATAATGG + Intronic
1027645364 7:80790702-80790724 CAGAAAGTAAAGATGGAGAAGGG - Intronic
1028001578 7:85504003-85504025 CAGAAAGAAAACAATGTTAATGG + Intergenic
1028097177 7:86775661-86775683 TAGAAGGTAAAGAAGGATAGAGG - Intronic
1028287646 7:89022790-89022812 CAGAACGATAAGTAGGAGAAAGG + Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1029042742 7:97594803-97594825 CAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1029646472 7:101859858-101859880 AAGAAAGAAAAGAAAGAAAAAGG - Intronic
1030019131 7:105255471-105255493 CAGATGGAAAAGAAGGAAAAGGG + Intronic
1030019869 7:105262798-105262820 CAGAATGCTAACAAGGAAAAAGG + Intronic
1030386327 7:108871853-108871875 AATAATGTAAAGAAGTATAATGG - Intergenic
1030819500 7:114078504-114078526 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
1030994033 7:116335971-116335993 CACATTGGAAAGAAGGATCAGGG + Intronic
1030996687 7:116367986-116368008 ATGAATGAAAACAAGGAAAAGGG - Intronic
1031201054 7:118685929-118685951 GAGAAAGAAAAGAAGTATACAGG + Intergenic
1031229936 7:119093430-119093452 AAGAAGGAAAAGCAGCATAAGGG - Intergenic
1031363131 7:120871121-120871143 GAGAAAGAAAAGAAGGAAGAGGG + Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031448820 7:121888546-121888568 CAGAATTAGAATTAGGATAATGG + Intronic
1031907163 7:127473308-127473330 CAGAAAGAAAAAAAGGAAGAAGG + Intergenic
1032027306 7:128454282-128454304 CAGAACTACAAGAAGGTTAAAGG + Intergenic
1032752986 7:134860993-134861015 CAGCTTGAAAGGAAGGTTAATGG + Intronic
1032884193 7:136120596-136120618 TATAATGGAAAGAAGGTTAATGG + Intergenic
1032936684 7:136740338-136740360 AAGAATGAAATGAAGGGAAATGG + Intergenic
1033215176 7:139488048-139488070 AAGGATGAAAGGAAGGATCACGG - Intergenic
1033410343 7:141111873-141111895 CAGAATGAAAATATTGATATAGG - Intronic
1033445057 7:141413730-141413752 CATAAGGAATATAAGGATAAAGG - Intronic
1033834962 7:145299327-145299349 AAGAAAGAAAAGAAAGACAAAGG - Intergenic
1033995582 7:147342238-147342260 CAGAATGTAAATAATGATAATGG + Intronic
1034072540 7:148200377-148200399 AAGAAAGAAAAGAAGTGTAATGG - Intronic
1034757382 7:153635476-153635498 GAGAAAGAAAAGAAGAATAGTGG - Intergenic
1034880762 7:154760777-154760799 CAAAACAAAAAGAAGGGTAAAGG + Intronic
1036115750 8:5959153-5959175 CAGAATGAATGCAAGGATAGAGG + Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036917736 8:12821027-12821049 CAGAATAAACAGCAGAATAAGGG - Intergenic
1037209836 8:16373362-16373384 GAGAAAGAAAAGAAGGAGGATGG - Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037312903 8:17575429-17575451 CAGAATGAAAAGAAATCTCACGG + Intergenic
1037436340 8:18867642-18867664 CAGCATGAAATGAATGAGAATGG + Intronic
1037672661 8:21028623-21028645 CAGAAAGGAAAGAGGGAGAAGGG + Intergenic
1038071770 8:24024224-24024246 AAAAATGAAAAGAATTATAAAGG + Intergenic
1038127493 8:24691000-24691022 AAGATTGAAAAGAAGAATGATGG + Intergenic
1038175023 8:25174076-25174098 CTGCATGAAAAGAATGATACAGG - Intergenic
1038339981 8:26677767-26677789 TAGAATCAAAAGAAGAATTATGG - Intergenic
1038525593 8:28270439-28270461 TAGAAGGAAAAGAAGGTGAATGG - Intergenic
1038662766 8:29511468-29511490 CAGAATGAAGGGAAAGAGAAAGG + Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1038784227 8:30596239-30596261 GAGAAGGAAAAGAAAGAAAACGG - Intronic
1038982860 8:32778354-32778376 CATAATGAAGAGAATGATCAAGG + Intergenic
1039118565 8:34119967-34119989 GAGAAAGAAGAGAAGGAGAAGGG - Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039555526 8:38472298-38472320 CTGAATGAAACGAAGGGAAACGG + Intergenic
1039845479 8:41322533-41322555 CAGAAGGATAAGAAAGAGAAAGG + Intergenic
1040632977 8:49237896-49237918 AAGAAAGAAAAAAGGGATAAAGG + Intergenic
1040984430 8:53278441-53278463 TTATATGAAAAGAAGGATAAAGG - Intergenic
1041121175 8:54587850-54587872 AAAAATGTAAAGAAGGCTAAAGG - Intergenic
1041396794 8:57399884-57399906 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041543092 8:59009128-59009150 TAGAAAGGAAAGAAGGAGAAGGG - Intronic
1042221111 8:66475267-66475289 AAAAAGGAAAAGAAGGGTAAAGG - Intronic
1042329654 8:67565293-67565315 GAGAAAGAAAAAGAGGATAATGG + Intronic
1042397665 8:68310941-68310963 AAGAATGGAAGGAAGGAAAACGG - Intronic
1042674693 8:71306843-71306865 CAGAATGAAAACAAGACTAAGGG - Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042964821 8:74339217-74339239 AGGAAAGAAAAGATGGATAAAGG - Intronic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043381886 8:79711330-79711352 CACAATAAAAAAAATGATAAAGG + Intergenic
1043609684 8:82046576-82046598 CAGATTCAAAAGAATGAGAAAGG + Intergenic
1043690265 8:83142253-83142275 AAGAATAGAAAGAAGGATATAGG - Intergenic
1043790318 8:84458556-84458578 AAGAAAGAAAGGAAAGATAATGG - Intronic
1043863079 8:85343882-85343904 AAGCAGAAAAAGAAGGATAAAGG - Intronic
1043933332 8:86115317-86115339 AAGAAAGAATAGAAGGATAGAGG - Intronic
1044186599 8:89260601-89260623 TATAATAAAATGAAGGATAATGG - Intergenic
1044192090 8:89331228-89331250 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1044904746 8:96989386-96989408 AAGAATGAAAGGAAGGAGAGGGG + Intronic
1044914852 8:97102171-97102193 CAAACTGAAAAAAAGGAAAACGG + Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045522120 8:102912757-102912779 ACGAATGGAAAGAAGAATAAAGG + Intronic
1045935802 8:107677617-107677639 TAGAAGGAAAAGAAGCATGAGGG + Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1046789702 8:118307866-118307888 AAGACTGGAAAGAAGGAGAAAGG + Intronic
1046984831 8:120375673-120375695 AAAAATGAAAAAAAGGATAACGG - Intergenic
1047019758 8:120762415-120762437 CAGAATGAAAAGCAGGACTGGGG + Intronic
1047059870 8:121213350-121213372 CAGAATGATTTGAAGGAAAAGGG + Intergenic
1047184535 8:122620056-122620078 CAGAATGAAAGAAGGGAGAAGGG - Intergenic
1047444171 8:124905089-124905111 GAGACAGAAAAGAAGGAAAAAGG - Intergenic
1047785566 8:128151024-128151046 CAGAATGAAAAGAGAGGGAAAGG - Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1049648724 8:143752909-143752931 CAGAAAGAGAAGAAAGAGAAAGG - Intergenic
1050093857 9:2043420-2043442 CAAAATGAAAAGAAAAATGATGG - Intronic
1050143020 9:2536416-2536438 CAGAAGGAAAAGAAGCTTACAGG - Intergenic
1050798962 9:9584773-9584795 CAGGTTGAAAATAAAGATAAAGG - Intronic
1050901608 9:10956441-10956463 AAGAATGATAAGAAGGTTTAAGG + Intergenic
1050929805 9:11308677-11308699 TAGAATAAAAATAAGGATAAGGG - Intergenic
1051040571 9:12804750-12804772 CAGGATGAAAAGATGGTTAAAGG + Intronic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051778392 9:20660830-20660852 CAGAAATAAAAGAAGAATTATGG + Intronic
1052044463 9:23778209-23778231 GAGGTTGAAAAGAAGGACAAAGG + Intronic
1052205237 9:25831057-25831079 CAACATGAAGATAAGGATAAAGG - Intergenic
1052325019 9:27208413-27208435 CAGAATGAAGAGAAGGCTATTGG - Intronic
1052541046 9:29811582-29811604 GAGAAAGAAGAGAAGGCTAAGGG - Intergenic
1052717169 9:32130692-32130714 CAGATTGAAAAATTGGATAAAGG + Intergenic
1053243281 9:36514568-36514590 TTGAATGAAAAGGAAGATAAAGG + Intergenic
1053294186 9:36901262-36901284 CAGAAGGAACAGCATGATAAAGG - Intronic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1053784034 9:41638793-41638815 CTGAAGAAAAATAAGGATAAGGG - Intergenic
1053829456 9:42062038-42062060 CAAAAAAAAAAGAAGGATAAAGG - Intronic
1054171990 9:61848929-61848951 CTGAAGAAAAATAAGGATAAGGG - Intergenic
1054446850 9:65377946-65377968 CTGAAGAAAAATAAGGATAAGGG - Intergenic
1054601103 9:67125416-67125438 AAAAAAAAAAAGAAGGATAAAGG + Intergenic
1055224086 9:73972341-73972363 AAGAATTAAAGGAAGAATAAAGG + Intergenic
1056042348 9:82681490-82681512 GAGGATGAAAAGAAGGAAACAGG - Intergenic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1057002133 9:91519692-91519714 AAGAAAGGAAAGAAGGAGAAAGG + Intergenic
1057362074 9:94382505-94382527 GAGAATGAAAAGATGGACCACGG - Intronic
1057517654 9:95735664-95735686 CAGAAAGAAAAGAAGGGAGATGG - Intergenic
1057590531 9:96369431-96369453 CTGAATGAAAAGAAAGGCAAAGG + Intronic
1057661281 9:97005658-97005680 GAGAATGAAAAGATGGACCACGG + Intronic
1057680254 9:97174638-97174660 AAGAAGGAAAAGAAAGAAAAAGG - Intergenic
1057943181 9:99302573-99302595 AAGAAAGAAAAGAAGGCTAGTGG - Intergenic
1058170634 9:101676855-101676877 CAGAAAAAAAAAAAGGAAAAGGG - Intronic
1058201114 9:102041873-102041895 AAGAATGAAAAGAATGAAACTGG + Intergenic
1058377228 9:104336742-104336764 GAGAAAGAAAAGAAGAAAAAGGG + Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058485493 9:105439750-105439772 CATGATGAAAAAAAGGAAAAGGG - Intergenic
1058578737 9:106431660-106431682 CACAATGAAAAGATGGCTAAGGG + Intergenic
1059152588 9:111962832-111962854 CAGAAGGAAAATAAGGATAAGGG + Intergenic
1059287714 9:113190405-113190427 CCAAATGAAAAGAAAGATGATGG + Intronic
1059530234 9:115028797-115028819 CAGAATGACAAAAAAGAGAATGG - Intronic
1059795849 9:117695843-117695865 CAGAAGGAAAAGAAGAGTTAAGG + Intergenic
1060315677 9:122508161-122508183 GAGAAGGAGAAGAAGGAGAAGGG + Intergenic
1060650036 9:125317646-125317668 AAGAAAGAAAAGAAAGAAAATGG + Intronic
1060755668 9:126211514-126211536 AAGAATGAAAGGAAGAAAAATGG + Intergenic
1060849974 9:126866483-126866505 CAGAAGGAAAAGCAGGAACAGGG - Intronic
1061301549 9:129708336-129708358 TAGAATCAAAAGACAGATAACGG - Intronic
1061362644 9:130153542-130153564 AAGAAAGAAAAGAATGAAAAAGG + Intergenic
1185537401 X:873010-873032 CAAAAGGAAAAGAAGAAAAAAGG - Intergenic
1186011184 X:5134923-5134945 GTGAAGGAAAAGAAGGAGAATGG + Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186075280 X:5871674-5871696 CAGGCAGAAAAGAAGGAGAAGGG + Intronic
1186261529 X:7785209-7785231 CAGAAGGCAAAGCAGGAGAAAGG + Intergenic
1186306463 X:8264947-8264969 CAGAAAGGAGAGAAGGACAAGGG - Intergenic
1186710762 X:12193836-12193858 AAGAAAGAAAAGAAAGAAAAAGG + Intronic
1186826803 X:13348482-13348504 GAGAGAGAAAAGAAGTATAAGGG + Intergenic
1186893329 X:13981694-13981716 CAGTATGAAAAGGTGGTTAATGG + Intergenic
1187499853 X:19830787-19830809 GAGAAAGAAAAGAAAGAGAAGGG + Intronic
1188009025 X:25038716-25038738 AAGAATGGAAAGAAGGATGGTGG + Intergenic
1188295189 X:28438770-28438792 CATACTGAAACAAAGGATAATGG + Intergenic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1188849451 X:35114065-35114087 CAAAATGAATAGAATGATGATGG + Intergenic
1189224166 X:39398627-39398649 AAGAAAGAAAGGAAGGAAAAGGG - Intergenic
1189835314 X:45014833-45014855 TGGAATGGAAAGAAGGAAAAAGG - Intronic
1190799781 X:53776981-53777003 AAAAATAAAAATAAGGATAAAGG - Intergenic
1191069507 X:56384801-56384823 CAAAAAGAAAAGAAAGATACAGG - Intergenic
1191871114 X:65746269-65746291 CAGAATGAAAGGCAGGAGATTGG - Intergenic
1192000077 X:67140494-67140516 GAGAATGGAAAGGAGGAGAATGG - Intergenic
1192090358 X:68148585-68148607 CATAATGAAAATGAGGAAAAAGG + Intronic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193506665 X:82351968-82351990 AAGAATGAAAGAAAGGAAAAAGG + Intergenic
1193713618 X:84909323-84909345 CAGAATCATACCAAGGATAATGG + Intergenic
1194023710 X:88725486-88725508 CAGAAAGAAAAGGATGTTAATGG + Intergenic
1194213681 X:91100839-91100861 AGGAATGAAAAGAAGGAGTAGGG + Intergenic
1195037577 X:100984089-100984111 CAAAAAAAAAAGAAGGAAAATGG - Intronic
1195235814 X:102897224-102897246 ATGAAGGAGAAGAAGGATAAGGG + Intergenic
1195820209 X:108936726-108936748 AAGAAAGAAAAGAAAGAAAAAGG + Intergenic
1196834441 X:119801658-119801680 AAGAAAGAAAAAAAGGAGAAAGG - Intergenic
1196944941 X:120814457-120814479 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1197708674 X:129651330-129651352 CAGAATCAAAAGTAGGAAACAGG - Intronic
1197805047 X:130390532-130390554 CAGTGTGAAAAGAATGATATAGG + Intergenic
1197858408 X:130944015-130944037 CAGGGTGAAAAGAACAATAAAGG - Intergenic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1198405330 X:136306454-136306476 CAGAATCACAGGAAGTATAAAGG + Intronic
1198433760 X:136594516-136594538 CAGAAAGGAAGGAAGAATAATGG - Intergenic
1198470770 X:136944570-136944592 CAAAATGTAAAGAGGAATAAAGG - Intergenic
1198528866 X:137529524-137529546 GAGAATGAAAAGTGGGCTAAAGG - Intergenic
1198706365 X:139452860-139452882 GAGAATGAAAAGAGAGATGATGG + Intergenic
1199024770 X:142923422-142923444 CAGCATGACAAGAAGGATGAAGG - Intergenic
1199145495 X:144361234-144361256 CAGAAAGGAAAAAAGGACAATGG + Intergenic
1199308023 X:146290832-146290854 CAGAATGGCAAGCTGGATAAAGG - Intergenic
1200375906 X:155779953-155779975 GAGAGTGAAAATAAGGATATGGG - Exonic
1200432403 Y:3101195-3101217 GAAAATGAAAACAAGGGTAATGG + Intergenic
1200845794 Y:7831348-7831370 AAGAATCAAAAGAAGCAAAATGG - Intergenic
1201341143 Y:12935623-12935645 GAGAAAGAAAGGAAGGATGAAGG - Intergenic