ID: 1038781095

View in Genome Browser
Species Human (GRCh38)
Location 8:30569003-30569025
Sequence CAGCCCCTGAGCAGGCGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781095_1038781103 -2 Left 1038781095 8:30569003-30569025 CCATTCCGCCTGCTCAGGGGCTG 0: 1
1: 1
2: 1
3: 21
4: 253
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781095_1038781104 11 Left 1038781095 8:30569003-30569025 CCATTCCGCCTGCTCAGGGGCTG 0: 1
1: 1
2: 1
3: 21
4: 253
Right 1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG No data
1038781095_1038781105 19 Left 1038781095 8:30569003-30569025 CCATTCCGCCTGCTCAGGGGCTG 0: 1
1: 1
2: 1
3: 21
4: 253
Right 1038781105 8:30569045-30569067 GGTTCATTACCCAGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781095 Original CRISPR CAGCCCCTGAGCAGGCGGAA TGG (reversed) Intronic
900950284 1:5854714-5854736 CAGCCCCGGAGCAGGAGGGTTGG - Intergenic
901210085 1:7519729-7519751 GAGCCCCTGAGGAGGAGTAAGGG - Intronic
901494950 1:9615517-9615539 CAGCCAGTGAGCAGGGGGACCGG + Intergenic
902397872 1:16142398-16142420 CAGCTCCTGAGGAGCAGGAATGG + Intronic
902954880 1:19918767-19918789 CAGGCCCTGAGAAGGGTGAAGGG + Intergenic
903033467 1:20479649-20479671 CAGGCCCTGTGCAGGGAGAAGGG + Intergenic
905348386 1:37327488-37327510 CAGCCTCTGAGCCTGGGGAAGGG - Intergenic
905749480 1:40450048-40450070 CAGCCGCTGCGCAGGCGCACTGG + Intergenic
905821742 1:40998029-40998051 CAGCAGCTGAGCTGGTGGAATGG + Intronic
906533580 1:46538724-46538746 CAGTGCCTGAGCAGGAGGGAGGG + Intergenic
908581910 1:65525532-65525554 CCGCCCCTGAGCGGGAGGAGCGG - Intronic
912413529 1:109493504-109493526 CAGCTGCTGAGGAGGCGGCAGGG + Intergenic
912553617 1:110500301-110500323 CACCCCCTGAGGATGAGGAAAGG - Intergenic
914417416 1:147496733-147496755 CAGGCCTTGGGTAGGCGGAAGGG - Intergenic
916118980 1:161511610-161511632 CAGCCCCTGAGCAGGGGAACTGG + Intronic
920674440 1:208029471-208029493 CAGCCTCGGAGCAGGCACAAAGG + Intronic
921304494 1:213782204-213782226 CAGCCCCTGAAGGGGCAGAAAGG + Intergenic
921541324 1:216419534-216419556 CCGACCCTGAGCAGGAAGAAGGG - Intronic
922417133 1:225431722-225431744 CAGCCCTTGGGCGGTCGGAATGG - Intergenic
922663145 1:227447555-227447577 CAGCCACAGAGCAGGGAGAAAGG + Intergenic
922763101 1:228144558-228144580 CAGCCGCAGAGCAGGTGGATGGG + Intronic
922862606 1:228832035-228832057 CTGCCCCAGAGCCGGAGGAAAGG + Intergenic
923336522 1:232975696-232975718 CAGCCACTGGGCAGGTGCAAGGG + Intronic
923516051 1:234698777-234698799 GGGCCCCTGAGCAGGCGGTTGGG - Intergenic
1065380289 10:25083335-25083357 CTGCACCTAAGCAGGCAGAAAGG - Intergenic
1066357712 10:34701164-34701186 AGGACCCTGAGCAGGGGGAAGGG + Intronic
1067140023 10:43648854-43648876 CAGCGCCGGCGCCGGCGGAATGG + Intronic
1067917638 10:50418153-50418175 CAGCCCTGGCGCGGGCGGAAAGG + Intronic
1070670930 10:78376721-78376743 CTGCCCCTGAGCAGGTGGGCTGG + Intergenic
1071602354 10:86964551-86964573 CATCCACTGAGGAGGCAGAACGG + Intronic
1072735066 10:97873664-97873686 CAGCCCCAGAGCAGCCAGGAAGG - Intronic
1074564180 10:114562122-114562144 CAGCCCCTGACCTGGAGGAGGGG - Intronic
1075349459 10:121710722-121710744 CAGCCCCTGAATAGGAGCAAGGG - Intergenic
1075924861 10:126243154-126243176 CAGCTGCTGAGCAGGCAGCATGG + Intronic
1076790512 10:132774756-132774778 CAGCCCCTGTGTAGGCTGCACGG - Intronic
1076883633 10:133251653-133251675 CAGCCTGTGAGCAGGAGGACAGG + Intergenic
1076902536 10:133347164-133347186 CAGGCCCTGAGCAGGCAGCTGGG + Exonic
1077444084 11:2582283-2582305 CAGCCACTGAGGAGGAGGGAGGG - Intronic
1077500820 11:2909126-2909148 CAGCCCCTGGACGGGGGGAAGGG + Intronic
1081491880 11:43575623-43575645 CAGCCACTGAGCAGGCGAGGCGG - Intronic
1083879475 11:65540922-65540944 CAGCCTCTGCCCAGACGGAAAGG - Exonic
1084482428 11:69429764-69429786 CAGCCCATGTGCCGGCGGAACGG - Intergenic
1087820177 11:102702805-102702827 CAGACCCGGACCAGGAGGAAAGG + Exonic
1089195691 11:116692932-116692954 CAGCCCCAGACCAGGCAGCAGGG + Intergenic
1089602660 11:119625004-119625026 CAGCCCCTAAGCTGGGGGAGGGG + Intronic
1089658872 11:119972654-119972676 TAGCCCCTGACCTGGTGGAAGGG + Intergenic
1090648597 11:128786969-128786991 CAGCCCCACTGCAAGCGGAATGG + Intronic
1091054670 11:132406822-132406844 CTGCCCCAGAGCAGGAGGGAAGG + Intergenic
1091702648 12:2674195-2674217 CAGCCCCTGGGCAGGAACAATGG - Intronic
1094155361 12:27332856-27332878 CAGCTACTGAGCATGCGGACTGG - Intronic
1096217904 12:49808686-49808708 CAGCCCCTGGGGAGGCAGCAGGG - Intronic
1098943175 12:76559982-76560004 CTGCCCTTGGGCATGCGGAAGGG - Intergenic
1099535940 12:83844602-83844624 AAGCCCCTGTTCAGGCGTAATGG - Intergenic
1101413279 12:104486733-104486755 GAGCCCCTGAGCCGACTGAAGGG + Intronic
1102453778 12:113058629-113058651 CAGCCTCTGAGCAAGCTGTAGGG + Intronic
1103562129 12:121798259-121798281 CAGCCCCTGTGGATGGGGAAAGG + Intronic
1103923750 12:124412686-124412708 CAGCCCCTGAGCAGGGAGCAGGG - Intronic
1103976267 12:124704835-124704857 CAGCCCCTGTGCAGGAGAGAGGG - Intergenic
1103979929 12:124730328-124730350 CAGCCCATGAGCAGGCGAGTGGG - Intergenic
1104587042 12:130055923-130055945 CAGCCCCTGAGCAGCTGGGCAGG - Intergenic
1104763862 12:131313989-131314011 AAGCCCCAGAGAAGGCGGCAGGG + Intergenic
1104841740 12:131828968-131828990 CAGCCCCGGAGCAGCCGGGCTGG + Intronic
1105893625 13:24699750-24699772 CAGCACCAGGGCTGGCGGAATGG + Intronic
1107210815 13:37852220-37852242 CACCCCCTAAGCAGAAGGAAGGG - Intronic
1108756162 13:53504830-53504852 CAGCACCTTAGCAGCAGGAAGGG + Intergenic
1113910274 13:113838393-113838415 TAGCCCCGGAGCAGGAGGAAGGG + Intronic
1113910306 13:113838474-113838496 CAGCCCCGGAGCAGGAGGAGGGG + Intronic
1113910338 13:113838555-113838577 CAGCCCCGGAGCAGGAGGAAGGG + Intronic
1113910369 13:113838636-113838658 CAGCCCCGCAGCAGGAGGAAGGG + Intronic
1113910414 13:113838757-113838779 CAGCACTGGAGCAGGAGGAAGGG + Intronic
1117452897 14:55868539-55868561 CAGCACCTGGGTAGGCTGAAGGG - Intergenic
1119431430 14:74570472-74570494 CAGCCCCTGTGAGAGCGGAAAGG - Intronic
1119859129 14:77923965-77923987 CAGCCCCAGAGGAGGCGGTGGGG + Intronic
1121348971 14:93157524-93157546 CAGCCCCAGAGCAAGTGGACAGG + Intergenic
1121495706 14:94390241-94390263 CTTCCCCTGAGCTGGCTGAATGG + Intronic
1121665627 14:95670055-95670077 CAGCCCCTGGGCAGGGGACAGGG - Intergenic
1121823270 14:96989041-96989063 CAGCCCCTGAGCAGAAAGAAGGG - Intergenic
1123131290 14:105987688-105987710 CAGCCCTGGAGCAGGTGCAAGGG - Intergenic
1123133341 14:106006143-106006165 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1123135736 14:106026201-106026223 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1123412559 15:20072679-20072701 TAGCCCCTGGGGAGGCGGCAGGG - Intergenic
1123521901 15:21079792-21079814 TAGCCCCTGGGGAGGCGGCAGGG - Intergenic
1123583367 15:21736588-21736610 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1123585190 15:21753891-21753913 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1123620017 15:22179185-22179207 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1123621837 15:22196498-22196520 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1125513189 15:40303654-40303676 CAGCCTCTGGGCAGGAGGACGGG - Intronic
1125578977 15:40772664-40772686 CAGCCCCTCAGCAGGCTGGCAGG - Intronic
1128073697 15:64813008-64813030 CAGCCCCTGCGGAAGGGGAAGGG + Intergenic
1128798014 15:70479067-70479089 CAGCCCTTGAGCAGGAAGACTGG + Intergenic
1129774890 15:78230124-78230146 CAGGCCCTGGGCAGGCTCAAGGG + Intronic
1129880745 15:79004641-79004663 AAGCCCCAAAGCAGGTGGAAAGG - Intronic
1130235877 15:82132974-82132996 CAGGGCCTGGGCAGGAGGAAGGG + Intronic
1130843480 15:87723406-87723428 CTGCCACTGAGCAGGCTGAGAGG - Intergenic
1132783432 16:1641496-1641518 CAGCCCCACAGCAGGCACAAAGG - Intronic
1132977969 16:2719963-2719985 CTGCCCCTGAGCAGGTGGGAAGG - Intronic
1133918435 16:10130455-10130477 CATCCCCTGAGTAGGCAGATGGG + Intronic
1134014507 16:10878979-10879001 CGGCCCCAGAGCTGGCGGGAGGG + Intronic
1134567075 16:15261008-15261030 CAGCCCCGGAGGAGGAGGGAGGG + Intergenic
1134735418 16:16495692-16495714 CAGCCCCGGAGGAGGAGGGAGGG - Intergenic
1135836719 16:25832344-25832366 GAGCCCCTGGGCTGGCGGAGAGG + Intronic
1138346351 16:56322591-56322613 CAGCCCCCAAGCAGAGGGAAGGG - Intronic
1138391072 16:56670184-56670206 CAGGCTCTGAGCAGCCGGATTGG + Intronic
1139201445 16:64981534-64981556 CAGCCACCGAGCAGGAGGCAAGG - Intronic
1139700895 16:68707439-68707461 CAGTCCCTGAGGATGCGGCAGGG + Intronic
1140469680 16:75207059-75207081 CAGGCCCTGCGGAGGCCGAAGGG - Intronic
1141635233 16:85310883-85310905 CAGCCCCTGAGCAGACACACAGG - Intergenic
1141693311 16:85608335-85608357 CAGCCCCGGTGCAGGGGCAAGGG - Intergenic
1142017906 16:87761183-87761205 CAGCCCCTGAGCAGAGTGAGTGG - Intronic
1142021380 16:87785000-87785022 CGGCCCCTGAGCAGGAAAAATGG - Intergenic
1142510475 17:389630-389652 CACCCTCTGACCAGGCGGAGCGG + Intergenic
1143270375 17:5670747-5670769 GAGACCCTGGGCAGGGGGAATGG + Intergenic
1143612283 17:8025681-8025703 CAGCCCCAGAGCAGGGGCCAGGG + Intergenic
1143658680 17:8311974-8311996 CATCCCCTGAGGAGGAGGGAGGG - Exonic
1143894260 17:10124102-10124124 GGGCCCCTGAGGAGGCGGAGTGG + Intronic
1144585128 17:16483091-16483113 CAGCCCCACAGTAGGCAGAAAGG + Intronic
1148768140 17:50051333-50051355 CAGGCCCTGGGCAGTAGGAAAGG + Intergenic
1150307684 17:64100241-64100263 CTGCCACTGAGGAGGGGGAATGG + Intronic
1150714987 17:67564474-67564496 CAGCCCCTCAGCAGGTTGGATGG + Intronic
1152558721 17:81067362-81067384 CAGCACCTGAGCAGGGGAAGGGG + Intronic
1152650504 17:81490373-81490395 GGGCCCCTGACCAGGCTGAAGGG - Intergenic
1152763378 17:82121581-82121603 CATCCCCTGAGAAGGCCAAAAGG - Intronic
1153813669 18:8774939-8774961 CAGCCCATAAGCAAGGGGAAGGG + Intronic
1157331950 18:46710662-46710684 CAGACCCTGGGCATGCTGAAAGG - Intronic
1160277532 18:77451605-77451627 CAGCCCCTGAACAGGGGCACGGG - Intergenic
1160368464 18:78349972-78349994 CAGCACCTGAGGAAGGGGAAGGG - Intergenic
1160658822 19:288836-288858 CAGGCCCTGAGCAGGCTCCAGGG - Intronic
1161087766 19:2343076-2343098 CATCCCCTGGGCAGGTGGAAGGG + Intronic
1161978974 19:7620791-7620813 AGGTCCCTGAGCAGACGGAAGGG - Intronic
1161988105 19:7668951-7668973 AAGCCCCTGAGCAGACAGTAAGG - Intergenic
1163439466 19:17314414-17314436 CCGCCCCTCAGCAGCCAGAATGG - Intronic
1163610664 19:18299751-18299773 CAGCTGCTGAGGAGGCTGAAGGG - Intergenic
1164658578 19:29942484-29942506 CAGCGCCTGCGCAGGCGGCGCGG - Exonic
1164731778 19:30510971-30510993 CAGCCTCTGAGGAGGCCAAATGG - Intronic
1168444970 19:56404076-56404098 CTGCGCCTGCGCAGGTGGAACGG + Intronic
925276843 2:2656211-2656233 CTGCCTCTGAGCAGCCGCAAGGG + Intergenic
925395132 2:3528301-3528323 CAGCACCTGTGCAGACGCAAGGG - Intergenic
925610392 2:5696821-5696843 CAGCCCCTGAGCCGGCGCGCGGG - Exonic
926247219 2:11130374-11130396 CAGCCTCAGAGCTGGCGGGAGGG + Intergenic
927104270 2:19810396-19810418 AAACCTCTGAGCAGGAGGAAGGG + Intergenic
927492108 2:23527431-23527453 CAGTCTCTGAGCAGGCAGAAGGG - Intronic
927651101 2:24914195-24914217 CAGGCCCAGAGCAGCCGGAAGGG - Intronic
928411563 2:31058258-31058280 CAGCCCCTGACCCGTGGGAAGGG + Intronic
928453824 2:31401578-31401600 CAGCCTCTGAGCAGGAGCAACGG + Intronic
928612930 2:33008813-33008835 CAGCCCCAGAGAAGGCTGAGTGG + Intronic
931766273 2:65459286-65459308 CAGCTCCTGAGTATGCTGAATGG + Intergenic
933183787 2:79256362-79256384 CAGCCCCTGAGCTGGAGGAGGGG - Intronic
933652194 2:84858543-84858565 CAGCCCCAGAGAAGGAGGAAGGG + Intronic
937086853 2:119177613-119177635 CAGCCTGTGAGCAAGCAGAATGG - Intergenic
937229796 2:120390908-120390930 CAGCACCTGTGCAGACGGCAGGG - Intergenic
942890238 2:180980212-180980234 CGGCCCCCGCGCAGGCGGATGGG + Intronic
944117983 2:196209632-196209654 CAGCTCATCAGCAGGCGGTAGGG + Intronic
946368596 2:219266545-219266567 CAGCCCCTGTCCAGGCAGCATGG + Intronic
946769990 2:223078986-223079008 GAGACTCTGAGCAGGAGGAAAGG + Intronic
947818608 2:233055033-233055055 CAGCCCCTGACTAGGATGAAGGG - Intergenic
948312662 2:237000224-237000246 CAGCCTCTGTGCAGGCTGCAGGG + Intergenic
948567148 2:238894439-238894461 CAGCAGCTGTGCAGGCGGCAAGG - Intronic
1168806716 20:675953-675975 CAGGCCCGGAGCAGGCAGGAGGG + Exonic
1169112308 20:3042035-3042057 CAAACCCTGAGCAGGCGGCCTGG - Intergenic
1169139417 20:3218603-3218625 CGGCCCCTGAACAGGCGCACGGG - Exonic
1171350229 20:24496253-24496275 CAGCACCACAGCTGGCGGAACGG - Intronic
1171356019 20:24546019-24546041 CAGGCTCTGAGCAGAAGGAATGG + Intronic
1171384597 20:24761743-24761765 CAGCACCTGAGCTGGCGACAAGG - Intergenic
1172107837 20:32527413-32527435 CAGCCCCAGAACAGGCTGCAAGG + Intronic
1172408904 20:34708588-34708610 CACCCCCAGAGCAGGGAGAAGGG - Intronic
1172767663 20:37359386-37359408 CAGCCCGTAAGAAGGCGGTAAGG + Intronic
1172856755 20:38010298-38010320 TAGCCTCTGAGAAGGTGGAATGG - Intronic
1174105685 20:48160931-48160953 CAGCCCCTAAGCAGGCAGGCAGG - Intergenic
1176010179 20:62889214-62889236 CAGCCCCGGGGCAGAGGGAAAGG - Intronic
1176091271 20:63319625-63319647 CTGCCCCAGAGCTGGGGGAACGG - Intronic
1176104934 20:63381489-63381511 CAGCCTGAGAGCAGGAGGAAGGG - Intergenic
1176149263 20:63581088-63581110 CAGGCCCTGAGCAGGAGGCATGG + Intergenic
1176171089 20:63696661-63696683 CGGCCCCTCCGCAGGCGGACCGG + Exonic
1176267987 20:64220713-64220735 AAGCCCCTCAGGAGGTGGAAGGG + Intronic
1176368131 21:6045847-6045869 CAGCTCCAGCGCAGGCAGAATGG + Intergenic
1176414518 21:6467203-6467225 CAGCCCCCGCGCCGGCGGAGTGG - Intergenic
1178617019 21:34143505-34143527 CACCCCCTGGGAAGGGGGAAGGG - Intergenic
1178699316 21:34819887-34819909 CAGCCCCCAAGCAGGCTTAAAGG + Intronic
1178703902 21:34857234-34857256 CACCCTCTGAGCAGACAGAAGGG - Intronic
1179215015 21:39360086-39360108 CAGCTCCTCAGGAGGCTGAAAGG - Intergenic
1179690016 21:43075525-43075547 CAGCCCCCGCGCCGGCGGAGTGG - Intronic
1179755388 21:43492695-43492717 CAGCTCCAGCGCAGGCAGAATGG - Intergenic
1179997457 21:44980574-44980596 CTGCCCCGGAGCAGTGGGAACGG - Intergenic
1181013713 22:20056583-20056605 CAGCACCCGAGGAGGGGGAAAGG - Intronic
1181997412 22:26893669-26893691 CAGGCCCTGGGGAGGCAGAAAGG + Intergenic
1183408180 22:37640431-37640453 CAGCCTCTGAGCCGGTGGCACGG + Intronic
1183576699 22:38695289-38695311 TAGTCCTTGAGCAGGTGGAAGGG - Intronic
1184280782 22:43436325-43436347 ACGCCCCTGGGGAGGCGGAAGGG - Intronic
1184571472 22:45327685-45327707 CAACCCCAGAGCAGGGGGACAGG - Intronic
1184596535 22:45517415-45517437 CAGCCCCTCAGCTCACGGAAGGG - Intronic
1185058872 22:48595198-48595220 CATCCCCTGAGTAGGTGGGAAGG - Intronic
1185089075 22:48755850-48755872 CAGCCTCTGACCAGGCAGCACGG + Intronic
949564131 3:5229411-5229433 CATGACCTGAGCAGGAGGAAGGG - Intergenic
952652610 3:35744469-35744491 CAGCCACTGTGCAGTGGGAAGGG + Intronic
954883940 3:53855687-53855709 TAGCATCTGAGCAGGTGGAAGGG - Intronic
954904939 3:54053322-54053344 CAGCTCCAGAGCACGCGGTAAGG + Intergenic
958535654 3:95399487-95399509 CAGCACCTGAGCAGGGGTAGAGG - Intergenic
959651873 3:108758081-108758103 CAGACCCTGAGCAGGAAGGAAGG + Intergenic
961302491 3:125931074-125931096 CAGCTCCTGAGCAGGGGCCAAGG + Intronic
962263592 3:133929903-133929925 CAGGCCCTGAGCAGGCAGAGGGG + Intergenic
962708649 3:138067906-138067928 CAGCCCCTCTGGAGGGGGAACGG + Intronic
966916173 3:184585159-184585181 CAGCCCCTGAGCACAGGGAGAGG + Intronic
974617379 4:64307088-64307110 CAACCCCTGGGCAGGAAGAAGGG + Intronic
985154670 4:186973547-186973569 CAGCGCCTGAGCAGAAGAAATGG + Intergenic
985171415 4:187154039-187154061 AAGCCCCTCAGGAGGCAGAAGGG + Intergenic
990253726 5:53943366-53943388 CATCCACTGAGAAGGTGGAAGGG + Intronic
992813115 5:80408505-80408527 CAGCCCCTCCCCAGGCGGGACGG - Intronic
992878912 5:81085845-81085867 CACCCCATGAGCATGTGGAAAGG + Exonic
993448709 5:88046909-88046931 CTGACTCTGAGCAGGGGGAAAGG + Intergenic
997714082 5:136029195-136029217 CAGCCCCTGGCCAGGCGGCTCGG - Intronic
998416416 5:141949511-141949533 CAGACCCAGAACAGGAGGAAGGG - Exonic
1001009518 5:168085427-168085449 CAGCCCCTGAGCTTCCGGACAGG - Intronic
1001076056 5:168628907-168628929 CTTCCCCTGAGAAGGCAGAAGGG + Intergenic
1001370594 5:171196620-171196642 CAGACACTGAGCAGGGGGATGGG + Intronic
1002302205 5:178263423-178263445 CAGCCCTTGGGCAGGCTCAAAGG + Intronic
1002389232 5:178896250-178896272 CAGCCCCGGAGCAGCGGGGATGG + Intronic
1002762246 6:210977-210999 CAGCCCTGGAGCTGGCAGAATGG - Intergenic
1004217640 6:13717102-13717124 CAGCCCTTGAGCAGTCGGGACGG - Intergenic
1004425098 6:15501751-15501773 GAGGCCCTAGGCAGGCGGAATGG - Intronic
1005426344 6:25706673-25706695 AAGTCCCTGAGCAGGGAGAAAGG + Intergenic
1006394867 6:33780710-33780732 CGGCCCCTGGGCAGTCTGAATGG + Intronic
1006457975 6:34142900-34142922 CAGGTCCTGAGCAGGCGGAGGGG - Intronic
1006645754 6:35512943-35512965 CACTCCTTGAGCAGGGGGAAGGG - Intergenic
1006936957 6:37725334-37725356 GGGCCCCTGAGCAGCCGTAATGG - Intergenic
1008368775 6:50711145-50711167 CAACCCCAGAGCAGATGGAAGGG + Intergenic
1010897051 6:81377685-81377707 CAGCCCCAGAGCAGGTGCACAGG - Intergenic
1011142184 6:84170925-84170947 CAGCCCCTGACCCGGCATAAAGG + Intronic
1011516934 6:88165845-88165867 CAGCCCCTGAGCTGGGCGAGAGG - Exonic
1014137715 6:117907843-117907865 CAGCCCGGGAGGAGGCGGACAGG - Exonic
1017023292 6:150159128-150159150 CAGCCCCTGAGCAGGTGGAAAGG - Intronic
1018093359 6:160363773-160363795 CAGCCCCTGTGCTGGGGGCAGGG - Intronic
1018247562 6:161837255-161837277 CAGGCCATTAGCAGGAGGAAGGG - Intronic
1018563746 6:165129613-165129635 CAGGCCCTGTGCAGGCGCAGAGG + Intergenic
1019225834 6:170507164-170507186 AAGCCCCTGAGCTGACTGAATGG - Intergenic
1019407519 7:891493-891515 CAGCGCCCGAGCTGGCGGAAGGG - Intronic
1019433945 7:1012258-1012280 CAGGCCCTGAGCAGGTGGGCAGG + Intronic
1019793641 7:3033781-3033803 GAGGCCCTAGGCAGGCGGAAGGG + Intronic
1023015627 7:35967425-35967447 CGGGCCCGGAGCAGGGGGAAGGG + Intergenic
1024644648 7:51360975-51360997 GAGCCCCTGAGCAGGCTCACAGG - Intergenic
1026046624 7:66910031-66910053 CAGCTACTCAGGAGGCGGAAGGG - Intergenic
1029403138 7:100357604-100357626 CAGCCCCTCAGCAGGAAGATGGG + Intronic
1029405766 7:100373365-100373387 CAGCCCCTCGGCAGGAGGACGGG + Intronic
1029551856 7:101240788-101240810 CAGCCCCAGAGGAGGGTGAAGGG + Intronic
1029561012 7:101303006-101303028 CAGCCCCTGCGCGCGGGGAAAGG + Intergenic
1029629678 7:101742621-101742643 CTGCCCCTGAGAAGGGGGACAGG + Intergenic
1034498625 7:151436225-151436247 CAGCCCCTGCTCTGGAGGAAGGG + Exonic
1034784211 7:153910430-153910452 CAGCCCCTGAGATGGAGGGAAGG - Intronic
1035131403 7:156657584-156657606 CAGCACCTGGGCAGGCGTGAGGG - Intronic
1035345732 7:158196485-158196507 CAGCCCCTGAGGAGGGGTGAGGG + Intronic
1035438356 7:158876183-158876205 CAGGGCCAGAGCAGGAGGAAGGG + Intronic
1037663191 8:20944345-20944367 AGGCCCCTGAGCAGGCTGAGGGG - Intergenic
1038781095 8:30569003-30569025 CAGCCCCTGAGCAGGCGGAATGG - Intronic
1042871003 8:73399431-73399453 CAGCGCTTGAGGAGGCTGAAGGG - Intergenic
1047991749 8:130293607-130293629 CAGCCCCAGAGCTGGCTGGAGGG + Intronic
1048535389 8:135289674-135289696 CAGCCAGTGAGAAGGAGGAAAGG - Intergenic
1048859237 8:138711664-138711686 CAGCCCCAGAGAAGGAGGATGGG + Intronic
1048972511 8:139653111-139653133 AAGCCCCTGAGCAGCTGGACTGG - Intronic
1049012984 8:139899981-139900003 CAGGCCAGGAGCAGGTGGAAAGG + Intronic
1049274771 8:141714693-141714715 CAGCCCCTGGGCAGGAGGCATGG - Intergenic
1049330705 8:142048969-142048991 CAGCCCCCGAGGAAGTGGAAGGG - Intergenic
1049543784 8:143220256-143220278 CAGTCCCTAAGGAGGAGGAAAGG - Intergenic
1049574748 8:143384900-143384922 CAGCCCCTGGGCTGCGGGAAGGG + Intergenic
1052846836 9:33344295-33344317 CAGCCCCTGAGCCGGGAGCAAGG - Intronic
1056848117 9:90057948-90057970 CAGGCCCTGGGCAGCAGGAATGG + Intergenic
1061187936 9:129065888-129065910 CAGCTCATGAGCAGGAGGCAGGG - Intronic
1061628330 9:131855697-131855719 CAGCAGGTGAGCAGGTGGAATGG + Intergenic
1061893108 9:133633202-133633224 CAGGCGCTGAGCAGCAGGAATGG + Intergenic
1061937164 9:133864213-133864235 CAGCCGCGGGGCAGGAGGAAAGG + Intronic
1061939292 9:133875419-133875441 CAGGCCCTGAGCAGGCAGAGGGG + Intronic
1062346822 9:136118812-136118834 CGGGCCCGGAGCAGGGGGAAGGG - Exonic
1185644649 X:1608436-1608458 CAGCTCCTGGGCAGGTGGACGGG - Intergenic
1186194927 X:7100295-7100317 CAGCCCCTGATCATGCTGCAGGG - Intronic
1189300128 X:39946518-39946540 CAGGCCATGAGAAGGAGGAAAGG - Intergenic
1190716100 X:53104996-53105018 CAGCCACTCAGGAGGCTGAAGGG - Intergenic
1190931216 X:54950914-54950936 CAGCCCCAGGGCAGGCGGCCAGG - Intronic
1193033414 X:76923953-76923975 CTGCCCCTGAGCAGGAGGTTTGG - Intergenic
1199671791 X:150153916-150153938 CAGTCCCTGAGCAGGCAGGCTGG - Intergenic