ID: 1038781089

View in Genome Browser
Species Human (GRCh38)
Location 8:30568990-30569012
Sequence GGCGGAATGGCTGCCTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781089_1038781102 0 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781102 8:30569013-30569035 TGCTCAGGGGCTGGGGCATTGGG No data
1038781089_1038781098 -7 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781098 8:30569006-30569028 TTCCGCCTGCTCAGGGGCTGGGG No data
1038781089_1038781103 11 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781089_1038781097 -8 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781097 8:30569005-30569027 ATTCCGCCTGCTCAGGGGCTGGG No data
1038781089_1038781096 -9 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781096 8:30569004-30569026 CATTCCGCCTGCTCAGGGGCTGG No data
1038781089_1038781101 -1 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781101 8:30569012-30569034 CTGCTCAGGGGCTGGGGCATTGG No data
1038781089_1038781104 24 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781089 Original CRISPR GGCGGAATGGCTGCCTAGGA GGG (reversed) Intronic
906406382 1:45545627-45545649 GTGAGAATGGCTGTCTAGGAAGG - Intergenic
906669148 1:47642293-47642315 GAAGGAAAGGCTGCCTTGGAAGG - Intergenic
907242986 1:53090881-53090903 GGCGGGGTGGCTGCCTGGGGAGG - Intronic
907682626 1:56578731-56578753 GGCGCAAAGGCTCCCCAGGAAGG + Intronic
908769243 1:67581304-67581326 GGGGGAAGGGCTGCATATGAGGG + Intergenic
910757554 1:90708397-90708419 TGGGGAAGGGCTGCCTAGGCAGG + Intergenic
911937570 1:103998296-103998318 CTCGGGATGGCTGCCAAGGAAGG + Intergenic
915341399 1:155178719-155178741 GGAGGAATGGCTGGCCAGGCCGG - Intronic
917730721 1:177872097-177872119 GGAAGGGTGGCTGCCTAGGAAGG - Intergenic
920092762 1:203465902-203465924 GGAAGAATGCCAGCCTAGGAGGG + Intergenic
1064615660 10:17152966-17152988 GGTGGAGAGGCTGTCTAGGAAGG - Intronic
1068196069 10:53718245-53718267 GGCGGAATTGATGCCTGAGATGG - Intergenic
1076193747 10:128500353-128500375 TGAGGCATGGCTGCCTCGGACGG - Intergenic
1077899716 11:6478672-6478694 TGAGGAATGACTGCCTGGGAGGG + Intronic
1084686375 11:70698239-70698261 GGTGGAATGGCTGTGAAGGAAGG - Intronic
1087305294 11:96482611-96482633 GGGGAAATGGCAGCCTAGAATGG - Intronic
1090475951 11:127020449-127020471 GGCAGAATGGAAGCCTGGGATGG + Intergenic
1090880931 11:130830890-130830912 GCCTGAAGGGCTGCCTAGGGTGG - Intergenic
1092399443 12:8161713-8161735 GATGGAATGGCTGCCTAAGGAGG - Intronic
1092701740 12:11239235-11239257 GGGGGATTGGATGCCCAGGAAGG + Intergenic
1092727674 12:11500701-11500723 GGCGGCAGCGGTGCCTAGGAGGG - Intronic
1094463090 12:30719212-30719234 GGGGGAATTGCTGCCTGGGGAGG + Intronic
1096154934 12:49336563-49336585 GGCGCAATGGCTGCCGGGGCCGG + Exonic
1096408355 12:51359787-51359809 AGCACACTGGCTGCCTAGGAAGG + Intronic
1096500079 12:52059303-52059325 GCTGGAAAGGCTGCCCAGGAAGG - Exonic
1106203249 13:27562501-27562523 GGGGGGTTGGCTGCCCAGGACGG - Exonic
1119881712 14:78104871-78104893 GGAGGGATGGCTGGCTAGGTGGG + Intergenic
1122516853 14:102314837-102314859 GGCGGAGGGGCTGCCGCGGAGGG + Intergenic
1122572062 14:102711376-102711398 CACGGCATGGGTGCCTAGGATGG - Intronic
1124097466 15:26661837-26661859 GGCCGAAGTACTGCCTAGGAAGG + Intronic
1128968826 15:72087700-72087722 GGTGGAATGGCTGCCACTGAGGG - Intronic
1129852017 15:78798831-78798853 GGCAGAATTGGTGCCTATGAGGG - Intronic
1130250982 15:82300256-82300278 GGCAGAATTGGTGCCTATGAGGG + Intergenic
1134112459 16:11524029-11524051 GGGTGAATGGATGCGTAGGAGGG - Intergenic
1138036247 16:53609634-53609656 TGCGCCATGGCTGTCTAGGATGG - Intronic
1138265985 16:55660063-55660085 TGAGGAAGGGCTGCTTAGGAAGG + Intronic
1142712574 17:1731297-1731319 AGCGGAGGGGCTGCCCAGGAGGG + Intronic
1149537449 17:57443570-57443592 GGAGCACTGGGTGCCTAGGAGGG + Intronic
1157387790 18:47273895-47273917 GGCTGAATGACTGCCAAGGCTGG - Intergenic
1157559714 18:48637712-48637734 GGAGGGACGGCTGCCCAGGATGG + Intronic
1160588148 18:79924118-79924140 GGCGGAGAGGCTCCCGAGGATGG + Intronic
1161169779 19:2807044-2807066 GAAGGAAGGGCTACCTAGGAAGG - Exonic
1161322132 19:3646188-3646210 GGCGCCATGGCTTCCTGGGAGGG + Intronic
1162817784 19:13207100-13207122 GGCGCCGTGGCTGCCCAGGAGGG + Exonic
1165328013 19:35125385-35125407 GGCGAAGTCGCTGCCTAGGATGG + Exonic
926279174 2:11430884-11430906 CTGGGAATGGCTGGCTAGGAGGG + Intergenic
926503154 2:13679408-13679430 GGTGGAATGGCTGCTTAAGGAGG - Intergenic
927255872 2:21040492-21040514 GGCTGAATGCCAGCCTAGGAGGG + Intronic
933271546 2:80238243-80238265 GGCGGCATGGCAGGCAAGGAGGG + Intronic
948677099 2:239603070-239603092 GGCGTTGTGGCTGCCGAGGAGGG + Intergenic
949035264 2:241813254-241813276 GGCAGAACGCCTGCCTACGACGG - Intronic
1173000503 20:39102111-39102133 GGAGGGATGGCTGCCAGGGAAGG - Intergenic
1182248819 22:28983250-28983272 GAAGGAATGACTGCTTAGGAGGG + Intronic
1182322283 22:29485714-29485736 TGCTGAATGGCTTCCTGGGAAGG - Exonic
1183354898 22:37352971-37352993 GGCAAAATGGCTGCATAGAAAGG + Intergenic
1183562141 22:38583591-38583613 AAGGGAATGCCTGCCTAGGAGGG - Intronic
1184872044 22:47246989-47247011 GGCTGAGTGCCTGCTTAGGAGGG + Intergenic
1185188790 22:49419675-49419697 CGCTGAAGGGCTGCCCAGGAGGG - Intronic
949346881 3:3084924-3084946 GGCAGAATGTATGCCTAGAAGGG + Intronic
950228036 3:11252019-11252041 GATGGAATGGCTGCTTAGGGAGG + Intronic
951500542 3:23381916-23381938 GGCGGAATGGCTGCTTACTGTGG + Intronic
951525577 3:23649692-23649714 AGCTAAATGGCTGCCTAGCAGGG - Intergenic
954456785 3:50603924-50603946 CCCAGAATGGCTGCCCAGGAGGG - Intergenic
956424720 3:69122047-69122069 CGAGAAATGGCTGCCTGGGATGG - Intronic
961603964 3:128079879-128079901 GGAGGCAGGGCTGACTAGGATGG - Intronic
961632854 3:128313890-128313912 GCAGCAGTGGCTGCCTAGGAGGG - Intronic
968603290 4:1520435-1520457 GGCGGAAAGGCTCCCTGGAAAGG + Intergenic
969670176 4:8585814-8585836 GCCGGACTGGGTGCCTCGGAGGG + Intronic
970584441 4:17501727-17501749 GGCGCAAAGGCTGCCCTGGATGG - Exonic
971479185 4:27099149-27099171 AGCAGAATGGGTGCCTTGGAGGG - Intergenic
973887757 4:55339970-55339992 GGTGGAATGGCTGCTTAAGGAGG - Intergenic
979307303 4:119162093-119162115 GTAGGAATGGCTGCATAGAAGGG + Intronic
979666173 4:123313198-123313220 GGCGGAATGGATGCAGAGGGAGG - Intronic
982707147 4:158723070-158723092 GAGGGGATGGCTGCCTAGGCTGG - Intronic
982779998 4:159480690-159480712 GGGGGGATGGGTGCCTGGGAAGG + Intergenic
983967930 4:173836172-173836194 GGCTGAATGGCTGGTTTGGAAGG - Intergenic
987474654 5:18375749-18375771 AGCAGAAGGGCTGCCTGGGAAGG - Intergenic
988100436 5:26669657-26669679 GGCGGCATGGCTGCCCAGAGCGG - Intergenic
989840635 5:46062947-46062969 GAGGGAATTGCAGCCTAGGATGG + Intergenic
996596539 5:125209680-125209702 GGCTGATTGGGTGCCTAAGATGG + Intergenic
999099395 5:149010379-149010401 GTCTGGATGGCTGCCTAGGTGGG + Exonic
1006255471 6:32829208-32829230 GGAGGAATGGAAGCCCAGGAGGG + Intronic
1018994831 6:168702754-168702776 TGGGGAATGGCTGCCTTGCATGG + Intergenic
1022273210 7:28830633-28830655 GGCGTAATGTCTCTCTAGGATGG + Intergenic
1033369468 7:140695685-140695707 GGCCGTCTGGCTGACTAGGAGGG + Intronic
1034285847 7:149882503-149882525 CCCGGAATGGCTGCACAGGAAGG - Intergenic
1038781089 8:30568990-30569012 GGCGGAATGGCTGCCTAGGAGGG - Intronic
1044105072 8:88194677-88194699 GGAGGCATGGCAGGCTAGGAAGG + Intronic
1047820326 8:128512562-128512584 GGAGGAAAGGCTGCTTTGGAAGG - Intergenic
1051196399 9:14566617-14566639 GGAGTACTGGATGCCTAGGAAGG + Intergenic
1052864335 9:33455936-33455958 GGCTGACTGCCTGCCTAGGCAGG + Intergenic
1053457275 9:38242252-38242274 GACGGCATGGCTGGCTAGGCGGG - Intergenic
1057987639 9:99733375-99733397 GGCGGAATGGCACACAAGGAAGG - Intergenic
1059046422 9:110873513-110873535 AGATGAATGGCTGTCTAGGAAGG - Exonic
1059406203 9:114099398-114099420 GGATGGATGGCTGCCTGGGATGG - Intergenic
1190971350 X:55352239-55352261 GGCAGAATTGCTGCTCAGGATGG + Intergenic
1192116672 X:68418240-68418262 GCAGGGATGGCTGGCTAGGAGGG + Intronic
1194323467 X:92480945-92480967 GGCAGCATGGCTCTCTAGGATGG + Intronic
1198479776 X:137030830-137030852 GGCAGAATGGAAGCCAAGGACGG - Exonic
1200122156 X:153796228-153796250 GGCGGGATGGCTGTGAAGGAAGG - Intronic
1200631568 Y:5594111-5594133 GGCAGCATGGCTCTCTAGGATGG + Intronic