ID: 1038781090

View in Genome Browser
Species Human (GRCh38)
Location 8:30568991-30569013
Sequence AGGCGGAATGGCTGCCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781090_1038781103 10 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781090_1038781096 -10 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781096 8:30569004-30569026 CATTCCGCCTGCTCAGGGGCTGG No data
1038781090_1038781102 -1 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781102 8:30569013-30569035 TGCTCAGGGGCTGGGGCATTGGG No data
1038781090_1038781097 -9 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781097 8:30569005-30569027 ATTCCGCCTGCTCAGGGGCTGGG No data
1038781090_1038781104 23 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG No data
1038781090_1038781101 -2 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781101 8:30569012-30569034 CTGCTCAGGGGCTGGGGCATTGG No data
1038781090_1038781098 -8 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781098 8:30569006-30569028 TTCCGCCTGCTCAGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781090 Original CRISPR AGGCGGAATGGCTGCCTAGG AGG (reversed) Intronic
902096574 1:13950672-13950694 AGAGGGAAGGGCTGCCTAGAAGG + Intergenic
902353055 1:15872864-15872886 AGGAGGAGTGGCTGCCTTTGTGG + Exonic
902360561 1:15940587-15940609 AGGAGGACTGACTGACTAGGAGG - Intergenic
903845657 1:26278599-26278621 AGGCTGAAGGGCTGGCTGGGTGG - Exonic
904005204 1:27359980-27360002 AGGAGGACAGGCTGCCTGGGTGG + Exonic
905657421 1:39693723-39693745 AGACAGAAGGGCTGCCCAGGAGG - Intronic
905906536 1:41622169-41622191 AGGCCGAATCCCTGCCTAGAGGG + Intronic
910108949 1:83661496-83661518 AGGAGGAATGGGTGCCCAGGGGG - Intergenic
915838316 1:159195764-159195786 ACGCCGAAGGGCTGCTTAGGAGG - Intronic
922572350 1:226641733-226641755 AGGCGGGATGGCTGTGTAGGGGG - Intronic
1065398360 10:25266355-25266377 AGGTGGAATGGATGCCTTTGTGG + Intronic
1065996999 10:31068830-31068852 AGCCAGAATGGCTACATAGGTGG + Intergenic
1067317172 10:45179967-45179989 AGGCTGGCTGGCTGGCTAGGAGG + Intergenic
1073105452 10:101030111-101030133 AGCCTGAGTCGCTGCCTAGGTGG + Exonic
1077899715 11:6478671-6478693 ATGAGGAATGACTGCCTGGGAGG + Intronic
1079302505 11:19290737-19290759 AGGCAAAAAGGCTGCCTAGTTGG - Intergenic
1080426785 11:32162521-32162543 AGATGGAATGGCAGCCTAAGGGG - Intergenic
1082092335 11:48100118-48100140 AGGTGGGGTGGCTGCCTTGGGGG + Intronic
1084155594 11:67311034-67311056 AGGCCAAATGGCTGACTTGGAGG + Intronic
1085193357 11:74648656-74648678 AGGCAGAATGGTTGGCTATGAGG + Intronic
1089904358 11:122023272-122023294 AGGAGGAGTGGCAGCCTAGCTGG - Intergenic
1094496128 12:30990511-30990533 AGGCTGAAAGGCGGCTTAGGAGG - Intronic
1103040697 12:117693108-117693130 AGGCGGGATGGTTGCCTAAGAGG + Intronic
1112600300 13:100848566-100848588 AGGAGGAAAGGATTCCTAGGTGG + Intergenic
1119467656 14:74871995-74872017 AAGGGGAAGGGCTGCCTATGAGG + Intergenic
1119881711 14:78104870-78104892 TGGAGGGATGGCTGGCTAGGTGG + Intergenic
1122516852 14:102314836-102314858 AGGCGGAGGGGCTGCCGCGGAGG + Intergenic
1123902112 15:24887670-24887692 AGGTGGAATAGCTGCCTTTGGGG + Intronic
1124378399 15:29143432-29143454 AGGCTGCAGGGCTGCCTTGGGGG + Intronic
1126739646 15:51764694-51764716 AGGCGGCATGGCTACAGAGGGGG - Intronic
1127628675 15:60805153-60805175 AGAGGGGATGGCTGCCTATGGGG - Intronic
1128968827 15:72087701-72087723 AGGTGGAATGGCTGCCACTGAGG - Intronic
1133614128 16:7460160-7460182 AGGAGGAATGACAGCCTAAGAGG - Intronic
1134112526 16:11524217-11524239 AGGGGGAATGGGTGAGTAGGTGG - Intergenic
1135375838 16:21946524-21946546 AGGGGGAATGGCCGCCATGGAGG - Intergenic
1137311682 16:47267044-47267066 AGGGGGAATGACTGCTTAAGGGG + Intronic
1141880964 16:86858968-86858990 CGGTGGAATGGCTTCCTTGGAGG + Intergenic
1154503040 18:15005873-15005895 AGGTGGAGGGGCTGCCTCGGAGG + Intergenic
1155995300 18:32324926-32324948 AGGAGGAATGGATGAATAGGTGG + Intronic
1156273751 18:35561670-35561692 GGGAGGAATGCCTGCCTTGGAGG - Intergenic
1158421514 18:57298964-57298986 AGGAGCAAAGGCTGCCTTGGTGG + Intergenic
1161053719 19:2179380-2179402 AGGCTGCACGGCTGCCTGGGCGG + Intronic
1167334250 19:48874803-48874825 AGTCGGAGGGGCAGCCTAGGAGG - Exonic
927255871 2:21040491-21040513 TGGCTGAATGCCAGCCTAGGAGG + Intronic
935211768 2:100944871-100944893 AGGCTGAGTGGCTGCCTGGCCGG - Intronic
938502205 2:131836043-131836065 AGGTGGATGGGCTGCCTCGGCGG + Intergenic
946417921 2:219549908-219549930 AGGCTGAGTGGCAGCCTAGCAGG - Exonic
948677098 2:239603069-239603091 AGGCGTTGTGGCTGCCGAGGAGG + Intergenic
1179513642 21:41891769-41891791 AGGGGAAATGGAGGCCTAGGGGG + Intronic
1181114069 22:20620458-20620480 AGGAGGAGAGGCTGCCTGGGTGG - Intergenic
1181574135 22:23783217-23783239 AGGCAGAAGGGCTCCCTAGAGGG + Intronic
1183562142 22:38583592-38583614 AAAGGGAATGCCTGCCTAGGAGG - Intronic
1184872043 22:47246988-47247010 AGGCTGAGTGCCTGCTTAGGAGG + Intergenic
949346880 3:3084923-3084945 AGGCAGAATGTATGCCTAGAAGG + Intronic
951525578 3:23649693-23649715 AAGCTAAATGGCTGCCTAGCAGG - Intergenic
954798820 3:53175268-53175290 AGGCGGAATGGATGCGGTGGGGG + Intronic
956343257 3:68249562-68249584 AAGGGGAATGGCTGCTCAGGAGG + Intronic
956611207 3:71125121-71125143 TGCAGGAATGGCTGCCTAAGAGG + Intronic
961564593 3:127754515-127754537 AGGCGGTACTGCTGCCTAGCGGG - Intronic
961632855 3:128313891-128313913 AGCAGCAGTGGCTGCCTAGGAGG - Intronic
973291638 4:48477061-48477083 AGGCGGAGTGGCTGGCTTTGGGG - Intergenic
985199003 4:187464607-187464629 AGACTGGCTGGCTGCCTAGGGGG - Intergenic
985502010 5:254208-254230 AGGCCGCATGGCTGGCCAGGGGG - Intronic
985735007 5:1574458-1574480 AGGCCGCATGGCTGGCCAGGGGG + Intergenic
987535384 5:19180687-19180709 AGGTGGAAAGGATGCTTAGGAGG - Intergenic
988367036 5:30313657-30313679 AGGAGGAATGGTGGACTAGGCGG - Intergenic
988411962 5:30897675-30897697 AGATGGAATGGCAGCCTATGGGG + Intergenic
990535764 5:56720332-56720354 AGGAGGAGTGGCTGCCTGGTTGG - Intergenic
994051390 5:95366102-95366124 AGGCAGAATGGCTTGCTAGGGGG + Intergenic
997461409 5:134055063-134055085 AGGCAGGATGGCTGCCCTGGTGG + Intergenic
999099394 5:149010378-149010400 TGTCTGGATGGCTGCCTAGGTGG + Exonic
1002705856 5:181160585-181160607 AGGCGGTGGGGCTTCCTAGGAGG + Intergenic
1003161489 6:3638242-3638264 AGGGGGAATGGCTGCTTAATGGG + Intergenic
1006416401 6:33906788-33906810 AGGTAGAATGGCTGGATAGGAGG + Intergenic
1006836075 6:36999471-36999493 AGGTGGGATGGCTGGCAAGGGGG + Intergenic
1015521355 6:134134742-134134764 AGTCGGAATGTCTGCCAAGATGG - Intergenic
1018667064 6:166148500-166148522 AGGCCGCATGGTTGCCTGGGTGG + Intergenic
1018840083 6:167510151-167510173 AGGTAGAATGGCTGTCTAAGGGG + Intergenic
1022207642 7:28179882-28179904 AAGCGGAATGGCTGCCGCGGTGG + Intronic
1022631877 7:32093158-32093180 AGGTAGAATGACTGCCTAGAGGG + Intronic
1025635843 7:63318325-63318347 AGGCGGAACGGGCGCCTGGGTGG - Intergenic
1025646853 7:63429855-63429877 AGGCGGAACGGGCGCCTGGGTGG + Intergenic
1029794107 7:102875677-102875699 TGGGGGAATGGCTACATAGGTGG + Intronic
1031454740 7:121965189-121965211 AGGAGGAAGGGCTGCTTAGCTGG + Intronic
1033606725 7:142933072-142933094 AGGCAGAATGACAGCCAAGGGGG - Intronic
1034423310 7:151000358-151000380 GGGAGGCCTGGCTGCCTAGGGGG - Intronic
1038781090 8:30568991-30569013 AGGCGGAATGGCTGCCTAGGAGG - Intronic
1042434890 8:68752403-68752425 AGGCGGTATGGCTCCCTGGCTGG + Intronic
1052196290 9:25718963-25718985 AAGAGCAATGGCTGCCTATGAGG - Intergenic
1053457276 9:38242253-38242275 GGACGGCATGGCTGGCTAGGCGG - Intergenic
1061707318 9:132463100-132463122 AGGAGGAAAGGGTGCCTGGGCGG + Intronic
1061925563 9:133804553-133804575 AGGAGGAATGGCTGGCTGTGTGG - Intronic
1062497236 9:136837636-136837658 AGGTGGAGGGGCTGCCTCGGTGG - Exonic
1189201925 X:39203783-39203805 AGGAGGGAAGGCTGCCTGGGTGG + Intergenic
1192116671 X:68418239-68418261 AGCAGGGATGGCTGGCTAGGAGG + Intronic
1195960217 X:110378365-110378387 ATGTGGAGTGGCTGCTTAGGAGG - Intronic