ID: 1038781091

View in Genome Browser
Species Human (GRCh38)
Location 8:30568994-30569016
Sequence AGCAGGCGGAATGGCTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781091_1038781103 7 Left 1038781091 8:30568994-30569016 CCTAGGCAGCCATTCCGCCTGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781091_1038781104 20 Left 1038781091 8:30568994-30569016 CCTAGGCAGCCATTCCGCCTGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG No data
1038781091_1038781105 28 Left 1038781091 8:30568994-30569016 CCTAGGCAGCCATTCCGCCTGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1038781105 8:30569045-30569067 GGTTCATTACCCAGGAAAGCTGG No data
1038781091_1038781102 -4 Left 1038781091 8:30568994-30569016 CCTAGGCAGCCATTCCGCCTGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1038781102 8:30569013-30569035 TGCTCAGGGGCTGGGGCATTGGG No data
1038781091_1038781101 -5 Left 1038781091 8:30568994-30569016 CCTAGGCAGCCATTCCGCCTGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1038781101 8:30569012-30569034 CTGCTCAGGGGCTGGGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781091 Original CRISPR AGCAGGCGGAATGGCTGCCT AGG (reversed) Intronic
900311705 1:2036481-2036503 AGCAGGAGGAAGTGCTGCCCCGG - Intergenic
900928989 1:5724434-5724456 AGAAGGCAGAAGGGCTGCCCAGG - Intergenic
901132405 1:6970391-6970413 AGGAGGCGGAATGGGTGGCAGGG + Intronic
901735717 1:11310945-11310967 TGCAAGCAGAATGGCCGCCTTGG + Intergenic
901763196 1:11483966-11483988 GGCAGCCGGACTGGCTTCCTTGG + Intronic
902609355 1:17588188-17588210 AGCAGGCAGGGTGGCTGCCACGG + Intronic
903360412 1:22773471-22773493 ACCAGGCTGATTTGCTGCCTAGG + Intronic
903574855 1:24332951-24332973 AGGAGTTTGAATGGCTGCCTTGG + Intronic
904419882 1:30384753-30384775 GGCAGGGGGCATGGCTGCCAAGG + Intergenic
910108952 1:83661499-83661521 AGGAGGAGGAATGGGTGCCCAGG - Intergenic
912950649 1:114118186-114118208 AGCAGGGGGAAGGGAGGCCTGGG - Intronic
1063217521 10:3937963-3937985 AGCTCACGGAAGGGCTGCCTGGG + Intergenic
1069652607 10:70060571-70060593 AGCAGGTGGACTGTATGCCTTGG - Intronic
1072681965 10:97514184-97514206 AGCAGGCAGGATGGGAGCCTGGG + Intronic
1076006975 10:126955673-126955695 GGCAGGAGGGATGGCTGTCTTGG + Intronic
1076516853 10:131050557-131050579 AGCAGGTGGAAAGGATGACTGGG - Intergenic
1077899714 11:6478668-6478690 AGGATGAGGAATGACTGCCTGGG + Intronic
1084192373 11:67504912-67504934 AGAGGACGGAGTGGCTGCCTAGG - Intronic
1085243463 11:75077725-75077747 AGCAGACTGAATGGCTGACCAGG - Intergenic
1090344449 11:126057535-126057557 AGCAAGAGGGAGGGCTGCCTGGG + Intronic
1090818196 11:130316412-130316434 AGAAGGCGGAATGCTTACCTGGG + Intergenic
1096627926 12:52906620-52906642 TGCAGGTGGAATCTCTGCCTTGG - Intronic
1096873808 12:54611757-54611779 AGCAGGGGGCATGGCTTGCTGGG + Intergenic
1097244989 12:57602906-57602928 AGCAAGAAGAATGGGTGCCTTGG - Exonic
1098694563 12:73537019-73537041 AGCTGGAGGAATGAGTGCCTGGG + Intergenic
1102867177 12:116383527-116383549 GGCAGAGGGAATGGCTGCCGAGG + Intergenic
1103474932 12:121211098-121211120 AGCATGGGGAATGACTGACTAGG - Intronic
1103505244 12:121438622-121438644 AGGAGAAGGAATGGCTTCCTAGG + Intronic
1104480869 12:129106880-129106902 TGCATGGGGAATGCCTGCCTTGG + Intronic
1106477119 13:30108446-30108468 AGCAGGGGACAGGGCTGCCTTGG - Intergenic
1111980756 13:95013007-95013029 TGCAGTGGGAGTGGCTGCCTGGG - Intergenic
1115740675 14:36384389-36384411 AGCAGAAGGAAAGGCTGCTTTGG - Intergenic
1118254900 14:64197007-64197029 GGCAGGGGGAGGGGCTGCCTCGG + Intronic
1120484382 14:85092784-85092806 AGCATGCAGAATGGCTGCCGAGG - Intergenic
1121670251 14:95704219-95704241 AGCAAGCTTGATGGCTGCCTTGG + Intergenic
1122188952 14:100024673-100024695 AGCAAGCCACATGGCTGCCTGGG - Intronic
1122516851 14:102314833-102314855 AGGAGGCGGAGGGGCTGCCGCGG + Intergenic
1123117816 14:105902567-105902589 AGCAGGTGAAGTGGATGCCTGGG + Intergenic
1124614323 15:31230581-31230603 AGCAGCAGGCATGGCTCCCTGGG + Intergenic
1126739649 15:51764697-51764719 AGCAGGCGGCATGGCTACAGAGG - Intronic
1128107305 15:65054473-65054495 AGCCTGCGGAATGACAGCCTGGG - Exonic
1128636106 15:69303471-69303493 AGCAGAGGAATTGGCTGCCTTGG - Intronic
1128721821 15:69955732-69955754 AGCACGCTGCATGCCTGCCTGGG - Intergenic
1128762190 15:70224881-70224903 AGCAGGAGGAAAGGATGCTTTGG + Intergenic
1129850203 15:78789480-78789502 AGCAGGAGAGAGGGCTGCCTGGG - Intronic
1132939623 16:2500360-2500382 AGGAGGCGGAGTGGCTGAGTGGG - Exonic
1133063044 16:3187896-3187918 AGCAGGAGTAAAGCCTGCCTCGG + Intergenic
1133087290 16:3374838-3374860 AGCAGGGGATCTGGCTGCCTGGG + Intronic
1133932309 16:10242421-10242443 ACCAGGGGGAATGGCTCCCCAGG - Intergenic
1139583020 16:67884334-67884356 AGCAGGCGCAATACCTGCCCTGG - Exonic
1140209109 16:72957431-72957453 AGCAGGCGTCATGGCGGCCATGG + Exonic
1141880962 16:86858965-86858987 ATCCGGTGGAATGGCTTCCTTGG + Intergenic
1142057834 16:88011115-88011137 AGCGGCCGGAAGGGCTGTCTGGG + Intronic
1142097069 16:88245950-88245972 AGCAGCTGGAATGGTTGCTTTGG + Intergenic
1144099530 17:11931588-11931610 AGCAGGTGTAATCACTGCCTGGG - Intronic
1146621102 17:34398609-34398631 AGCAGGCAGAGTGACTGACTTGG + Intergenic
1147574976 17:41593725-41593747 AGCAGGCGGCATAGCTGTCTGGG - Intergenic
1150610417 17:66728789-66728811 GGAAGGCGGAATGACTGTCTGGG + Intronic
1150765524 17:67998862-67998884 AGCAGGCTGGATGGCTCCCAGGG + Intergenic
1152344525 17:79743055-79743077 AGCAGCCTGATTGGCTGCCTGGG + Intergenic
1159611734 18:70533151-70533173 AGGAGACAGAATGGCTGCCAAGG + Intergenic
1163782287 19:19256902-19256924 AGCAGCAGGACTGGTTGCCTTGG + Exonic
1165228140 19:34368519-34368541 AGCTGGGAGCATGGCTGCCTGGG + Intronic
1166167682 19:41003863-41003885 AGCAGGGGAAAGGGCAGCCTGGG + Intronic
928433379 2:31238608-31238630 GGCAGGAGGAAAGGCTGCCAGGG - Intronic
929591485 2:43150436-43150458 AGCAGGAGCAGTGTCTGCCTGGG + Intergenic
929830798 2:45344732-45344754 AGCAGTGGGAAGGGCTTCCTGGG - Intergenic
931904246 2:66825223-66825245 AGGAGGTGGAATGGCAGCCACGG + Intergenic
932679522 2:73812656-73812678 GCCAGGCAGAGTGGCTGCCTGGG + Intronic
934688404 2:96338284-96338306 AGCAGGTGCAATGGCAGACTTGG - Intronic
937301863 2:120847657-120847679 AGCAGGCTGAATGTCAGCCCTGG + Intronic
937867013 2:126760010-126760032 AGCAGGCAGAATCCCTGCATTGG + Intergenic
938306882 2:130262659-130262681 AGCAGGAGAGGTGGCTGCCTTGG - Intergenic
943044845 2:182848319-182848341 AGCAGCAGGAATGGATGCCATGG + Intronic
944910400 2:204305240-204305262 AGCATGTGGAGTGGCTGCCACGG - Intergenic
947301999 2:228698043-228698065 AGCAGGAGGAAGGTCTGTCTTGG + Intergenic
948299110 2:236888688-236888710 AGCAGGCGGAATGGAGGCCCAGG - Intergenic
1169546752 20:6658243-6658265 AGCATCCGGCATGGCTACCTAGG + Intergenic
1169773181 20:9223637-9223659 AGCAGGGGGACAGCCTGCCTGGG + Intronic
1170769402 20:19318870-19318892 TCCATGCTGAATGGCTGCCTCGG + Intronic
1171272565 20:23828096-23828118 AGCTGGAAGCATGGCTGCCTAGG - Intergenic
1171414484 20:24968402-24968424 AGCAGGCGGGATGGCAGCTGTGG + Intronic
1172442181 20:34973601-34973623 AGCAGCGGGAGAGGCTGCCTTGG - Intergenic
1173320302 20:41981728-41981750 AGCAGACAGCATGGGTGCCTTGG + Intergenic
1174559201 20:51417870-51417892 AGCTGGCAGGCTGGCTGCCTCGG - Intronic
1176096538 20:63346973-63346995 ACCAGCAGCAATGGCTGCCTCGG - Intronic
1176390487 21:6160608-6160630 AGCAGGCCTGATGGCTGCCATGG + Intergenic
1177070686 21:16503167-16503189 AGCAGACAGGATGGCAGCCTTGG - Intergenic
1179732980 21:43377632-43377654 AGCAGGCCTGATGGCTGCCATGG - Intergenic
1180994681 22:19959616-19959638 AGCAGAGGGACTGGCTGCCCCGG - Intronic
1181822395 22:25486252-25486274 AGCAGAAGGCATGGCTGTCTTGG + Intergenic
1181885236 22:26016848-26016870 AGAGGGCGGAAAGGCTTCCTGGG + Intronic
1184162365 22:42704635-42704657 AGCAGGCGGTCTTGCTGTCTGGG + Intronic
1185028329 22:48428054-48428076 TGCAGCCGGAAAGCCTGCCTGGG - Intergenic
1185090179 22:48762319-48762341 AGCAGGCGGATTAGCTGCCTAGG + Intronic
950417712 3:12877691-12877713 AGCAAGCAGAATGGAGGCCTGGG + Intergenic
951673899 3:25215560-25215582 AGCAGGAGGAAGTTCTGCCTTGG + Intronic
952745236 3:36770826-36770848 AGCAGGAAAAATGGTTGCCTTGG - Intergenic
954117842 3:48477013-48477035 AGGAGGAGGAGTGGCTTCCTGGG - Intronic
954168075 3:48777151-48777173 AGCAGGCGAGATGACTGTCTTGG - Intronic
954712000 3:52509813-52509835 AGCAGGAGGCAGGGCTGGCTGGG - Intronic
954798817 3:53175265-53175287 GGCAGGCGGAATGGATGCGGTGG + Intronic
956402980 3:68899494-68899516 AATAGGAGGAATGGCTTCCTAGG - Intronic
961452911 3:127010516-127010538 AGGAAGCTGACTGGCTGCCTGGG - Intronic
961529785 3:127533455-127533477 AGGAGGCAGCTTGGCTGCCTTGG + Intergenic
964548949 3:157865529-157865551 AGCAGGGGGCGTGGCAGCCTCGG + Intergenic
969282875 4:6182973-6182995 AGCGGGAGGAAGGGCTGCCTTGG - Intronic
970437253 4:16047698-16047720 AGCAGGAGCAATAGCTGGCTGGG - Intronic
973894246 4:55396180-55396202 GGCAGGCGGGATGGCGGCCGCGG + Exonic
974932541 4:68375500-68375522 AGCAAGCGAAATGGCAGCTTTGG - Intergenic
977871084 4:102091598-102091620 AGCAGGCTAAGTGGCTGCCTGGG + Intergenic
979735854 4:124082701-124082723 AGCTGGAGGAATGGCAGCCAGGG - Intergenic
983249143 4:165325667-165325689 AGCTGGAGGAATGCCTGCTTAGG + Intergenic
984853959 4:184177153-184177175 AGCAGGGGAAATGGCAGACTGGG - Intronic
995650287 5:114361818-114361840 AGCAGGCGGAATCCCTGCCCTGG + Intronic
996171532 5:120298370-120298392 AGCTGGGGGAATGTGTGCCTGGG - Intergenic
997461408 5:134055060-134055082 AGAAGGCAGGATGGCTGCCCTGG + Intergenic
998490729 5:142544358-142544380 AGCTGGCGGAAATGCTGCCTGGG + Intergenic
998699474 5:144681580-144681602 AGCTGGGCGTATGGCTGCCTCGG - Intergenic
1000451872 5:161399548-161399570 AGCAGGACTAGTGGCTGCCTTGG + Intronic
1000460820 5:161515956-161515978 AGCAGGCAGAAAAGCTGCCATGG - Intronic
1002182729 5:177439660-177439682 AGCATGGGGAATGGCTGCTAAGG - Intronic
1002436740 5:179236142-179236164 GGCAGGGGGAAGAGCTGCCTTGG + Intronic
1002705855 5:181160582-181160604 AGCAGGCGGTGGGGCTTCCTAGG + Intergenic
1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG + Intergenic
1004895787 6:20146652-20146674 AGCAGCAGGCATGGCTGCATTGG - Intronic
1006358470 6:33574252-33574274 GGCAGGCTGAAGGGCTTCCTGGG - Intronic
1006747634 6:36355860-36355882 ATCAGAGGGAATGACTGCCTTGG - Intronic
1008066582 6:47055953-47055975 TGCAGGCAGAAGGGCTGCCAAGG - Intergenic
1010988681 6:82454616-82454638 AGCAGTCAGAATGGCCACCTCGG - Intergenic
1014065595 6:117121447-117121469 AGCTGGCTGATTGGCTGACTTGG + Intergenic
1015810987 6:137162146-137162168 AGGAGGCGGAGAGGCTGCCAAGG + Intronic
1017653258 6:156602048-156602070 AGCAGCCCACATGGCTGCCTGGG + Intergenic
1017923500 6:158891004-158891026 AGCAGAGGCAATGACTGCCTTGG - Intronic
1018419959 6:163632302-163632324 AGCTGTCGGGATGGTTGCCTCGG + Intergenic
1018784549 6:167098067-167098089 AGAAGGCGGAAAGGCACCCTTGG - Intergenic
1018910437 6:168098401-168098423 AGGAGCAGGAATGCCTGCCTGGG + Intergenic
1021169408 7:17380463-17380485 AGCAGGAGGAATGGATGTTTCGG - Intergenic
1022207641 7:28179879-28179901 AGGAAGCGGAATGGCTGCCGCGG + Intronic
1024324025 7:48094774-48094796 AGTTGGCGGAATGGCGGCCACGG + Exonic
1025635844 7:63318328-63318350 AGGAGGCGGAACGGGCGCCTGGG - Intergenic
1025646852 7:63429852-63429874 AGGAGGCGGAACGGGCGCCTGGG + Intergenic
1029686699 7:102153408-102153430 AGCTGGAGGCGTGGCTGCCTGGG - Intronic
1031556182 7:123179636-123179658 AGCAGGAGGGAAGGGTGCCTGGG - Intronic
1031934609 7:127723703-127723725 AACAGGAGGAATGGCTCTCTAGG + Intronic
1033823633 7:145163107-145163129 AGCAGGAGGCCTGGCTGGCTGGG - Intergenic
1034708648 7:153170964-153170986 GGCAGCTGGAATGGCTGCGTGGG + Intergenic
1036765464 8:11547033-11547055 AGCATGGGGAAGGGATGCCTCGG + Intronic
1036953778 8:13165805-13165827 AGTAGGGTGAATGGCTTCCTTGG + Intronic
1037348366 8:17923346-17923368 AGCGGGCGGACTGACCGCCTAGG - Intronic
1037635262 8:20696122-20696144 AGCAGGCAGAGTGGGTGCCTTGG + Intergenic
1038781091 8:30568994-30569016 AGCAGGCGGAATGGCTGCCTAGG - Intronic
1042136026 8:65633907-65633929 CCCAGGCGGATTCGCTGCCTCGG + Intronic
1043255031 8:78124223-78124245 AGCAAGATGGATGGCTGCCTGGG + Intergenic
1046380905 8:113449230-113449252 AGCAGCCCAAATGGCTGCCTTGG - Intergenic
1048023803 8:130565824-130565846 AACAGGAGGAATGACTGCATTGG - Intergenic
1048152052 8:131903985-131904007 AGCGGGTGGAATGGGTGGCTGGG - Intergenic
1053335022 9:37260358-37260380 AGCAGCTGGACTGGCTGCCTGGG - Intronic
1061449222 9:130659668-130659690 TGCCGGCGGAGTGGCGGCCTCGG - Intergenic
1061541568 9:131280295-131280317 AGCAGGAGGAAGGGCTGTGTAGG - Intergenic
1061557593 9:131381257-131381279 AGCAGGTGGGATGGCTTCCTGGG + Intergenic
1062177092 9:135169370-135169392 AGCAGGCACAAAGGCTGCCGTGG + Intergenic
1062580977 9:137229107-137229129 TGCAGGGGAAATGCCTGCCTTGG + Exonic
1185625128 X:1475897-1475919 CCCAGGAGGAATGGCTGCATAGG + Intronic
1187989928 X:24859302-24859324 AGAAGGTGGAAAGGCTGGCTTGG - Intronic
1189132337 X:38513154-38513176 AGAAGATGAAATGGCTGCCTTGG - Intronic
1189201924 X:39203780-39203802 AGCAGGAGGGAAGGCTGCCTGGG + Intergenic
1190797488 X:53758991-53759013 AGCAGGAGGAAGGGCTGCTCAGG - Intergenic
1196045568 X:111252765-111252787 AGCAGGAGGAAAGGGTACCTGGG + Intronic
1199680667 X:150222202-150222224 AGCAGAGTGAATGGCTGCCTGGG - Intergenic