ID: 1038781099

View in Genome Browser
Species Human (GRCh38)
Location 8:30569008-30569030
Sequence TGCCCCAGCCCCTGAGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1512
Summary {0: 1, 1: 0, 2: 11, 3: 155, 4: 1345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781099_1038781103 -7 Left 1038781099 8:30569008-30569030 CCGCCTGCTCAGGGGCTGGGGCA 0: 1
1: 0
2: 11
3: 155
4: 1345
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781099_1038781105 14 Left 1038781099 8:30569008-30569030 CCGCCTGCTCAGGGGCTGGGGCA 0: 1
1: 0
2: 11
3: 155
4: 1345
Right 1038781105 8:30569045-30569067 GGTTCATTACCCAGGAAAGCTGG No data
1038781099_1038781104 6 Left 1038781099 8:30569008-30569030 CCGCCTGCTCAGGGGCTGGGGCA 0: 1
1: 0
2: 11
3: 155
4: 1345
Right 1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781099 Original CRISPR TGCCCCAGCCCCTGAGCAGG CGG (reversed) Intronic
900090054 1:916305-916327 TTGCCCAGACCCTGACCAGGGGG - Intergenic
900141937 1:1142334-1142356 TGCCTCAGCCCCTGAGTAGTTGG + Intergenic
900296550 1:1954667-1954689 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
900400655 1:2471649-2471671 TCCACCGGCCCCAGAGCAGGGGG - Intronic
900458283 1:2787754-2787776 TGCCCAATCACCTGGGCAGGTGG - Intronic
900538837 1:3192691-3192713 AGCCCCAGCTCCTGCCCAGGAGG + Intronic
900656760 1:3762479-3762501 TCCCCCAGCCCCTTGGCAGGAGG + Intronic
900959491 1:5909990-5910012 AGCCCCTGCACCTCAGCAGGAGG + Intronic
901052250 1:6431066-6431088 TGCCCCAGGGCCTGAGCAGCTGG + Intronic
901273177 1:7969692-7969714 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
901277724 1:8005750-8005772 TGCCTCAGCCTCCGAGTAGGTGG + Intronic
901342404 1:8507156-8507178 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
901477769 1:9502760-9502782 TGCCTCAGCCCCGAAGTAGGTGG - Intergenic
901573978 1:10185126-10185148 TGCCAAAGCCCCTGAGTAGCTGG - Intergenic
901858383 1:12058721-12058743 TGCCCCTTCCCATGGGCAGGAGG - Intergenic
901881930 1:12199172-12199194 TGCCCCACCCCCTCTGCTGGTGG - Intronic
902027758 1:13396455-13396477 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
902218888 1:14952089-14952111 TGCTGCCACCCCTGAGCAGGTGG - Intronic
902410342 1:16208289-16208311 TGCCCCTGGCCCTGAGCACCTGG + Intronic
902481980 1:16716945-16716967 TGTCCCAGGGCCTGAGCAGCTGG - Intergenic
902602620 1:17550526-17550548 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
902769774 1:18638932-18638954 TGCCCCATGGCCAGAGCAGGGGG + Intronic
902906089 1:19558468-19558490 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
902932785 1:19743171-19743193 TGCCCCTGCCCCTGACTAGCTGG + Intronic
903065779 1:20698447-20698469 GCCCCCAGACCCTGTGCAGGTGG - Exonic
903225783 1:21893561-21893583 TGACCCAGGCCCTGGCCAGGTGG - Intronic
903269883 1:22181212-22181234 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
903776879 1:25799447-25799469 GGCTCCAGCCCCTCAGCAGCTGG - Intergenic
903818496 1:26082829-26082851 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
903851493 1:26309352-26309374 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
904622418 1:31783278-31783300 TTCCCCAGTCCCTGGTCAGGAGG + Intergenic
904731085 1:32591955-32591977 TGCCTCAGCTCCCGAGCAGCTGG + Intronic
904742426 1:32688695-32688717 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
905038438 1:34931726-34931748 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
905091842 1:35436314-35436336 TGCCCAAGCCCCAGAGCATGTGG - Intronic
905264467 1:36741706-36741728 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
905467422 1:38165945-38165967 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
905796710 1:40819994-40820016 TCCCCCACCAACTGAGCAGGAGG - Intronic
906199050 1:43947534-43947556 TGCCCCAGCCCCTTGGCTGCTGG - Exonic
906323813 1:44832122-44832144 TGGCTGAGCCCCTGAGCAGCTGG - Intronic
906454932 1:45986601-45986623 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
906533574 1:46538719-46538741 AACCCCAGTGCCTGAGCAGGAGG + Intergenic
906534707 1:46545002-46545024 TGCCCCAGCCCCTGGGAACCAGG + Intergenic
906887977 1:49672805-49672827 TGCCCCAGCCCCCTAGTAGCTGG - Intronic
906970508 1:50508813-50508835 TGCCTCAGCTCCTGAGTAGCAGG + Intronic
907035667 1:51213795-51213817 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
907204633 1:52758083-52758105 TGCCTCACCCTCTGAGCAGCTGG - Intronic
907209820 1:52810918-52810940 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
907513039 1:54976678-54976700 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
907551888 1:55311801-55311823 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
908191182 1:61705298-61705320 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
908230624 1:62101375-62101397 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
908261053 1:62339480-62339502 TGCCCCAGCCCCAGGGCTGCTGG + Intergenic
908449512 1:64238288-64238310 TGCCTCAGCCAGTGAGCAGCTGG - Intronic
908750908 1:67422394-67422416 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
908763182 1:67531108-67531130 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
908840872 1:68278851-68278873 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
908850703 1:68373248-68373270 AGCCCAAGGCCCTGAGCAGAGGG + Intergenic
908947905 1:69522550-69522572 TGCCTCAGCCTCCGAGCAGCTGG + Intergenic
909501337 1:76338487-76338509 TGCTACAGCCCCAGTGCAGGGGG - Intronic
909614618 1:77592414-77592436 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
909619521 1:77651900-77651922 TGCCTCAGCCCCAGAGTAGCTGG - Intronic
909647222 1:77931297-77931319 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
909728250 1:78862249-78862271 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
910029655 1:82703237-82703259 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
910325104 1:85997666-85997688 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
910896481 1:92075335-92075357 TCCTCCAGTCCCAGAGCAGGAGG + Exonic
911215673 1:95190441-95190463 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
911414101 1:97548620-97548642 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
911593305 1:99772213-99772235 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
911617031 1:100024730-100024752 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
911669896 1:100595836-100595858 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
911787496 1:101969261-101969283 TGCCTTAGCCCCTGAGTAGCTGG + Intronic
912125358 1:106530827-106530849 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
912339674 1:108900351-108900373 TGCCTCAGCTTCTGAGCAGCTGG + Intronic
912386166 1:109272287-109272309 TGCCCCAGCCCCTACGCAGATGG + Exonic
912515534 1:110214396-110214418 TGCCTGGGCTCCTGAGCAGGAGG - Intronic
912555775 1:110514899-110514921 TGTCCCAGCCCATGAGCCTGAGG - Intergenic
912621592 1:111165161-111165183 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
912854603 1:113156056-113156078 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
912890099 1:113521198-113521220 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
912930124 1:113950615-113950637 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
914195686 1:145446885-145446907 AGCCCCAGCCCCAGAACACGGGG + Intergenic
914743257 1:150482605-150482627 TGCCTCAGCTCCCGAGTAGGTGG + Intergenic
914761303 1:150600781-150600803 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
914762458 1:150610203-150610225 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
915079197 1:153340002-153340024 AGCCCCAGCCTCTGAGTAGGAGG + Intronic
915187847 1:154122539-154122561 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
915194908 1:154182443-154182465 TGCCTCATTTCCTGAGCAGGAGG + Intronic
915268829 1:154737806-154737828 TGCCTCAGCCTCCGAGCAGCTGG - Intronic
915878764 1:159643261-159643283 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
915896818 1:159818176-159818198 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
916380531 1:164205753-164205775 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
916707114 1:167362624-167362646 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
916737527 1:167621381-167621403 TGCCCCAGCCTCCGAGTAGCTGG - Intergenic
916768585 1:167885727-167885749 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
917801137 1:178571684-178571706 TGCCTCAGCTTCTGAGCAGATGG - Intergenic
917857682 1:179114292-179114314 TGCCTCAGCCCCTCAGTAGCTGG - Intronic
918248037 1:182677603-182677625 ACCCCCAGCCACTGAGCAGCTGG - Intronic
919081005 1:192865947-192865969 TGCCTCGGCCCCTGAGTAGCTGG + Intergenic
919632806 1:199975394-199975416 TGCCTCAGCCCCCAAGCAGCTGG - Intergenic
919755577 1:201064163-201064185 TGCACCAGGCCCTGGGCAGGGGG + Intronic
919881758 1:201905665-201905687 TGACCCATCACCTGAGGAGGAGG + Intronic
919890369 1:201968504-201968526 TGCCTCAGCTCCTGAGTAGTTGG + Intronic
919915776 1:202138213-202138235 TTTCCCAGCTCCTCAGCAGGGGG + Intronic
919981618 1:202645455-202645477 TGCCCCAGACCCTTAGCATCAGG - Intronic
920041346 1:203099744-203099766 TTCCAGAGGCCCTGAGCAGGTGG - Intronic
920137887 1:203784907-203784929 TGCCTCAGCTCCTGAGTAGTTGG - Intergenic
920211053 1:204328499-204328521 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
920966244 1:210703861-210703883 TGGCCCAGCCCCAGAGCAGGAGG + Intronic
921091162 1:211844744-211844766 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
921384304 1:214553034-214553056 TGCCTCAGCCCCAGAGTAGCTGG - Intergenic
921540168 1:216404733-216404755 TTCCTCAGCTCCTGAGCAGTTGG + Intronic
921651684 1:217686831-217686853 TGCCACAGCCTCTGAGTAGCTGG + Intronic
921875340 1:220189329-220189351 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
921878174 1:220223159-220223181 CACCTCAGCCCCTGAGTAGGTGG + Intronic
921971449 1:221153598-221153620 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
922052619 1:222008615-222008637 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
922237053 1:223729886-223729908 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
922474060 1:225894491-225894513 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
922691342 1:227694189-227694211 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
923637968 1:235720059-235720081 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
923716975 1:236433423-236433445 CGCCTCAGCCCCAGAGCAGCTGG + Intronic
923991810 1:239446049-239446071 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
924174637 1:241378178-241378200 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
924223799 1:241904274-241904296 TGCCTCAGCCTCTGAGTAGATGG - Intergenic
924697391 1:246414829-246414851 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
924808321 1:247379291-247379313 CGCCTCAGCCCCTGAGTAGCTGG + Intergenic
924940830 1:248811700-248811722 TCCCCCTTCCCCTCAGCAGGCGG - Exonic
1062888056 10:1034359-1034381 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1062999106 10:1897696-1897718 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1063148465 10:3317581-3317603 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1063223027 10:3988892-3988914 TGCCTCAGCCCCCGAGTGGGTGG + Intergenic
1063356182 10:5400515-5400537 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1063392237 10:5658042-5658064 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1063828950 10:9930714-9930736 TGACTCAGCCCCTGAGTAGCTGG - Intergenic
1064126220 10:12663073-12663095 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1064283281 10:13970294-13970316 TTCACCTGCCCCTGGGCAGGCGG - Intronic
1064376837 10:14804304-14804326 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1064435852 10:15310745-15310767 TGCCTCAACCCCTGAGTAGCTGG - Intronic
1064456249 10:15490258-15490280 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1064528407 10:16282474-16282496 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1064609664 10:17085212-17085234 AGCCCCAGCCCCTGTGCAGCTGG + Intronic
1064617813 10:17180424-17180446 TGCCTCAGGCCCTGAGTAGCTGG - Intronic
1064934697 10:20666538-20666560 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1065048449 10:21765728-21765750 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1065352206 10:24805755-24805777 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1065451492 10:25863257-25863279 TGCCTCAGCCTTTGAGTAGGTGG - Intergenic
1065603948 10:27396399-27396421 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1066179584 10:32946956-32946978 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1066180707 10:32958271-32958293 TCCTCCCGCCCCTGAGGAGGAGG - Intronic
1066194206 10:33083125-33083147 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1066391551 10:34980978-34981000 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1066410249 10:35161547-35161569 TGCCCCAGCCTCTGAGTAACTGG - Intronic
1066553747 10:36587902-36587924 TGCCTCAGCGCCTGAGTAGCTGG - Intergenic
1067175921 10:43945440-43945462 TGACCCAGCACCTCAGCAAGGGG - Intergenic
1067684674 10:48459201-48459223 GGCCCCGGCCCCAGAGCAGATGG + Intronic
1068014573 10:51499843-51499865 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1068087716 10:52395521-52395543 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1068412976 10:56681787-56681809 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1068443003 10:57083945-57083967 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1068673862 10:59750184-59750206 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1068907413 10:62342827-62342849 TGCCACAGCCTCTGAGTAGCTGG + Intergenic
1069377920 10:67812737-67812759 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1069538782 10:69277451-69277473 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1069636110 10:69925922-69925944 TGCACCATGCCCTGATCAGGGGG + Intronic
1069808021 10:71138057-71138079 AGTCCCAGGCACTGAGCAGGGGG + Intergenic
1069837156 10:71316744-71316766 TGCCCTGGCCCCTGACCAGCAGG - Intergenic
1070005791 10:72422822-72422844 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1070177456 10:73984292-73984314 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1070191710 10:74117538-74117560 TGCCTCAGCCTTTGAGCAGCTGG - Intronic
1070195823 10:74155641-74155663 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1070196632 10:74163079-74163101 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1070895676 10:79981768-79981790 AGCCACAGCCCCAGAGGAGGCGG + Intronic
1071552610 10:86578735-86578757 TGCCTCAGCCTCTGAGTAGCAGG + Intergenic
1072154917 10:92715441-92715463 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1072232753 10:93426772-93426794 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1072289098 10:93946232-93946254 TGTGCCAGGCTCTGAGCAGGTGG + Intronic
1072418152 10:95266081-95266103 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1072578503 10:96720671-96720693 TCTCGCTGCCCCTGAGCAGGGGG - Intergenic
1072696551 10:97608195-97608217 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1072820342 10:98550580-98550602 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
1073224631 10:101907494-101907516 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1073453166 10:103621474-103621496 TGCCCCAGGCCCAAAGCAGCAGG - Intronic
1074217750 10:111404019-111404041 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1074445863 10:113520470-113520492 AGCCACAGTCCCCGAGCAGGTGG - Intergenic
1074585386 10:114763499-114763521 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1074650681 10:115521265-115521287 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1074781600 10:116806320-116806342 AGTCCCAGCCACTGAGGAGGAGG - Intergenic
1074787920 10:116857750-116857772 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1075348297 10:121700981-121701003 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1075446043 10:122513840-122513862 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1075742182 10:124702670-124702692 CACCCCTGCCCCTCAGCAGGTGG + Intronic
1076054903 10:127364478-127364500 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1076142972 10:128094201-128094223 TGCCTCAGCCTCTGAGGAGCTGG - Intergenic
1076708937 10:132320524-132320546 TGCCCCAGCCTCTGCGGGGGTGG - Intronic
1076764839 10:132627388-132627410 TGTCCTGGCCGCTGAGCAGGTGG + Intronic
1076846494 10:133071870-133071892 GGCCCCAGCCCTGGAGAAGGAGG + Intronic
1077117139 11:890265-890287 TGCCCCATCCCCTGAGGCTGCGG + Intronic
1077140926 11:1024538-1024560 ACCACCAGCTCCTGAGCAGGGGG + Intronic
1077159177 11:1104925-1104947 TGCCCCTGCCCTGGAGCTGGGGG + Intergenic
1077183158 11:1225327-1225349 TCCCCCATCCCTTGAGAAGGAGG + Intronic
1077315621 11:1918217-1918239 AGCCACAGACCCAGAGCAGGAGG + Intergenic
1077329675 11:1978634-1978656 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1077393629 11:2310859-2310881 GGGCCCGGGCCCTGAGCAGGAGG + Intronic
1077444089 11:2582288-2582310 TCCACCAGCCACTGAGGAGGAGG - Intronic
1077487774 11:2846935-2846957 AGAACCAGCCCCTGAGAAGGTGG + Intronic
1078592712 11:12658969-12658991 TGCCTCAGCCTCTGAGTAGTTGG + Intergenic
1078845733 11:15117054-15117076 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
1079121544 11:17688585-17688607 TGCCCCAGCCCCTCAACACAGGG - Intergenic
1079795660 11:24799479-24799501 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1080349132 11:31361593-31361615 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1081403258 11:42666878-42666900 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1081700922 11:45152179-45152201 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1081749661 11:45500874-45500896 TACCCCAGTCTCTGTGCAGGTGG + Intergenic
1081980499 11:47263376-47263398 TGCCTCAGCCCCCAAGTAGGTGG + Intronic
1082284774 11:50306766-50306788 TGCCTCAGCCCCCAAGTAGGTGG + Intergenic
1083307601 11:61769342-61769364 TGCCCAAACCCTGGAGCAGGAGG - Intronic
1083386917 11:62317870-62317892 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1083718139 11:64590924-64590946 TGCCCCAGCCCCAAATTAGGGGG + Exonic
1083949774 11:65947526-65947548 TGCCCCAGCGCCCCAGGAGGGGG + Exonic
1084082970 11:66841230-66841252 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
1084156106 11:67313469-67313491 TGCCTCAGCCCCTGAGTAGTTGG + Intergenic
1084163925 11:67366393-67366415 CTCCCCAGCCCCTCAGCTGGTGG - Intronic
1084540679 11:69784601-69784623 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1084621502 11:70273161-70273183 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1084694822 11:70746879-70746901 TGCCACAGCCCCTGGGGATGAGG + Intronic
1084945731 11:72637321-72637343 TGCATCAGCCCCTTGGCAGGTGG - Intronic
1085350529 11:75795499-75795521 AGCACCAGCCCCAGGGCAGGAGG + Intronic
1085632115 11:78127091-78127113 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1085902695 11:80721001-80721023 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1086290903 11:85308038-85308060 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1086452192 11:86927836-86927858 AGCCTCAGCCCCTGAGTAGCTGG - Intronic
1086679821 11:89656975-89656997 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1086942885 11:92816488-92816510 TGTCCCTGCTCCTGTGCAGGTGG - Intronic
1087669877 11:101093572-101093594 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1087840794 11:102919014-102919036 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1088138982 11:106592730-106592752 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1088189990 11:107217667-107217689 TGCCGCAGCTCCCGAGCAGCTGG - Intergenic
1088603187 11:111502037-111502059 TACCCCAGCCACTGAGGAAGAGG - Intronic
1088655950 11:112000019-112000041 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1088674371 11:112178021-112178043 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1088678268 11:112217474-112217496 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1088741176 11:112768528-112768550 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1088931753 11:114358427-114358449 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1089250895 11:117160569-117160591 TACCTCAGCCCCTGAGTAGTTGG + Intronic
1089273541 11:117317265-117317287 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1089304784 11:117519704-117519726 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1089660703 11:119983315-119983337 TGCCCCTGCACATAAGCAGGAGG - Intergenic
1089963546 11:122636722-122636744 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1090073646 11:123565145-123565167 TGCCCCAACCCCTGAACAGCTGG + Intronic
1090178902 11:124676193-124676215 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1090244180 11:125203976-125203998 TGCCCCACCCTCTGAGCAGAGGG - Intronic
1090675119 11:128985131-128985153 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1090746414 11:129709267-129709289 TGCCTTAGCCCCTGAGTAGCTGG + Intergenic
1090760832 11:129835695-129835717 TGCCCCAGCCCAGGACCAAGGGG + Intronic
1090930804 11:131296424-131296446 TGTCCCAGCACCTGTGCATGTGG - Intergenic
1202812653 11_KI270721v1_random:33813-33835 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1091403762 12:196486-196508 AGCCCCAGCCCCTGAGCCTCGGG - Intronic
1091609277 12:1989597-1989619 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1091967658 12:4758888-4758910 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1092018655 12:5181632-5181654 TGCACCAGCCCCTCAGGAGATGG + Intergenic
1092200615 12:6580111-6580133 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1092255840 12:6926585-6926607 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1092324397 12:7514350-7514372 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1093046747 12:14455062-14455084 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1093165216 12:15797255-15797277 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1093392168 12:18636344-18636366 TGCCTCAGCCCCCAAGCAGCTGG + Intronic
1094020796 12:25912058-25912080 TGCCTCAGCTTCTGAGCAGCTGG + Intergenic
1094188544 12:27671955-27671977 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1094544374 12:31390900-31390922 TGCCCCAGCCACTGATTAGCTGG - Intronic
1094604070 12:31935653-31935675 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1095172980 12:39056913-39056935 TGCCTCAGCCTCTGAGTAGATGG + Intergenic
1095277056 12:40298656-40298678 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1095502513 12:42856029-42856051 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1095521036 12:43066492-43066514 TGCCTCAGACACTGAGCAGAGGG + Intergenic
1095836468 12:46644758-46644780 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1096005979 12:48172214-48172236 TGCCTCAGCCTCTGAGTAGGTGG - Intronic
1096072672 12:48783966-48783988 TGCCTCAGCTCCTGAGTAGCTGG - Exonic
1096077661 12:48815210-48815232 TGCCCCAGCTCCTGAGCTCTTGG - Intronic
1096089106 12:48886739-48886761 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1096166612 12:49430812-49430834 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1096375121 12:51102609-51102631 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1096408924 12:51363373-51363395 TGTGCCAGCCCCTGAGCTGCAGG - Intronic
1096582515 12:52596663-52596685 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1096626158 12:52897366-52897388 TGCCCCAGAGCCTGGGAAGGAGG - Exonic
1096690455 12:53317626-53317648 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1097011358 12:55955601-55955623 TGGCACAGCCGCTGGGCAGGGGG + Exonic
1097108765 12:56642108-56642130 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
1097166748 12:57090049-57090071 TGCCACGGCCCCTGAGCTGAAGG + Intronic
1097789605 12:63800805-63800827 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1098286940 12:68916772-68916794 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1098394306 12:70002439-70002461 TCCCTCAGCCACTGAGCATGGGG + Intergenic
1098548708 12:71739535-71739557 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1098552988 12:71784976-71784998 TGCCTCAGTCCCTGAGTAGCTGG - Intronic
1098855936 12:75653284-75653306 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1099851405 12:88101537-88101559 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1100300994 12:93307704-93307726 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1100334225 12:93614727-93614749 TGCCTCAGACCCCGAGCAGCTGG + Intergenic
1100578353 12:95914208-95914230 TGCCCCAGCCTCCGAGTAGCTGG - Intronic
1100617696 12:96243727-96243749 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1100748939 12:97675617-97675639 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1100809537 12:98324922-98324944 TTCCCAAGCCCCTGTGCAGTGGG + Intergenic
1100812607 12:98354189-98354211 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1100916404 12:99428314-99428336 TGTGCCATGCCCTGAGCAGGAGG + Intronic
1101007900 12:100419417-100419439 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1101071096 12:101076753-101076775 TGGCCCAGCCCCTGAATATGTGG - Intronic
1101414609 12:104498318-104498340 TGCCCCACCCCCAGCCCAGGAGG - Intronic
1101581005 12:106040629-106040651 CGCCCCACCCACTCAGCAGGGGG + Intergenic
1101924912 12:108963599-108963621 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1102148253 12:110670713-110670735 TACTCCACCCTCTGAGCAGGTGG - Intronic
1103357221 12:120330681-120330703 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1103744759 12:123114966-123114988 TGCTACAGCCTCTGAGCAGTGGG + Intronic
1103788316 12:123450290-123450312 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1103876311 12:124130256-124130278 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1104573107 12:129942660-129942682 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1104841738 12:131828963-131828985 TGCAGCAGCCCCGGAGCAGCCGG + Intronic
1104924473 12:132306658-132306680 TGTCCCTGGCTCTGAGCAGGGGG - Intronic
1105028750 12:132868373-132868395 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1105057716 12:133118058-133118080 TGCCTCAGCTCCTGAGTAGCTGG + Exonic
1105213025 13:18268654-18268676 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1105403143 13:20113050-20113072 TGCCCCAACACCTGCGAAGGTGG - Intergenic
1105719461 13:23099809-23099831 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1105956191 13:25285646-25285668 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1106411655 13:29515131-29515153 GGCCCCAGCCCCTGGGCAGGTGG - Intronic
1106934948 13:34707482-34707504 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1107608377 13:42086030-42086052 TGCCTCAGCCCTTGAGTAGATGG + Intronic
1107666655 13:42697620-42697642 TGCCTCAGCCCCTTAGTAGCTGG + Intergenic
1107724359 13:43282967-43282989 TGCCTCAGCTCCCGAGCAGCTGG - Intronic
1107796819 13:44061477-44061499 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1107922611 13:45225502-45225524 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1107926832 13:45271175-45271197 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1108207620 13:48106685-48106707 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1108556475 13:51598243-51598265 TGCCCCAGCCCCCGAGTAGCTGG - Intronic
1109213832 13:59565022-59565044 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1109357418 13:61248204-61248226 TGCCTCAGCCTCCGAGCAGCTGG + Intergenic
1109495381 13:63164136-63164158 TGCCTCAGGCCCTGAGTAGCTGG - Intergenic
1109787298 13:67195257-67195279 TGCCTCAGCCTCCGAGCAGCTGG + Intronic
1109872121 13:68345690-68345712 TGCCTCAGCCCCTGGGGAGCTGG - Intergenic
1110222954 13:73092116-73092138 TGCCTCAGCTCCTGAGAAGCTGG - Intergenic
1110386355 13:74915646-74915668 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1110593112 13:77287297-77287319 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1110727760 13:78845396-78845418 TGCCCCAGCCTCTGAATAGCTGG + Intergenic
1111150939 13:84253056-84253078 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1111637554 13:90926018-90926040 TGCCTCAGCTCCTGAGAAGCTGG + Intergenic
1112324465 13:98434195-98434217 CGCCCCTGCCCCTGAGCACCGGG + Intronic
1112535996 13:100256119-100256141 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1112598435 13:100831343-100831365 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1113053861 13:106245890-106245912 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1113273370 13:108700216-108700238 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1113491295 13:110694139-110694161 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1113519477 13:110929421-110929443 TGCCACAGCCCCTGCTCAGAGGG + Intergenic
1113595820 13:111531010-111531032 TGGCCCAGTCCCTGGGCAGAGGG - Intergenic
1113890238 13:113731709-113731731 TGCCCCAGACCCTGGGCAGTGGG + Intronic
1113893088 13:113746858-113746880 TGCCCCAGGCCCCAAGCTGGTGG - Intergenic
1113910301 13:113838469-113838491 CAGCCCAGCCCCGGAGCAGGAGG + Intronic
1113910334 13:113838550-113838572 CAGCCCAGCCCCGGAGCAGGAGG + Intronic
1114379835 14:22190773-22190795 TCCCTAAGCTCCTGAGCAGGTGG - Intergenic
1114383728 14:22235311-22235333 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1114466907 14:22929471-22929493 TGCCACAGCTCCCGAACAGGAGG + Exonic
1114478903 14:23019022-23019044 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1114530837 14:23394977-23394999 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1114644795 14:24249387-24249409 GGCCCCAGCCCCTGGGGATGGGG - Exonic
1114763269 14:25342168-25342190 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1114993661 14:28318959-28318981 TGCCTCAGCCTCTGAGTAGTTGG - Intergenic
1115504047 14:34077458-34077480 TGCCTCAGCCTCAGAGCAGCTGG + Intronic
1115536606 14:34379196-34379218 TTCCCCAGCCTCTGAGTAGCTGG + Intronic
1116822508 14:49639233-49639255 TGCCCCAGCCTCCAAGCAGCTGG + Intergenic
1118046148 14:61973891-61973913 TGGACCAGACCCTGAGAAGGAGG + Intergenic
1118280422 14:64423506-64423528 TGCCTCAGCCTCTGAGCAGCTGG + Intronic
1118778298 14:68988340-68988362 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1118871208 14:69743963-69743985 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1119171147 14:72537232-72537254 AGCCCCAGGCCCTAAGCACGTGG + Intronic
1119435478 14:74595273-74595295 TGCCCCAGCCCCTGGCCCCGCGG - Intronic
1119530824 14:75359970-75359992 TGCCTCAGCCTCCGAGCAGCTGG + Intergenic
1119596488 14:75939497-75939519 TGCCTCAGCCCCTGAGTGGCTGG + Intronic
1119649685 14:76374923-76374945 TCTCCCAGCCCCTGCCCAGGCGG + Intronic
1119705849 14:76782103-76782125 TGCCCCTGGCACTGAGCATGAGG - Exonic
1119816305 14:77571393-77571415 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1119822308 14:77627960-77627982 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1119939372 14:78624499-78624521 TGGCCCCGCCCCTGTGCAGTGGG - Intronic
1120177114 14:81306341-81306363 TGTCTCAGCCTCTGAGCAGATGG + Intronic
1120722677 14:87905480-87905502 TGCCCCAGCACCACAGCAGTGGG - Intronic
1120867275 14:89306479-89306501 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1120900362 14:89570112-89570134 TGCCCCAGCCTCCGAGTAGCTGG + Intronic
1120943392 14:89970950-89970972 TGCCTCAGCCCCAGAGTAGCTGG + Intronic
1121034930 14:90694150-90694172 TGCCCCAGCCTCCGAGTAGCTGG - Intronic
1121348968 14:93157519-93157541 AGTCCCAGCCCCAGAGCAAGTGG + Intergenic
1121521907 14:94591880-94591902 TGCCCCAGGCACTGTGCTGGGGG - Intronic
1122010226 14:98740454-98740476 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1122103385 14:99431603-99431625 TGCCTCAGCTCCTGAGTAGGTGG + Intronic
1122108313 14:99477637-99477659 TGCCTCAGCCTCTGAGCAGCTGG - Intronic
1122199680 14:100114783-100114805 ACCCCCACCCCCGGAGCAGGTGG - Intronic
1122308835 14:100782058-100782080 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1122518541 14:102326210-102326232 TGTACAAACCCCTGAGCAGGAGG - Exonic
1122555870 14:102579713-102579735 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1122937905 14:104968334-104968356 TGGCGCAGGGCCTGAGCAGGCGG + Intronic
1123028725 14:105440644-105440666 TGGCCCTGGCCCTGAGGAGGAGG - Intronic
1123128673 14:105968388-105968410 TGCCCCACCCCCTAAACAGATGG - Intergenic
1202839993 14_GL000009v2_random:112842-112864 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1202909376 14_GL000194v1_random:103039-103061 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1202883900 14_KI270722v1_random:86237-86259 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1123432533 15:20230893-20230915 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1123476447 15:20594991-20595013 TGCCCCACCAACTGAGCAGGAGG - Intergenic
1123641564 15:22405373-22405395 TGCCCCACCAACTGAGCAGGAGG + Intergenic
1123692336 15:22848709-22848731 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1123862579 15:24484220-24484242 TGCCTCAGCCGCTGAGGAGCTGG + Intergenic
1124021467 15:25928829-25928851 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1124497306 15:30194191-30194213 TGCCCCAGACCCTTAGCATCAGG - Intergenic
1124612093 15:31215828-31215850 CGCCCGAGCCCCAGTGCAGGCGG + Intergenic
1124746268 15:32344456-32344478 TGCCCCAGACCCTTAGCATCAGG + Intergenic
1125016401 15:34940413-34940435 TGCCCCAGCCTCTGAGTAGAGGG - Intronic
1125513194 15:40303659-40303681 GGCCCCAGCCTCTGGGCAGGAGG - Intronic
1125609504 15:40960994-40961016 GGCCCCAGCCGCTGGGCTGGTGG - Intergenic
1125663032 15:41409157-41409179 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1125857152 15:42961535-42961557 TGCCTCAGCTCCCGAGCAGCTGG + Intronic
1125991819 15:44116965-44116987 TGCCCCACCCCCTGAGTAGCTGG - Intronic
1126141400 15:45442416-45442438 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1126165498 15:45651099-45651121 TGCCCCAGCCCCCCAGCGGTGGG - Intronic
1126762638 15:51983363-51983385 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1126835388 15:52658869-52658891 TGCCTCAGTCCCTGAGAAGCTGG - Intronic
1127476254 15:59336254-59336276 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1127706042 15:61548187-61548209 TGCCTCAGCCTCTGAACAGCTGG - Intergenic
1127754805 15:62081686-62081708 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1127754943 15:62083150-62083172 TGCACCAGCTCCTGAACTGGTGG + Intergenic
1127756268 15:62095427-62095449 TGCCTCAGCCCCAGAGTAGCTGG - Intergenic
1127995780 15:64152434-64152456 TGCCTCAGTCCCTGCGCAGCCGG + Intronic
1128229211 15:66023290-66023312 AGCCCCAGGCCCTGAGCTGATGG - Intronic
1128302668 15:66576527-66576549 TCCCCCAGCCACTGGGCAGCAGG - Intergenic
1128334209 15:66775662-66775684 TAGGCCAGGCCCTGAGCAGGGGG + Intronic
1128335502 15:66783278-66783300 TGCATCAGCCCCTGAGTAGCTGG + Intergenic
1128359796 15:66954022-66954044 TGCCCCATCCCCACAGCAGAAGG + Intergenic
1128559572 15:68655782-68655804 TCCCCAAGCCCCTCAACAGGAGG + Intronic
1128832876 15:70785598-70785620 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1129245839 15:74278177-74278199 TGCCCCTGCCCCTGGGGAGATGG - Intronic
1129310528 15:74705205-74705227 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1129343213 15:74899735-74899757 TGCCTCAGCTCCTGAGTAGCTGG + Exonic
1129347140 15:74929648-74929670 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1129381989 15:75173897-75173919 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1129436130 15:75541921-75541943 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1129681776 15:77662272-77662294 TGCCCCAGCTCCTGCCCAAGGGG + Intronic
1129740990 15:77989597-77989619 TGCCGCAGCCCATGGGCAGGAGG - Intronic
1129844729 15:78762955-78762977 TGCCGCAGCCCATGGGCAGGAGG + Intronic
1129905131 15:79181852-79181874 TGCCCCAGCCTCTGAGGAGCTGG - Intergenic
1130100549 15:80890473-80890495 TGCCTCAGACCCTGAGTAGCTGG - Intronic
1130257098 15:82330911-82330933 TGCCGCAGCCCATGGGCAGGAGG - Intergenic
1130366940 15:83249266-83249288 TGCCCCAGCATCTGAGGAGGTGG + Intergenic
1130398761 15:83529699-83529721 CGCCCCACCCACTGAGCAGCAGG - Intronic
1130548609 15:84874642-84874664 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1130558412 15:84939936-84939958 TGCCTCAGCCCCTGTGTAGCTGG + Intronic
1130565412 15:84990100-84990122 TGCCTCAGCTCCTGAGTAGATGG - Intronic
1130597852 15:85259079-85259101 TGCCGCAGCCCATGGGCAGGAGG + Intergenic
1130655548 15:85789829-85789851 TCCACCAGCCCCTTCGCAGGAGG + Intronic
1131159856 15:90098656-90098678 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
1131176172 15:90211135-90211157 GGAGCCAGCCCCTGAGCAGAGGG + Intronic
1131769515 15:95719634-95719656 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1132023556 15:98385260-98385282 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1132234767 15:100210984-100211006 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1132382955 15:101379267-101379289 TGCCCCTGCCCGTGACCAGAGGG + Intronic
1132434144 15:101782906-101782928 TGCCTCAGCTCCTGAACAGCTGG - Intergenic
1132541785 16:513332-513354 TGCCTCAGCCCCTGAGTTGCTGG + Intronic
1132550836 16:553254-553276 TGCTCCTGCCCCTGTACAGGTGG + Intronic
1132590118 16:722918-722940 TGGACCAGCACCTGGGCAGGTGG - Exonic
1132911248 16:2313437-2313459 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1132977973 16:2719968-2719990 CCCTCCTGCCCCTGAGCAGGTGG - Intronic
1133023842 16:2979218-2979240 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1133296650 16:4756628-4756650 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1133605728 16:7385865-7385887 TGCTTCAGCCTCTGAGTAGGTGG + Intronic
1134014503 16:10878974-10878996 TGCCGCGGCCCCAGAGCTGGCGG + Intronic
1134087030 16:11364325-11364347 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1134492988 16:14710143-14710165 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1134498369 16:14749267-14749289 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1134582208 16:15379828-15379850 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1134618833 16:15672316-15672338 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1135045672 16:19153172-19153194 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1135073546 16:19373436-19373458 TGCCTCAGCTCCTGAGAAGCTGG - Intergenic
1135313526 16:21423884-21423906 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1135366450 16:21856162-21856184 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1135445365 16:22515002-22515024 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1135537998 16:23309238-23309260 TGCCCCAGGCCCTCAGGTGGGGG - Intronic
1135696289 16:24589792-24589814 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1135832709 16:25790293-25790315 TGCCTCAGCCTCTGAGTAGATGG - Intronic
1135863412 16:26078253-26078275 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1135989220 16:27207293-27207315 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136002909 16:27309628-27309650 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1136079324 16:27841212-27841234 TGCCCCTGCCCCTCACCAGCCGG - Intronic
1136152672 16:28361605-28361627 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136194079 16:28639568-28639590 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1136210410 16:28753676-28753698 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1136310192 16:29402587-29402609 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136319459 16:29473322-29473344 TGCCTCAGCCTCTGAGCAGCTGG - Intergenic
1136323637 16:29504389-29504411 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136340546 16:29640267-29640289 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1136434030 16:30212666-30212688 TGCCTCAGCCTCTGAGCAGCTGG - Intergenic
1136438322 16:30244358-30244380 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136515885 16:30768174-30768196 TGCCCCAGCCCCAGGGAAAGAGG + Exonic
1136561055 16:31039522-31039544 CACCCCATCCTCTGAGCAGGGGG + Exonic
1136579569 16:31143253-31143275 GGCCCCAGCCCCTCCCCAGGGGG - Intronic
1136852102 16:33620254-33620276 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1136871607 16:33812482-33812504 TGCCCCACCCCCTAAACAGATGG + Intergenic
1137843335 16:51661858-51661880 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1138019369 16:53463680-53463702 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1138035576 16:53602658-53602680 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1138110886 16:54322932-54322954 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1138684985 16:58717261-58717283 TACCTCAGCCCCTGAGTAGCTGG - Intronic
1139354733 16:66360862-66360884 TGCCGCAGCCCCTGGGAGGGAGG - Intergenic
1139408035 16:66735214-66735236 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1139417666 16:66827452-66827474 TGCCTCAGCCTCCGAGTAGGTGG - Intronic
1139448179 16:67011484-67011506 TGCCCAAGGGCCTGAGCTGGTGG + Intergenic
1139499000 16:67345198-67345220 CGCCTCAGCCCCTGAGTAGCTGG - Intronic
1139514606 16:67445770-67445792 TGCCCCAGCCCCTTTGTAGCTGG - Intronic
1139671920 16:68497919-68497941 TGTCCCAGCCCCTGAGGAGCTGG - Intergenic
1139724831 16:68888924-68888946 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1139827806 16:69771359-69771381 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1139837047 16:69847521-69847543 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
1139857875 16:69994989-69995011 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1139962990 16:70728577-70728599 AGCCTCAGGCCCTGAGCGGGTGG + Intronic
1140179749 16:72703093-72703115 TGCCTCAGCCACTGAGTAGCTGG + Intergenic
1140251632 16:73299644-73299666 TGCCCCAGCCCAGGAGGAGCAGG + Intergenic
1140426360 16:74864988-74865010 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1140494113 16:75367988-75368010 TGCCTCAGCCCTTGAGTAGCTGG - Intronic
1140519902 16:75572046-75572068 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1140571617 16:76113121-76113143 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1140974853 16:80049950-80049972 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1141078369 16:81029687-81029709 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1141246910 16:82316552-82316574 TACCTCAGCCCCTGAGTAGCTGG + Intergenic
1141388713 16:83646585-83646607 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1141429110 16:83961787-83961809 TGCCCCAGCCTCTAAGGAGGGGG + Intronic
1141499443 16:84433536-84433558 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1141720406 16:85752338-85752360 TGCCCCAGCTGCTGGGCTGGGGG + Intergenic
1141801973 16:86315880-86315902 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1141859129 16:86704621-86704643 TGCCCCGACCCCTGACCAGCGGG + Intergenic
1141949910 16:87333701-87333723 TTCCCCAGCACCTGAGCAAGCGG - Intronic
1142420883 16:89969112-89969134 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1203100565 16_KI270728v1_random:1303576-1303598 TGCCCCACCCCCTAAACAGATGG - Intergenic
1203113701 16_KI270728v1_random:1468722-1468744 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1142584239 17:960897-960919 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1142724563 17:1803027-1803049 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1142842729 17:2646536-2646558 TGCCTCAGCTCCTGAGTAGTGGG - Intronic
1142904999 17:3035508-3035530 TGTCCCTGCCTCTGAGCTGGTGG + Exonic
1143091402 17:4451025-4451047 CCCGCCAGCCCCTAAGCAGGAGG - Intronic
1143440819 17:6972067-6972089 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1143548550 17:7614679-7614701 TGCCACAGCCAACGAGCAGGGGG + Exonic
1143595541 17:7911633-7911655 GGCCCCAGCGCTTGAGCTGGGGG - Exonic
1143622758 17:8090338-8090360 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1143647711 17:8242141-8242163 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1143741605 17:8958194-8958216 TGCCTCAGCCCCTGAGTACCTGG - Intronic
1143766364 17:9140322-9140344 TGCCACAGCACCAGGGCAGGGGG - Intronic
1144162999 17:12580271-12580293 AGCCCCAACCCCTGGGCAGGTGG + Intergenic
1144358323 17:14467217-14467239 TGCCTCAGCCTCTGAGCACCTGG - Intergenic
1144516928 17:15924986-15925008 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1144565743 17:16357756-16357778 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1144567099 17:16368718-16368740 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1144693354 17:17283722-17283744 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1144831624 17:18134992-18135014 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1144832717 17:18140498-18140520 TGCCCCGACCCCTGCCCAGGTGG + Exonic
1145093049 17:20001635-20001657 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1145182172 17:20762849-20762871 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1145783168 17:27577395-27577417 GGCCCCTGCCACTCAGCAGGAGG + Intronic
1146073595 17:29707037-29707059 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1146275669 17:31514176-31514198 GGCCCAAGCCCCTGACCGGGTGG - Intronic
1146543739 17:33719993-33720015 TGCCTCAGCCCCTGAGTATCGGG + Intronic
1146927984 17:36758091-36758113 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1147028185 17:37607840-37607862 TGCCTCAGCCTCGGAGCAGCTGG - Intronic
1147061907 17:37886739-37886761 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1147280735 17:39358566-39358588 TGCCTTAGCCTCTGAGTAGGTGG - Intronic
1147282084 17:39370374-39370396 TGCCTCAACCCCTGAGTAGCTGG - Intronic
1147408495 17:40231536-40231558 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1147632974 17:41944248-41944270 TGCCTCAGCCACTGAGTAGCAGG - Intronic
1147633031 17:41944674-41944696 TGCCTCAGCCCCTGAGTTGCTGG - Intronic
1147810876 17:43169290-43169312 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1148408979 17:47447916-47447938 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1148455007 17:47806527-47806549 TGCCTCAGCTCCTGAGCAGCTGG - Intergenic
1148490228 17:48018729-48018751 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1148615768 17:48998444-48998466 AGCCCCAGGCCCTGGGCGGGAGG - Intronic
1148723907 17:49775100-49775122 TGCCTCAGCTCCTGAGTAGATGG + Intronic
1148733006 17:49849245-49849267 TGCCTCAGCCCCTGAGTAGTTGG + Intergenic
1148754214 17:49964138-49964160 TGTCCCAGCCCCGGACCCGGTGG - Intergenic
1148996584 17:51715802-51715824 TGCCACAGCCTCTGAGTAGCTGG + Intronic
1149085830 17:52714957-52714979 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1149559957 17:57601489-57601511 TGAAGCAGCCCCTGAGCAGCAGG + Intronic
1149624661 17:58072244-58072266 TGCCTCAGCCTCAGAGTAGGTGG - Intergenic
1149681687 17:58512098-58512120 TACCTCAGCCCCCGAGTAGGTGG + Intronic
1149810545 17:59665724-59665746 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1150030840 17:61733272-61733294 TGCCTCAGCTCCCGAGCAGCTGG - Intronic
1150067418 17:62123275-62123297 TGCCTCAGCTTCTGAGCAGCTGG + Intergenic
1150132763 17:62678280-62678302 AGCCCCATCCCCTGACCAGCAGG - Intronic
1150223883 17:63512285-63512307 TGCCTCAGCACCTGAGTAGCTGG + Intronic
1150316878 17:64176189-64176211 TTCCCCAGCTCCTGAGAAAGAGG - Intronic
1150382796 17:64733897-64733919 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1150434801 17:65145500-65145522 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1150445258 17:65223561-65223583 AGCCCTGGTCCCTGAGCAGGTGG - Intronic
1150615320 17:66766080-66766102 TGGCCCAGTGGCTGAGCAGGCGG + Intronic
1151044701 17:70905569-70905591 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1151115323 17:71729022-71729044 TGCCCCAGGCCCTGGGCAGTAGG + Intergenic
1151195700 17:72429975-72429997 TGCCCCCTCCCCTGGGCAGCTGG + Intergenic
1151237477 17:72731838-72731860 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1151607741 17:75150365-75150387 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
1151710028 17:75798950-75798972 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1151766828 17:76137247-76137269 TGGCCCAGCCCCTGCCTAGGTGG + Exonic
1151883228 17:76907163-76907185 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1151920716 17:77153179-77153201 TGCCTCAGCCTCTGAGTAGCCGG + Intronic
1151986694 17:77548428-77548450 TGCCCCACCCCCTCCCCAGGTGG + Intergenic
1152134828 17:78497659-78497681 TTCCCCAGCCCCAGGGCTGGAGG - Intronic
1152135320 17:78500062-78500084 TGCCCCAGCCCCTGCCCTGGAGG - Intronic
1152285555 17:79410693-79410715 TGCTTAAGCCCCTGAGCTGGAGG + Intronic
1152377178 17:79924876-79924898 TGCCCCTGCCCCTGATAAGAAGG + Intergenic
1152526157 17:80889391-80889413 AGCCCCAGCCAGGGAGCAGGAGG + Intronic
1152609904 17:81310299-81310321 CGCCCCGGCCCCTGCGCAGCTGG - Intergenic
1152743537 17:82029074-82029096 AATCCCTGCCCCTGAGCAGGTGG + Exonic
1152903249 17:82957122-82957144 TCCCTCAGCCCCGGAGCAGGTGG + Intronic
1153492803 18:5667062-5667084 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1153892659 18:9532670-9532692 TGCCTCAGCCGCTGAGTAGCTGG - Intronic
1153894441 18:9545690-9545712 TGCCTCAGCCTCCGAGCAGCTGG + Intergenic
1154119324 18:11638242-11638264 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1154933434 18:21025620-21025642 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1155149357 18:23110796-23110818 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1155640417 18:28007044-28007066 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1156343013 18:36228915-36228937 TGCCCCAGCCCCCTAGTAGCTGG + Intronic
1156453554 18:37280154-37280176 AGCCCCAGCTCCTGCGCAGGTGG - Intronic
1156498743 18:37543502-37543524 AGCCACAGCCCCTGCCCAGGAGG - Intronic
1156634023 18:39006261-39006283 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1156969046 18:43132851-43132873 TGCCTCAGGCCCTGAGTAGCTGG - Intergenic
1157001359 18:43529583-43529605 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1157557015 18:48619542-48619564 GGCCCAGGCCCCTGAGCTGGAGG + Exonic
1157607783 18:48936963-48936985 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
1157845321 18:50998959-50998981 TACCCCAGCCTCTGGGCTGGTGG - Intronic
1158115442 18:53990261-53990283 TGCCTCAGCCCTTGAGTAGCTGG - Intergenic
1158132353 18:54166740-54166762 TGACCCAGGCCCTGTGCAGCAGG - Intronic
1158621489 18:59036341-59036363 TGCACCAGCCCATGAATAGGTGG + Intergenic
1158930402 18:62319583-62319605 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1159160393 18:64637179-64637201 TGCCTCAGCCCCAGAGGAGCTGG + Intergenic
1159264049 18:66056079-66056101 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1159379515 18:67638017-67638039 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1159593513 18:70360573-70360595 TGCCTCAGCCTCTGAGTAGCCGG + Intergenic
1159601509 18:70432508-70432530 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1159775794 18:72601764-72601786 TGCCCCAGCCTATAAGCGGGAGG + Intronic
1160211730 18:76886484-76886506 TGAACCAGCACCTGAGAAGGGGG + Intronic
1160228167 18:77027442-77027464 TGGCCCTGCCCCTGCCCAGGGGG - Intronic
1160539409 18:79612283-79612305 TGCAGCAGCCGCTGTGCAGGAGG + Intergenic
1160697670 19:492415-492437 TGCCCCAGCCCCTCACCAGGCGG + Intronic
1160734550 19:656532-656554 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1160764553 19:801644-801666 TCCCCCAGCCTCTGAGCTGGAGG + Intronic
1160824859 19:1074791-1074813 CGCCCCAGCCCCTGACCCTGCGG + Exonic
1160865297 19:1253461-1253483 TGGCCCATACCCAGAGCAGGGGG + Intronic
1160907438 19:1458090-1458112 TCCTCCAGCCCCCGAACAGGTGG + Intronic
1160922656 19:1528243-1528265 TCACCCAGCCCCTGAGCACCTGG - Intronic
1161048382 19:2149427-2149449 TGCCCCAGCTCCTGAGTAGCTGG - Intronic
1161098668 19:2409251-2409273 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1161105749 19:2443228-2443250 AGCCCCAGGCCCCGGGCAGGCGG + Intronic
1161327786 19:3671736-3671758 GCCCCCACCCCCTGGGCAGGCGG - Intronic
1161378395 19:3951520-3951542 TGCTCCAGGCCCTGACCTGGAGG + Intergenic
1161569194 19:5021030-5021052 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1161706951 19:5826656-5826678 ACTCCCAGCCCCAGAGCAGGTGG - Intronic
1161739762 19:6013631-6013653 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1161812406 19:6478355-6478377 TGCCGCAGCCTCTGAGCAGCTGG + Intronic
1161823986 19:6549973-6549995 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1162086603 19:8253270-8253292 AGCCCCAGCCCCTGCCCATGGGG + Intronic
1162434247 19:10647595-10647617 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1162689172 19:12414466-12414488 TCCCCTAGCCTCAGAGCAGGAGG + Intronic
1162934178 19:13972929-13972951 GGCCCCAGCCCCAGTGCTGGTGG + Exonic
1163032785 19:14555190-14555212 TGTCACAGCCCCTGAGGAGTAGG + Intronic
1163119464 19:15208330-15208352 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1163212427 19:15851106-15851128 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1163342112 19:16715433-16715455 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1163364939 19:16870663-16870685 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1163370009 19:16896618-16896640 TGCCGTGGCCCCTGAGGAGGGGG - Exonic
1163389100 19:17019235-17019257 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1163402827 19:17104513-17104535 TGCCCCTGGCCCTCACCAGGTGG - Intronic
1163436688 19:17300316-17300338 TGCCTCAGCCCTTAAGTAGGTGG + Intronic
1163534142 19:17867331-17867353 CGCCTCAGCACCTGAGGAGGTGG - Intergenic
1163536526 19:17880011-17880033 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1163586027 19:18164010-18164032 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1163594819 19:18214833-18214855 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1163600596 19:18247091-18247113 TGCCCCCGGGCCTGAGCAGTGGG - Intronic
1163645053 19:18484524-18484546 TGCCTCAGCACCTGAGTAGCTGG - Intronic
1163702360 19:18792433-18792455 TGCCCCAACCCCTGTCCAAGGGG + Intergenic
1163803549 19:19382810-19382832 TGACTCAGCCCCTGAGTAGCTGG - Intergenic
1163819314 19:19487168-19487190 TACCACAGCCCCAGAGAAGGGGG - Intronic
1163839323 19:19596273-19596295 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1163839435 19:19597097-19597119 TGCCTCAGCCTCTGAGTAGCCGG - Intronic
1164203917 19:23042029-23042051 TGTCTCAGCCTCTGAGCAGCTGG - Intergenic
1164315544 19:24085044-24085066 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1164609731 19:29623949-29623971 TACCCCAGCTCCTCTGCAGGAGG - Intergenic
1164658580 19:29942489-29942511 TGAACCAGCGCCTGCGCAGGCGG - Exonic
1164672700 19:30081960-30081982 TGCCCCAGCATCTGGGGAGGGGG - Intergenic
1165009508 19:32833681-32833703 TGCCTCAGCTCCTGAGGAGCTGG - Intronic
1165028778 19:32982291-32982313 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1165134091 19:33654835-33654857 TGCCCCAGGCCCTGACCTGTAGG + Intronic
1165315662 19:35053884-35053906 TGCCCCAACCCCAGAGCAGGAGG + Intronic
1165331353 19:35142657-35142679 ATCCCCAGCTCCTGGGCAGGTGG - Intronic
1165554091 19:36614795-36614817 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1165639091 19:37368989-37369011 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1165712282 19:38020566-38020588 TTCCGCAGCCCCTGAGCCTGGGG + Intronic
1165863960 19:38924755-38924777 TGCCTCAGCCCCAGAGTAGCTGG + Intronic
1165902407 19:39174912-39174934 TGACCCAGCCCCTGCACAGGTGG + Exonic
1165996987 19:39850614-39850636 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1166300039 19:41908072-41908094 TTCCCCAGCCCCAGAGTGGGGGG - Intronic
1166310451 19:41959390-41959412 TGGCGCAGCCCCGGAGCAGCTGG + Exonic
1166750311 19:45161377-45161399 TGCGCCAGGCCCTGAGCTGAGGG - Intronic
1166916701 19:46200280-46200302 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1166921981 19:46234793-46234815 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1166974339 19:46595673-46595695 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1167164102 19:47786474-47786496 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1167296760 19:48654962-48654984 CTCCCCAGCCCCTGAGTGGGAGG + Intergenic
1167351958 19:48980997-48981019 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1167400639 19:49266065-49266087 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1167417471 19:49383425-49383447 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1167495103 19:49812992-49813014 CGCCCCCGCCCGTCAGCAGGTGG - Exonic
1167564285 19:50246506-50246528 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1167700805 19:51044235-51044257 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1167806548 19:51790325-51790347 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1168048956 19:53814464-53814486 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1168074707 19:53973710-53973732 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1168283671 19:55320119-55320141 CGCCCCAGTCCCGGAGCTGGTGG + Exonic
1168315750 19:55484130-55484152 CGCCCCAGCCACTGAGCTGCTGG + Exonic
1168541593 19:57216235-57216257 TGCCTCAGCCCCCCAGCAGCTGG - Exonic
1168660337 19:58160670-58160692 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1202652817 1_KI270707v1_random:22331-22353 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1202659326 1_KI270708v1_random:53411-53433 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
925056392 2:860632-860654 TGCTCCTGCCCCAGAGCCGGGGG - Intergenic
925390432 2:3490457-3490479 CGCCCCAGGCACTGTGCAGGAGG + Intergenic
926158128 2:10469363-10469385 TCCCTCAGACCCTGACCAGGTGG - Intergenic
926170636 2:10550639-10550661 GGCCACACCCCCTGGGCAGGCGG + Intergenic
926659715 2:15451163-15451185 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
927394463 2:22633170-22633192 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
927898819 2:26804089-26804111 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
928092872 2:28386763-28386785 TGCTCCAGGCCCAGACCAGGAGG - Intergenic
929106668 2:38371781-38371803 TGCCTCAGCCCCTGAGTATCTGG - Intronic
929157171 2:38798827-38798849 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
929167173 2:38894216-38894238 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
929667246 2:43842516-43842538 TGCCAAAGCCCCCAAGCAGGAGG - Intronic
929934875 2:46286995-46287017 TCCCCTTGCCCCTGAGCAGTTGG - Intergenic
929988093 2:46757750-46757772 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
930553920 2:52870900-52870922 TGCCCCAGCATCTGAGTAGCTGG + Intergenic
930777439 2:55187496-55187518 TGCCCCAACCACTGAGTAGCTGG - Intronic
931253396 2:60551861-60551883 CGCGGCAGCCCCGGAGCAGGCGG - Intronic
931566222 2:63618802-63618824 TGCCTCAGCTCCTGAGCAGCTGG + Intronic
931654841 2:64501702-64501724 TGCCCCAGCTCCTGAATAGCTGG + Intergenic
931704667 2:64937515-64937537 TGCCTCAGCCCATGAGTAGCTGG - Intergenic
931759853 2:65407040-65407062 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
932333475 2:70914913-70914935 TGCCTCGGCCCCTGAGTAGCTGG + Intronic
932345194 2:70990812-70990834 GCCCCCAGCCCCTCAGCAGCAGG - Intronic
932767022 2:74477230-74477252 TGCCTCAGCCTCTGAGCAGCTGG + Intronic
933139866 2:78779327-78779349 ACCGCGAGCCCCTGAGCAGGGGG - Intergenic
933718681 2:85382322-85382344 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
933760521 2:85668849-85668871 TGCCCCAGCCCCTACCCTGGAGG - Intergenic
934058407 2:88271557-88271579 TGGCCCAGGTCCTGGGCAGGTGG + Intergenic
934300509 2:91773636-91773658 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
934501450 2:94862952-94862974 TGCCCCAGCCTCTGAGTAGCTGG + Intergenic
934565817 2:95340220-95340242 TGCCGCACCTCCTGAGCAGCTGG - Intronic
934679187 2:96270386-96270408 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
934964228 2:98705826-98705848 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
935031786 2:99329851-99329873 TGCCTCAGCCCCCGAGGAGCTGG - Intronic
935279226 2:101503555-101503577 AGCCCCACCCCAAGAGCAGGTGG + Intergenic
935282595 2:101532047-101532069 TGCCTCAGCCTCTGAGTAGCCGG - Intergenic
935488365 2:103686479-103686501 TGCCTCAGCCCCTAAGTAGCTGG - Intergenic
935694158 2:105756655-105756677 TGGCCCAGCTCCAGAGCAGCAGG + Intronic
936037030 2:109121131-109121153 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
936574527 2:113642119-113642141 AGCCCCAGCCCCTCAGCTGTGGG - Exonic
936931958 2:117799120-117799142 TGCCTCAGCCCCCGAGTAGCCGG + Intergenic
937098396 2:119250490-119250512 AGCACCAGCCCCTTGGCAGGAGG + Intronic
937105367 2:119307323-119307345 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
937759549 2:125584115-125584137 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
937889909 2:126930948-126930970 TTCTCAAGCCCCTGAGCAGCAGG + Intergenic
937941063 2:127286431-127286453 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
938034438 2:128024763-128024785 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
938082258 2:128376474-128376496 TGCCCCAGGCCCAGAGTAGCAGG - Intergenic
939022945 2:136980467-136980489 GGCCCCACCCCATGAGGAGGAGG + Intronic
939131067 2:138236642-138236664 TGCCTCAGCCTCTGAGTAGATGG - Intergenic
939923634 2:148147354-148147376 TGCCTCAGCCCCCGAGAAGCTGG + Intronic
940078571 2:149772432-149772454 TGCCTCAGCCTCTGAGCAGCTGG - Intergenic
940363395 2:152819753-152819775 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
940565953 2:155360342-155360364 TGCCTCAGCCCCGGAGTAGCTGG + Intergenic
940791621 2:158035269-158035291 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
941598394 2:167507390-167507412 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
941928908 2:170922000-170922022 TTCCTCAGCCTCTGAGTAGGTGG - Intergenic
941984141 2:171492650-171492672 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
942255365 2:174091757-174091779 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
942764136 2:179434049-179434071 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
943192258 2:184694041-184694063 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
943469253 2:188273306-188273328 TGCCTCAGCCCCAGAGTAGCTGG - Intergenic
943561827 2:189473101-189473123 TGCCTCAGCCCCCGAGTAGGTGG - Intronic
943666975 2:190619261-190619283 TGCCTCAGCCCCCAAGCAGCTGG - Intergenic
943716404 2:191157067-191157089 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
944110791 2:196129634-196129656 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
944241727 2:197492302-197492324 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
944245398 2:197525230-197525252 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
944655428 2:201872563-201872585 TGCCCCAGGCCCTGAGAACGAGG + Intronic
944699007 2:202229023-202229045 AGTCCCAGCCACTGAGGAGGCGG - Intronic
945097488 2:206233324-206233346 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
945164760 2:206931190-206931212 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
945457903 2:210070342-210070364 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
945914518 2:215689068-215689090 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
945914539 2:215689202-215689224 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
946367630 2:219259203-219259225 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
946496844 2:220203607-220203629 TGCCTCAGCTCCTGAGTAGATGG - Intergenic
946601459 2:221364413-221364435 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
947202403 2:227626454-227626476 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
947504002 2:230693129-230693151 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
947576248 2:231277184-231277206 TGCCCCAGCCCTGGAGGTGGAGG + Intronic
947582410 2:231329422-231329444 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
947772316 2:232680621-232680643 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
947876458 2:233470996-233471018 AGCCCCTGGTCCTGAGCAGGCGG + Exonic
947882446 2:233529912-233529934 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
948027889 2:234792292-234792314 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
948275640 2:236705874-236705896 CGCCCCAGTCCTTGAGCAGCGGG - Intergenic
948307757 2:236962329-236962351 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
948460558 2:238128095-238128117 TGGCCGAGGCCCTGAGGAGGAGG - Intronic
948483459 2:238264735-238264757 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
948788091 2:240363437-240363459 TGCCCCAGCCTGGGAGAAGGTGG - Intergenic
948901143 2:240957499-240957521 CGCCCCGGCCCCCCAGCAGGCGG - Intronic
1168927406 20:1594087-1594109 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1169454588 20:5741034-5741056 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1170840397 20:19920788-19920810 TGTCTCAGCCCCTGAGTAGCTGG + Intronic
1170848159 20:19979928-19979950 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1170851953 20:20012966-20012988 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1171062770 20:21982526-21982548 TGACCCAGTCCAAGAGCAGGTGG - Intergenic
1171252803 20:23662385-23662407 ACCCCCAGCCCATGTGCAGGCGG - Intergenic
1172040406 20:32040650-32040672 TCACCCCGCCCCTGAGCAGGAGG + Intergenic
1172045471 20:32076969-32076991 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1172103965 20:32504716-32504738 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1172249872 20:33471630-33471652 TGCCTCAGCCCCTGAGTAACTGG + Intergenic
1172534776 20:35664730-35664752 TCCCGCAGCCCCTGAACGGGTGG - Intronic
1172595618 20:36149242-36149264 TGCCCCAGCCCCTTTGCCAGAGG + Intronic
1172605518 20:36210949-36210971 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1172626744 20:36351804-36351826 TGCCCCAGACACTGTGCTGGGGG + Intronic
1172698414 20:36837689-36837711 TGTCTCAGCCCCTGAGTAGCTGG + Intronic
1172937724 20:38632374-38632396 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1173009944 20:39172869-39172891 TGCCTCAGGCTCTGAGCAGCTGG - Intergenic
1173089977 20:39961264-39961286 TCCCGCAGCCCCAGAGGAGGAGG + Intergenic
1173113062 20:40213481-40213503 TGCTTCAGCCCCTGAGTAGCTGG - Intergenic
1173587564 20:44194736-44194758 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1173603921 20:44316029-44316051 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1173666955 20:44769800-44769822 TGGCCCTGCCCCTCAGCTGGGGG - Intronic
1173748026 20:45452948-45452970 TACCTCAGCCTCTGAGCAGCTGG - Intergenic
1173951943 20:47000406-47000428 TGCCTCAGCCTCTGCGCTGGAGG - Intronic
1174000927 20:47374154-47374176 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1174027675 20:47592154-47592176 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1174102333 20:48137207-48137229 TCCACAAGCCCCTGAGAAGGTGG - Intergenic
1174224567 20:48986498-48986520 TGCCTCAGCCTCTGAGCAGCTGG - Intronic
1174469000 20:50741654-50741676 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1174513491 20:51073820-51073842 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1174654296 20:52157570-52157592 TTCCCTAACCCCTGAGTAGGGGG + Intronic
1175109438 20:56636410-56636432 TGCCTCAGCCCCTGAATAGCTGG - Intronic
1175233252 20:57489701-57489723 TGCCTCAGCCTCTGAGGAGCAGG + Intergenic
1175289267 20:57862969-57862991 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1175407891 20:58746562-58746584 GACGCCAGCCCCAGAGCAGGGGG - Intergenic
1175453596 20:59092288-59092310 TGGCCCAGCCCCTGAAGAGATGG - Intergenic
1175506577 20:59490036-59490058 TGCCTCAGCCACTGAGTAGCTGG - Intergenic
1175686092 20:61029876-61029898 TGCACATGCCCCTGAGAAGGAGG + Intergenic
1175776999 20:61659781-61659803 TGCCCCAGCTCCTGGGCCGGAGG - Intronic
1175899359 20:62353943-62353965 TGCCCCAGTGCCTGGGCTGGTGG - Intronic
1176099096 20:63356864-63356886 TGCCTCATGACCTGAGCAGGTGG + Intronic
1176145606 20:63564054-63564076 TGCCCCCGCCGCCGTGCAGGTGG + Exonic
1176197590 20:63844531-63844553 TCCACCAGCCCCTGAGCAGCAGG - Intergenic
1176256254 20:64154671-64154693 GGGTCCAGCCCCTGAGGAGGAGG - Intronic
1176309664 21:5142901-5142923 ACCCCCAACCCCTGAGCAAGGGG + Intronic
1176359419 21:5982625-5982647 TTCCTGAGCCCCTGAGCAGCAGG + Intergenic
1176554064 21:8245446-8245468 TGCCCCAGGCTGTGCGCAGGCGG - Intergenic
1176572986 21:8428470-8428492 TGCCCCAGGCTGTGCGCAGGCGG - Intergenic
1176599332 21:8777322-8777344 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1176628728 21:9117748-9117770 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1176645280 21:9343599-9343621 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1176882447 21:14213854-14213876 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1177291043 21:19111654-19111676 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1177915986 21:27088675-27088697 TGACTCAGCCCCCGAGCAGTTGG + Intergenic
1177932362 21:27300653-27300675 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1178077764 21:29028235-29028257 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1178136483 21:29633382-29633404 TGCCTCAGCCTCCGAGCAGCTGG - Intronic
1178307120 21:31500049-31500071 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1178373777 21:32049837-32049859 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1178759004 21:35382424-35382446 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1178850170 21:36206414-36206436 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1178962329 21:37076814-37076836 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1179222492 21:39421214-39421236 TGCCTCAGCCCCTGGGTAGCTGG + Intronic
1179637055 21:42719524-42719546 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1179718783 21:43303795-43303817 TCCCCCAGCCCCGCAGCATGGGG + Intergenic
1179764099 21:43555925-43555947 TTCCTGAGCCCCTGAGCAGCAGG - Intronic
1179800069 21:43807556-43807578 TGCCTCAGCCCCTGAGTAACTGG + Intergenic
1179881336 21:44294437-44294459 GACCCCAGCCCCTGTGGAGGGGG + Exonic
1180000420 21:44993046-44993068 GGCCTCAGCCCCTGACCATGTGG - Intergenic
1180077765 21:45471932-45471954 TGCCCCACCCCCGGAGCCAGCGG + Intronic
1180326788 22:11436936-11436958 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1180367672 22:11955635-11955657 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1180378416 22:12115699-12115721 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1180419091 22:12797580-12797602 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1180646198 22:17341122-17341144 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1180651771 22:17383109-17383131 TGCCTCAGCCTCTGAGCAGCTGG - Intronic
1180816649 22:18793504-18793526 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1180846011 22:18982854-18982876 TGCCTCAGCCCCGGAGTAGCTGG + Intergenic
1180929885 22:19582269-19582291 TGCCTCAGCCCCCGAGTAGCGGG - Intergenic
1180933654 22:19610219-19610241 TGCCTCAGCCCTTGAGTAGCTGG - Intergenic
1181041492 22:20194706-20194728 CACCCCAGCCCCTGGTCAGGTGG + Intergenic
1181202841 22:21227836-21227858 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1181283894 22:21738612-21738634 TGCCTCAGCCTCTGAGTAGCCGG - Intergenic
1181498963 22:23304998-23305020 TGCCTCAGCCCCTGAGGAGCTGG - Intronic
1181565026 22:23730970-23730992 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1181644423 22:24223285-24223307 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1181698864 22:24608769-24608791 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1181845854 22:25708131-25708153 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1182164056 22:28154463-28154485 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1182279260 22:29208603-29208625 TGCCCCAGCCTCTGTCTAGGGGG + Intronic
1182502020 22:30754767-30754789 TGCCCCAGCACAGCAGCAGGAGG - Intronic
1182590496 22:31375954-31375976 TGCCTCAACCCCTGAGTAGCTGG + Intergenic
1182633829 22:31708738-31708760 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1182674566 22:32028546-32028568 TGTCTCAGCCCCCGAGTAGGTGG + Intergenic
1182888716 22:33798174-33798196 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1183408175 22:37640426-37640448 ACCCCCAGCCTCTGAGCCGGTGG + Intronic
1183667785 22:39255201-39255223 TGCCTCAGGCCCTGACCATGGGG - Intergenic
1183746392 22:39694319-39694341 GGCCCCAGCCCGTGAGCTGCAGG - Intergenic
1183798762 22:40143609-40143631 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1183909877 22:41070734-41070756 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1184111312 22:42397164-42397186 GGCCCCAGCCGCTGGGCAGAGGG + Intronic
1184158184 22:42682685-42682707 TGCCAGAGCCTCTGAGCAGCTGG - Intergenic
1184171415 22:42761915-42761937 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1184173716 22:42774124-42774146 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1184185151 22:42859563-42859585 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
1184396260 22:44243466-44243488 TGCCCCTGCCCCTTTGGAGGTGG + Intergenic
1184468623 22:44683372-44683394 AGCCCCAGCTCCTGAGGAAGAGG + Intronic
1184571474 22:45327690-45327712 CGCCGCAACCCCAGAGCAGGGGG - Intronic
1184574251 22:45349448-45349470 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1184798817 22:46747924-46747946 TGCCCCAGCCTCTCCGCAGAGGG + Intergenic
1184952173 22:47851171-47851193 TGCCTCAGCCCATGGGCAGAAGG - Intergenic
1185015374 22:48339637-48339659 GGGCCCTGCCCCTGAGCTGGGGG + Intergenic
1185193017 22:49450733-49450755 GTCCCCTCCCCCTGAGCAGGGGG - Intronic
1185425643 22:50768764-50768786 AGCCCCAGCCCCTCAGCTGTGGG + Exonic
1203224079 22_KI270731v1_random:67577-67599 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1203259069 22_KI270733v1_random:162484-162506 TGCCCCAGGCTGTGCGCAGGCGG - Intergenic
1203266749 22_KI270734v1_random:19215-19237 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
949194021 3:1283883-1283905 TGCCTCAGCCCCAGAGTAGCTGG - Intronic
949437079 3:4041184-4041206 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
949500946 3:4679502-4679524 TGTCCCAGCTCCAGAACAGGTGG + Intronic
950136604 3:10585378-10585400 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
950224040 3:11219002-11219024 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
950355486 3:12404688-12404710 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
950530735 3:13551029-13551051 TGCCCCATCCCCTGGGTTGGGGG - Intronic
950713305 3:14829278-14829300 TACGCCATCCCCTGGGCAGGGGG + Intronic
951227048 3:20132257-20132279 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
951391290 3:22107136-22107158 TGCCTCAGCCCCGGAGTAGCTGG + Intronic
951415728 3:22419222-22419244 TGCCCCATTCCATGAGCAGGTGG - Intergenic
952018846 3:28992672-28992694 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
952357409 3:32597352-32597374 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
952595042 3:35006952-35006974 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
952619070 3:35314031-35314053 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
952732765 3:36656535-36656557 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
952940197 3:38438113-38438135 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
953153821 3:40350346-40350368 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
953161572 3:40425300-40425322 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
953195716 3:40731397-40731419 TATACCAGCACCTGAGCAGGTGG + Intergenic
953326250 3:42014153-42014175 TTCCCCAGCCCCTGGGCCCGAGG - Intronic
953398615 3:42592312-42592334 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
953927065 3:46987952-46987974 TGCCCCAGCCCCGGGGCGGGAGG + Intronic
954036884 3:47855607-47855629 TGCCACAGCCACTGAGCTGCAGG + Intronic
954071394 3:48145478-48145500 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
954092193 3:48294186-48294208 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
954137545 3:48588981-48589003 GTCCCCAGCCCCTGAGCCTGTGG - Exonic
954167381 3:48770847-48770869 TACCCCAGCCACAAAGCAGGTGG + Intronic
954181627 3:48885686-48885708 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
954243939 3:49316086-49316108 TGCCTCAGCCTCTGAGTAGATGG - Intronic
954354918 3:50076769-50076791 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
954382806 3:50228436-50228458 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
954453875 3:50586486-50586508 GACCCCAGCCCCTGGGAAGGGGG - Intergenic
954557166 3:51527163-51527185 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
954605944 3:51909686-51909708 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
954613398 3:51957838-51957860 TGCGGCAGCCCCAGGGCAGGGGG - Exonic
954731294 3:52664618-52664640 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
954863829 3:53712363-53712385 TGCCCCTGTCCCTGAACACGCGG + Intronic
955169260 3:56547184-56547206 TGCCTCAGCCCCTGAGCAGCTGG - Intergenic
955300607 3:57775166-57775188 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
956093649 3:65693835-65693857 TGCCTCAGCCCCCGAGCAGCTGG + Intronic
956487696 3:69739810-69739832 TGCCCTTGCCCCGGAGCAGAGGG + Intronic
956788356 3:72661227-72661249 TGCCTCAGGGCCTGTGCAGGAGG - Intergenic
957437224 3:80194123-80194145 TGCCTCAGCCCCTAAGTAGCTGG + Intergenic
957483747 3:80831590-80831612 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
957564318 3:81865210-81865232 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
958010683 3:87875333-87875355 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
958632778 3:96703141-96703163 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
958741594 3:98080239-98080261 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
958798668 3:98732649-98732671 GGCGCCAGCCGCGGAGCAGGAGG + Intronic
959036755 3:101375426-101375448 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
959059869 3:101606381-101606403 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
959427203 3:106205429-106205451 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
960096695 3:113696499-113696521 TCCCCCAGCCCCGGAGGAGCAGG - Exonic
960311896 3:116126745-116126767 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
960591222 3:119367741-119367763 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
960652506 3:119967190-119967212 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
960670210 3:120148373-120148395 TGCCTCAGCTCTTGAGCAGTTGG + Intergenic
961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG + Intergenic
961658771 3:128457413-128457435 TGCCCCAGGCCCAGTGCAGAGGG + Intergenic
961755493 3:129124639-129124661 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
961766980 3:129219092-129219114 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
961932287 3:130547152-130547174 TGCCCGAGCCCCTCCGCAGTCGG - Intergenic
962036631 3:131658676-131658698 TCCTCCAGCTCCTGAGAAGGAGG + Intronic
962121232 3:132562216-132562238 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
962855189 3:139338936-139338958 TGCCCAGGCCCCTGACCTGGGGG + Intronic
962943214 3:140144499-140144521 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
963052111 3:141151127-141151149 AGCCACAGCCTCTGAACAGGCGG + Intergenic
963097670 3:141562506-141562528 TGCGCCAGCTCCTGAGTAGCTGG - Intronic
963157179 3:142111312-142111334 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
963210962 3:142689307-142689329 TCCCTCAGCCCCTGAGTAGCTGG - Intronic
963457163 3:145558789-145558811 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
963961267 3:151311908-151311930 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
964098387 3:152960525-152960547 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
964120266 3:153175882-153175904 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
964121632 3:153190423-153190445 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
964362534 3:155913633-155913655 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
964619985 3:158711707-158711729 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
965016228 3:163161068-163161090 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
965591288 3:170362386-170362408 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
965825783 3:172728141-172728163 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
965831553 3:172795211-172795233 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
965834153 3:172832547-172832569 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
966176557 3:177144637-177144659 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
966247270 3:177823657-177823679 TGCCTCAGCCCCCGAGTAGTTGG + Intergenic
966606165 3:181823442-181823464 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
966795973 3:183713917-183713939 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
967251842 3:187547764-187547786 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
967313113 3:188125125-188125147 TGCCTCAGCTCCTGAGGAGCTGG - Intergenic
967660555 3:192103487-192103509 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
967857258 3:194127674-194127696 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
967917943 3:194592727-194592749 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
968083367 3:195862659-195862681 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
968152966 3:196353599-196353621 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
968209409 3:196836095-196836117 TGCCTCAGCCTCTGAGTAGTTGG + Intergenic
968271672 3:197407920-197407942 TGCCTCTGCCCCTGAGTAGCTGG + Intergenic
1202741610 3_GL000221v1_random:61469-61491 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
968438541 4:609324-609346 TACCTCAGCTCCTGAGCAGCTGG + Intergenic
968480578 4:831342-831364 AGCAGGAGCCCCTGAGCAGGGGG - Intergenic
968569166 4:1330429-1330451 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
968721675 4:2211134-2211156 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
968726717 4:2251298-2251320 TGCCCCAGTGCCTGGCCAGGGGG - Intronic
968825265 4:2891331-2891353 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
968829255 4:2923922-2923944 AGCCCCGGCCTCTGTGCAGGGGG + Intronic
968830932 4:2932755-2932777 GGCCCCTGCCCCTGGGCAGATGG - Exonic
968901204 4:3432757-3432779 CTCCTCAGCCCCTGGGCAGGTGG + Intronic
968927592 4:3557908-3557930 GGCCCCTGCCCCTGGGGAGGTGG + Intergenic
968971929 4:3800372-3800394 TGCCCCAGTCCAGGTGCAGGGGG + Intergenic
969339597 4:6531863-6531885 TGGCCCAGGTCCGGAGCAGGTGG + Intronic
969351310 4:6599547-6599569 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
969420611 4:7092795-7092817 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
969657219 4:8505270-8505292 GGCTGCAGCCCCTGAGGAGGTGG + Intergenic
970401214 4:15719589-15719611 TGCCCCAGCCCCTAAGACTGTGG + Intronic
970446118 4:16124516-16124538 TCCCACAACCCCTGAGGAGGAGG - Intergenic
970819249 4:20193500-20193522 TGCCCCAGCCCCTGAAGACAAGG - Intergenic
971269650 4:25129506-25129528 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
971300846 4:25441238-25441260 TGCCCCAACCTCTGAGTAGCTGG - Intergenic
971928678 4:33049035-33049057 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
972501439 4:39681678-39681700 TGCCTCAGCCTCTGAGCAGTTGG + Intergenic
972604565 4:40602052-40602074 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
972771192 4:42198594-42198616 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
973050221 4:45586599-45586621 TGCCTCAGCTCCTGAGTAGGTGG - Intergenic
973201017 4:47502354-47502376 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
973362697 4:49179693-49179715 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
973398404 4:49617160-49617182 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
973677331 4:53278250-53278272 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
973781289 4:54290507-54290529 TGACCCTGTCCCTGAGGAGGAGG + Exonic
973827507 4:54723354-54723376 TGGCCCAGCCCCAGAGGAGATGG - Intronic
973982780 4:56320056-56320078 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
974517705 4:62938544-62938566 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
974856683 4:67469458-67469480 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
975127529 4:70799029-70799051 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
975323154 4:73031430-73031452 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
975602583 4:76118493-76118515 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
976180844 4:82397235-82397257 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
976221429 4:82759563-82759585 TGCCTTAGCTCCTGAGCAGCTGG - Intronic
976420740 4:84840689-84840711 TGCCTCAGCCTCTGAACAGCTGG + Intronic
976528332 4:86119479-86119501 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
976544866 4:86323058-86323080 TGCCTCAGCCCCAGAGTAGCTGG - Intronic
976603907 4:86964547-86964569 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
976634985 4:87278488-87278510 TGCCCAAGCCCCTGCCCATGTGG - Intergenic
977065977 4:92315854-92315876 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
977498360 4:97805320-97805342 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
977681795 4:99805770-99805792 TGCCTCAGCCACTGAGCAGCAGG + Intergenic
978572532 4:110154367-110154389 TGCCTCAGCCTCCGAGCAGCTGG + Intronic
978754344 4:112286189-112286211 TGCCCCAGGGCGTGGGCAGGCGG + Intronic
978762515 4:112369566-112369588 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
979524576 4:121703651-121703673 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
979680148 4:123450496-123450518 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
980050005 4:128029871-128029893 TGCCTCAGCCTCTGAGTAGATGG - Intronic
980112583 4:128648874-128648896 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
980220229 4:129903618-129903640 TGCCCCTGCTCCTGAGGAGATGG + Intergenic
980476593 4:133325923-133325945 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
981006634 4:139881813-139881835 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
981044441 4:140252766-140252788 TGCCCGAGCCCGAGAGCGGGAGG - Intergenic
981078940 4:140618888-140618910 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
981089590 4:140718999-140719021 TGCCTCAGCCTCCGAGCAGCTGG - Intronic
981343850 4:143652741-143652763 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
981420502 4:144544352-144544374 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
981903505 4:149893266-149893288 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
981931971 4:150199888-150199910 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
982514227 4:156324180-156324202 TGCCTCAGCCTCCGAGCAGCTGG + Intergenic
982769438 4:159382486-159382508 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
982992909 4:162301874-162301896 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
982999388 4:162393764-162393786 TGCCTCAGCTCCTGAGTAGCAGG - Intergenic
983059487 4:163141248-163141270 TGCCTCAGCCCCTGAGTGGCTGG - Intronic
983867994 4:172790777-172790799 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
983977222 4:173950378-173950400 TGCCTCAGCCCCAGAGTAGCTGG + Intergenic
984509279 4:180659152-180659174 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
984806755 4:183758425-183758447 TTCCCAAGGCCGTGAGCAGGAGG + Intergenic
985096762 4:186420541-186420563 TGCCCCTGCCCAGCAGCAGGAGG + Intergenic
1202760036 4_GL000008v2_random:101165-101187 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
985543630 5:498514-498536 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
985835290 5:2266996-2267018 TGCCCCAACCACAGGGCAGGCGG + Intergenic
986208407 5:5647682-5647704 TGCCACAGCCCTTGGGCACGTGG + Intergenic
986682697 5:10248659-10248681 TGCCTCAGCCCCAGAGTAGATGG + Intronic
986692702 5:10326834-10326856 TGCCTCAGCCTCTGAGTAGGTGG - Intergenic
986808245 5:11329267-11329289 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
986843381 5:11723939-11723961 TGCCACAGCTCCCGAGCAGCTGG - Intronic
986899041 5:12409215-12409237 TGCCTCAACCCCTGAGTAGCTGG + Intergenic
988461105 5:31438673-31438695 TGTCCTAGCCCATGAGCAGTAGG - Intronic
988800935 5:34696250-34696272 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
988802959 5:34713917-34713939 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
988805457 5:34736284-34736306 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
989234246 5:39126580-39126602 TACCTCAGCCTCTGAGCAGCTGG - Intronic
989241651 5:39209438-39209460 TGCCTCAGCCTCCGAGCAGGTGG + Intronic
989303135 5:39917807-39917829 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
989826667 5:45864917-45864939 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
990571257 5:57081358-57081380 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
990716551 5:58643933-58643955 TGCCTCAGCCCCCGAGGAGCTGG + Intronic
990806495 5:59668592-59668614 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
990911677 5:60858700-60858722 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
991334251 5:65529599-65529621 TGCCCCAGCCCCTGAGTAGCTGG + Intronic
991696829 5:69280913-69280935 TGCCTCAGCCCCTGAGTAGCTGG + Exonic
992207642 5:74446334-74446356 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
992301888 5:75391077-75391099 TGCCTCAGCCTCTGAGTAGGTGG + Intronic
992578643 5:78147917-78147939 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
992657860 5:78928427-78928449 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
992821727 5:80504632-80504654 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
993092575 5:83444272-83444294 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
993131565 5:83904942-83904964 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
993581981 5:89674299-89674321 TGCCTCAGCCCCAGAGTAGCTGG - Intergenic
993788249 5:92172065-92172087 TGCCTCAGCCCCTGAGTAACTGG + Intergenic
993903049 5:93597104-93597126 TGGCCCAGGACCTGGGCAGGAGG + Intergenic
994399643 5:99263573-99263595 TGCCCCAGTCCTGCAGCAGGTGG - Intergenic
994649398 5:102507450-102507472 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
995382435 5:111549821-111549843 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
996406496 5:123110679-123110701 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
996817128 5:127586866-127586888 TGCTCCAGCCCCTTAGCAAGGGG - Intergenic
996846489 5:127904614-127904636 TGCCTCAGCCCCTGAGTAGCCGG + Intergenic
996963129 5:129275289-129275311 TGCCTCAGCTCCTGAGTAGTTGG - Intergenic
996977327 5:129450672-129450694 TGGCCCAGGTGCTGAGCAGGGGG + Intergenic
997218002 5:132130291-132130313 TGCCTCAGCTCCTGAGTAGAGGG - Intergenic
997540352 5:134656593-134656615 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
997714084 5:136029200-136029222 TTCCGCAGCCCCTGGCCAGGCGG - Intronic
997717067 5:136050216-136050238 TGCCTCAGCCCCTGAGTAACTGG - Intronic
997727222 5:136132177-136132199 GGACCCAGCCCCTGGACAGGCGG - Intergenic
998047752 5:139003099-139003121 TTCCCCAGCTCCTGAGATGGTGG - Intronic
998136930 5:139678828-139678850 GGGCCCAGCCCCAGAGCAGCTGG - Intronic
998149755 5:139750209-139750231 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
998217428 5:140247814-140247836 TGCCTCAGCCCCTAAGTAGCTGG - Intronic
998435375 5:142103694-142103716 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
998457952 5:142288313-142288335 TGCCTCAGCTCCTGAGTAGGTGG + Intergenic
998537015 5:142942892-142942914 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
999281966 5:150372080-150372102 GGCCCCAGCCCCTGGGAAGGTGG + Exonic
999387387 5:151164167-151164189 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
999439641 5:151591328-151591350 TGTCCCAGCCCAGGAGGAGGAGG + Intergenic
999762988 5:154716943-154716965 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1000003806 5:157164903-157164925 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1000037506 5:157460252-157460274 CTCCCCAGCTCCGGAGCAGGTGG - Exonic
1000134993 5:158339297-158339319 TGCCTCAGCCTCCGAGCAGCTGG + Intergenic
1000702691 5:164473171-164473193 TGCCTCAGCCTCTGAGAAGCTGG - Intergenic
1001146238 5:169187225-169187247 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1001328397 5:170745607-170745629 TGCCCCAGCCTCTGAGCAACTGG - Intergenic
1001462477 5:171929254-171929276 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1001568430 5:172715083-172715105 TGCCCCAGCCCCAGGGCTGCAGG + Intergenic
1001683936 5:173578429-173578451 TGCCTGGGCCCCTCAGCAGGTGG - Intergenic
1002132435 5:177089785-177089807 TTGCCCAGGCCCTGAGAAGGTGG + Intronic
1002189756 5:177472484-177472506 GCCGCCAGCCCCAGAGCAGGTGG + Intronic
1002524076 5:179806140-179806162 CGCCCCAGCTCCTGCCCAGGTGG + Intronic
1002545047 5:179936232-179936254 GGCCTCAGCCTCTGAGCAGCTGG + Intronic
1002595915 5:180322919-180322941 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1002606863 5:180388719-180388741 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1002920299 6:1564407-1564429 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1003077652 6:2997488-2997510 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1003234281 6:4281963-4281985 TCCCCCAGCTCCGCAGCAGGTGG + Intergenic
1003358921 6:5404911-5404933 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1003501416 6:6706069-6706091 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1003620014 6:7691514-7691536 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1004562798 6:16767012-16767034 TACCTCAGCCCCTGAGTAGCTGG + Intergenic
1004731736 6:18366185-18366207 TGTCCCAGGCCCTGGGGAGGAGG - Intergenic
1005065840 6:21816828-21816850 TGCCCCAGCCTCCGAGTAGCTGG + Intergenic
1005516515 6:26559625-26559647 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1005745466 6:28833030-28833052 TGCCTCAACCTCTGAGCAGCTGG - Intergenic
1005913083 6:30327371-30327393 TGCCCCAGCCCCAGATCTGGCGG + Intronic
1006030763 6:31175170-31175192 TGCCCCAGCCCCTGAGTCCCTGG - Intronic
1006060578 6:31415541-31415563 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1006119788 6:31796770-31796792 TGCCACAGCTCCTGAGTAGCTGG - Intergenic
1006123705 6:31823705-31823727 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1006309870 6:33249943-33249965 TGCTGCAGCCCCCGAGCAAGGGG + Intergenic
1006311101 6:33260884-33260906 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1006334822 6:33415020-33415042 AGCCAGAGCCCCTGAGGAGGAGG + Exonic
1006376753 6:33675871-33675893 TGGCCCTGGCCCTGAGCATGAGG + Intronic
1006802425 6:36767654-36767676 TCCTCCAGCCTCTGAGCATGTGG - Intronic
1006972357 6:38059760-38059782 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1006984339 6:38167193-38167215 TGGCCCAGCCCATGTGCAGAGGG - Intergenic
1007114231 6:39332059-39332081 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
1007219987 6:40270789-40270811 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1007403939 6:41622489-41622511 TGCCTCAGGCCGTGAGCTGGAGG + Intergenic
1007428502 6:41762523-41762545 TGCCTCATCCCCAGAGCAGATGG - Intergenic
1007461482 6:42022463-42022485 TGACCCAGCCCCAGAGGAAGTGG - Intronic
1007487309 6:42190057-42190079 AGCCCCAGCCCCAGATCAAGGGG + Intronic
1007512681 6:42386327-42386349 TGCCTCAGTCCCTGAGTAGCTGG - Intronic
1007554587 6:42755333-42755355 TACCCCAGCTCCTGAGGAGTAGG - Intronic
1008084851 6:47234103-47234125 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1008233238 6:49011216-49011238 AGCCCCAGCCCCTAACCACGGGG - Intergenic
1008602123 6:53106627-53106649 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1008707514 6:54181291-54181313 CGCCCCAGCCCATGTGCTGGTGG - Intronic
1008798543 6:55338202-55338224 TGCCTCAGCCCCTGAGTAGCTGG + Intronic
1009428052 6:63536214-63536236 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1010401307 6:75449530-75449552 TGCCTCAACCCCTGAGTAGCTGG - Intronic
1010797540 6:80134864-80134886 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1010888322 6:81271667-81271689 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1011275917 6:85631226-85631248 TGCCTCAGCCACTGAGTAGCTGG - Intronic
1011539326 6:88413927-88413949 TGCCTCAGCCTCTGAGTAGTGGG + Intergenic
1011595791 6:89014552-89014574 TGCCTCAGTCCCTGAGTAGCTGG - Intergenic
1011640894 6:89414769-89414791 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1011646192 6:89460548-89460570 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1012911954 6:105127872-105127894 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1013033963 6:106362082-106362104 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1013521954 6:110941518-110941540 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1013905308 6:115209946-115209968 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1013988990 6:116230990-116231012 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1014432816 6:121389990-121390012 TGCCCCAGGACCAAAGCAGGAGG + Intergenic
1016714691 6:147211193-147211215 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1016886364 6:148963360-148963382 TGCCCCAGTCTCTGGGCAGAGGG - Intronic
1017109110 6:150915712-150915734 GGCCTCAGCCTCTGAGTAGGTGG + Intronic
1017857255 6:158360705-158360727 TCCCACAGGCTCTGAGCAGGTGG + Intronic
1018022181 6:159771775-159771797 TGCCTCAGCTCTTGAGTAGGTGG - Intronic
1018465603 6:164041752-164041774 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1018579896 6:165299796-165299818 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1018768775 6:166954875-166954897 TGCCTCAGCCTCTGAGTAGGTGG - Intronic
1019385229 7:751685-751707 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1019428257 7:987339-987361 TGCCCCAGGCCGGGTGCAGGAGG + Exonic
1019607890 7:1919154-1919176 TGCCCCAGGACCTGGGCCGGTGG + Intronic
1019677823 7:2325716-2325738 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1019738120 7:2660372-2660394 TGCCCGGGCCCCTGGGCATGTGG + Intronic
1019777587 7:2921841-2921863 TCCCCCAGCTCCGGGGCAGGCGG - Intronic
1019945429 7:4324975-4324997 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1019960318 7:4454160-4454182 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1020004582 7:4775565-4775587 TGCCGCATCACATGAGCAGGAGG - Intronic
1020024608 7:4890194-4890216 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1020046540 7:5045212-5045234 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1020130777 7:5557450-5557472 TGCCTCAGCCTCCGAGTAGGTGG - Intronic
1020656398 7:10932854-10932876 TGCCTCAGCCCCTAAGTAGCCGG - Exonic
1020703902 7:11518100-11518122 TGCCCTAGACTCTAAGCAGGGGG - Intronic
1020827840 7:13053995-13054017 GGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1021328759 7:19308437-19308459 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1021565840 7:22015404-22015426 TGCCTCAGCATCTGAGCAGCTGG - Intergenic
1021721310 7:23507212-23507234 TGCCTCAGCTCCCGAGCAGCTGG + Intronic
1021882359 7:25107070-25107092 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1022014025 7:26333436-26333458 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1022200919 7:28116556-28116578 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1022360864 7:29655879-29655901 TGCTTCAGCCCCTGAGTAGCTGG - Intergenic
1022627785 7:32055832-32055854 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1023462589 7:40415154-40415176 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1023574143 7:41606872-41606894 TGCCTCAGCCCCTCAGTAGCTGG - Intergenic
1023856916 7:44189651-44189673 TGCCCCAGGATCTGAACAGGTGG - Intronic
1024258796 7:47558843-47558865 TGTCCAAGGCCATGAGCAGGAGG + Intronic
1024620111 7:51149718-51149740 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1024931924 7:54673146-54673168 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1025266328 7:57461161-57461183 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1025625863 7:63220956-63220978 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1025656256 7:63522209-63522231 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1025734150 7:64132158-64132180 TGCCTCAGCCCCTGAGGAGCTGG + Intronic
1025977546 7:66380893-66380915 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1026129347 7:67607272-67607294 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1026159962 7:67860083-67860105 TGCCTCAGCCCGTGAGGAGCTGG + Intergenic
1026498524 7:70923504-70923526 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1026549492 7:71356089-71356111 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1026729508 7:72899094-72899116 GGCCTCAGCCCCTGAGTAGCTGG + Intronic
1026842447 7:73677702-73677724 TGCCTCAGCTCCTGAGTAGTTGG + Intergenic
1026851964 7:73729960-73729982 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1026898627 7:74025020-74025042 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1026981050 7:74526752-74526774 AGCCCCAGCCCTTGAGCAATTGG - Intronic
1027025843 7:74851284-74851306 TTCCCCAGGCCCTCAGGAGGAGG + Intronic
1027061918 7:75092835-75092857 TTCCCCAGGCCCTCAGGAGGAGG - Intronic
1027114494 7:75468016-75468038 GGCCTCAGCCCCTGAGTAGCTGG - Intronic
1027165044 7:75828309-75828331 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1027203235 7:76076065-76076087 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1027756588 7:82221628-82221650 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1027760851 7:82277314-82277336 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1027853724 7:83482449-83482471 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1028621461 7:92833446-92833468 CGCCCGAGCGCCTGAGCCGGCGG - Exonic
1028789375 7:94835624-94835646 TGCCTCAGCCCCCGAGGAGCTGG - Intergenic
1029173491 7:98647171-98647193 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1029405762 7:100373360-100373382 AGGCCCAGCCCCTCGGCAGGAGG + Intronic
1029454984 7:100665110-100665132 TGTCTCAGCCCCTGAGTAGCTGG - Intergenic
1029477902 7:100795964-100795986 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1030585541 7:111414101-111414123 TGAGCCAGCCCCTGAGGAGGGGG - Intronic
1031293271 7:119966926-119966948 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1032125185 7:129188582-129188604 TCCCCCAGCCTCGGCGCAGGGGG + Intergenic
1032246190 7:130215188-130215210 TGCCTCAGCCCCCCAGCAGCTGG - Intronic
1032627550 7:133608661-133608683 TGCCCCAGCTCCTGAGTAGCTGG + Intronic
1032779953 7:135157605-135157627 ATCTCTAGCCCCTGAGCAGGTGG + Intronic
1032790368 7:135238220-135238242 TCCCCCAGCTCCTGACCAGGGGG + Intronic
1033189337 7:139262598-139262620 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1033282815 7:140017841-140017863 TGCCCCTGCCTCTGAGCAGGGGG - Intronic
1033305773 7:140224276-140224298 TGGCCCAGCTCCTGAGAGGGAGG - Intergenic
1033597781 7:142868958-142868980 TGCCCCTTCCCCTCAGCAGCGGG + Exonic
1034064510 7:148123481-148123503 TGCCTCAGCCTCTGGGCAGGAGG - Intronic
1034498621 7:151436220-151436242 TGACCCAGCCCCTGCTCTGGAGG + Exonic
1034575660 7:151994869-151994891 TGCCTCAGCTCCCGAGCAGCTGG + Intronic
1034899518 7:154899080-154899102 TGGCCCAGCTCCTGAGCATGTGG + Intergenic
1035295456 7:157864694-157864716 TGCCCCATCCTCTCTGCAGGAGG + Intronic
1035411816 7:158650158-158650180 TGCCTCAGCCCCCGAGCAGCTGG + Intronic
1035479043 7:159167405-159167427 TGCCGCTGCCTCTGAGCAAGGGG + Intergenic
1035495692 7:159323723-159323745 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1035532698 8:366500-366522 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1035582606 8:749111-749133 TGCCTCAGCCCTTGAGTAGCTGG + Intergenic
1035594179 8:841693-841715 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1035744294 8:1950644-1950666 TGCCTCAGCTCCTGAGTAGTTGG + Intronic
1036649613 8:10633983-10634005 TGCCCGAGGGCCTGACCAGGAGG + Intronic
1036697453 8:10986883-10986905 TGCCTCAGCCCCTAAGTAGATGG + Intronic
1037506013 8:19530105-19530127 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1037905954 8:22716159-22716181 TGTCCCAGCCACAGGGCAGGTGG - Intronic
1037983973 8:23275190-23275212 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1038164050 8:25067712-25067734 TGCCCCCACCCCACAGCAGGAGG - Intergenic
1038323735 8:26554002-26554024 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1038326060 8:26573552-26573574 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1038353580 8:26805661-26805683 TACCCCAGCTCCAGAGCTGGTGG + Intronic
1038435806 8:27535288-27535310 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1038447382 8:27613270-27613292 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1038781099 8:30569008-30569030 TGCCCCAGCCCCTGAGCAGGCGG - Intronic
1038993958 8:32900929-32900951 TGCCTCAGCCTCTGAGTAGTTGG + Intergenic
1039040366 8:33402162-33402184 TGCCCCAGACCCTTGGCTGGAGG + Intronic
1039084138 8:33763162-33763184 TGCCTCAGCCTCTGAGTAGTGGG + Intergenic
1039248440 8:35634878-35634900 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1039368190 8:36955383-36955405 TGTATCAGCCCCTCAGCAGGTGG - Intergenic
1039471569 8:37816476-37816498 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1039617859 8:38970682-38970704 TGCCTCAGCCTCTGAGTAGCTGG - Exonic
1039928270 8:41959045-41959067 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1039950947 8:42172304-42172326 TGCCTCAGCCTCAGAGTAGGTGG + Intergenic
1040323754 8:46330927-46330949 TGGTCTAGCCACTGAGCAGGGGG + Intergenic
1040861782 8:52007198-52007220 TGCCTCAGCCTCTGAGTAGTTGG - Intergenic
1040967127 8:53093814-53093836 TGCCTCAGCCTCCGAGCAGCTGG - Intergenic
1041049414 8:53918500-53918522 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1041250718 8:55932533-55932555 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1041577689 8:59418767-59418789 TGCCTCAGCCCCTGAGCAGCTGG + Intergenic
1041722374 8:60987815-60987837 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1041781229 8:61579711-61579733 TGCCCCAGAGCCTGAGAAGGAGG + Intronic
1042234180 8:66591231-66591253 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1042311291 8:67381626-67381648 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1042532559 8:69831144-69831166 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1042553115 8:70011881-70011903 TGCCTCAGCCCCTGAGTATCTGG + Intergenic
1042582163 8:70291959-70291981 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1042644032 8:70966360-70966382 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1042855563 8:73263398-73263420 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1043075593 8:75695084-75695106 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1043391646 8:79797634-79797656 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1043486484 8:80703333-80703355 TGCCCCTGGCCCTTGGCAGGTGG - Intronic
1043580189 8:81703535-81703557 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1043967825 8:86498660-86498682 AGCCCCAGCCACTCAGGAGGTGG + Intronic
1044659090 8:94578222-94578244 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1044669902 8:94668905-94668927 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1045330357 8:101150703-101150725 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1045351062 8:101340039-101340061 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1045454936 8:102368540-102368562 TGCCTCACCTCCTGAGTAGGTGG + Intronic
1045777583 8:105824000-105824022 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1046006152 8:108488273-108488295 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1046378414 8:113419230-113419252 TGCCTCAGCCTCTGAGTAGATGG + Intronic
1046936255 8:119887932-119887954 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1047078728 8:121435691-121435713 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1047109394 8:121772133-121772155 TGCCTCAGCCTCCGAGCAGCTGG - Intergenic
1047109534 8:121773595-121773617 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1047119577 8:121886008-121886030 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1047121616 8:121910932-121910954 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1047224938 8:122948133-122948155 TCACCGAGCCCCTAAGCAGGTGG + Intronic
1047272672 8:123376975-123376997 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1047421944 8:124714574-124714596 TGCCCCAGCCTCTGTGTAGCTGG + Intronic
1047775705 8:128068608-128068630 TGCCTCAGCCCCTGAGAAGCTGG + Intergenic
1047959499 8:130000576-130000598 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1048575344 8:135685674-135685696 ACCCACAGCCCATGAGCAGGTGG - Intergenic
1048575559 8:135687160-135687182 TGCCCCTGCCCCTGAGTGAGTGG + Intergenic
1048901576 8:139042845-139042867 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1048904630 8:139075771-139075793 TGCCTCAGCCTCTGAGTAGTTGG - Intergenic
1049132540 8:140860586-140860608 TGCCCCAGCTCCTCAGTAGCTGG + Intronic
1049269064 8:141684535-141684557 TGCCCCAGCTGCAGAGCACGTGG + Intergenic
1049274774 8:141714698-141714720 TTGCCCAGCCCCTGGGCAGGAGG - Intergenic
1049318001 8:141979867-141979889 TGCCACAGCCCTGGAGGAGGGGG - Intergenic
1049457632 8:142701469-142701491 GGCCCCAGCCACTGCTCAGGGGG + Intronic
1049543788 8:143220261-143220283 GGCCCCAGTCCCTAAGGAGGAGG - Intergenic
1049611892 8:143559690-143559712 TGTCCCAGCCCCAGGGCAGAGGG - Intronic
1049633270 8:143671285-143671307 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1049685066 8:143936079-143936101 TACCCCTGCCCCTGTGCATGTGG - Intronic
1049767222 8:144360504-144360526 ACCCCCAGCCCCTGTGCGGGTGG + Intronic
1049862409 8:144908776-144908798 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1050312244 9:4365440-4365462 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1050504173 9:6330006-6330028 TCCTCCAGCCCCTCAGCTGGAGG - Exonic
1050564011 9:6863679-6863701 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1050719100 9:8564584-8564606 TGCCTCAGCCCCTGAGTAGCGGG - Intronic
1050928557 9:11296978-11297000 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1050930991 9:11326414-11326436 TACAGCAGCCCCTAAGCAGGAGG - Intergenic
1051242928 9:15079344-15079366 TGCCTCAGCACCTGAGTAGCTGG - Intergenic
1051633360 9:19160007-19160029 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1052458395 9:28731102-28731124 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1052797796 9:32939782-32939804 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1052881870 9:33605842-33605864 TGCCTCGGCCCCTGAGTAGCCGG + Intergenic
1052892406 9:33715437-33715459 TGCCTTAGCCCCTGAGTAGCTGG - Intergenic
1052898436 9:33769743-33769765 TGCCCCAGCCCAGGACCAAGGGG + Intronic
1053005913 9:34604326-34604348 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1053316560 9:37057011-37057033 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1053357648 9:37460320-37460342 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1053435746 9:38073045-38073067 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1053494442 9:38540003-38540025 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1054784657 9:69199414-69199436 TGCCTCAGCCCCGGAGTAGCTGG - Intronic
1055041878 9:71883027-71883049 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1055098379 9:72437868-72437890 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1055228300 9:74028385-74028407 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1055368915 9:75575813-75575835 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1055428029 9:76215823-76215845 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1056149824 9:83774821-83774843 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1056285001 9:85078879-85078901 GGCCACAGCACCTTAGCAGGTGG - Intergenic
1056318876 9:85418137-85418159 TGCCCCTGAACCTGAGTAGGTGG - Intergenic
1056395946 9:86181082-86181104 TGCCTCAGCCCTTGAGTAGCTGG - Intergenic
1056460224 9:86802135-86802157 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1056580829 9:87887250-87887272 TGCCCCACCGCCTGAGCAGGAGG + Exonic
1056789858 9:89618367-89618389 TCCCTCAGCCCCTGAGAACGTGG + Intergenic
1057149495 9:92783747-92783769 TGCCTCAGCTCCTGAGCAGCTGG + Intergenic
1057151298 9:92798456-92798478 TGCCCCAGCGCCAGGGCAGAGGG + Intergenic
1057170052 9:92956949-92956971 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
1057386392 9:94609073-94609095 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1057639897 9:96809404-96809426 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1057889196 9:98855558-98855580 TGCCTCAGCCCCCAAGCAGATGG + Intergenic
1058002945 9:99885117-99885139 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1058214388 9:102216167-102216189 TGCCTCAGCCCCTGAGTAACTGG + Intergenic
1058361453 9:104151354-104151376 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1058396578 9:104560423-104560445 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1058658245 9:107245303-107245325 TGCCTCAGCCCCTGAGTAACTGG + Intergenic
1059067536 9:111101459-111101481 TGCCTCAGCTCCTGAGAAAGTGG + Intergenic
1059096231 9:111417630-111417652 TGCCCCAGCTCCTGAATAGCTGG - Intronic
1059177354 9:112179410-112179432 TGCCTCAGCCCCAGAGTAGCTGG - Intergenic
1059242163 9:112815955-112815977 TGCCTCAGCCTCTGAGTAGTAGG + Intronic
1060119096 9:120971550-120971572 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1060551270 9:124486493-124486515 TGACCCAGCTCCTGGGCAGGGGG - Intronic
1061017330 9:127989471-127989493 AGCCCCAGTCCCAGAGCAGATGG - Intergenic
1061023651 9:128033455-128033477 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1061076833 9:128346586-128346608 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1061122539 9:128652802-128652824 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1061216854 9:129226579-129226601 TGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1061297933 9:129687030-129687052 TCCCCCACCCCCTCTGCAGGGGG - Intronic
1061435327 9:130557711-130557733 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1061615167 9:131774570-131774592 AGCCAGAGCCCTTGAGCAGGGGG - Intergenic
1061632013 9:131878157-131878179 TGCCTCAGCCCCTAAGTAGTTGG - Intronic
1061672192 9:132194900-132194922 TGGCTCAGCCCCTCAGAAGGCGG + Intronic
1061938524 9:133871853-133871875 GGCCCCCACCCCTGGGCAGGTGG - Intronic
1061951480 9:133938693-133938715 CTCCCCAGCCCCTTAGGAGGTGG + Intronic
1062240449 9:135534762-135534784 TGTCCCAGCCCCTGTGAATGAGG + Intergenic
1062242359 9:135547293-135547315 TGCACCAGCCCCACTGCAGGTGG + Intronic
1062383020 9:136296669-136296691 GGCCCCTGCCCTTGAGCGGGTGG - Intronic
1062395385 9:136350643-136350665 CCTCCCAGCCCCTGACCAGGAGG - Intronic
1062436938 9:136550559-136550581 TCCCCCAGCCTCTGTGCAGAGGG - Intergenic
1062663379 9:137652498-137652520 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1062698980 9:137889465-137889487 AGCCCCAGCCCCAGAACACGGGG - Intronic
1203751574 Un_GL000218v1:85430-85452 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1203475260 Un_GL000220v1:144493-144515 TGCCCCAGGCTGTGCGCAGGCGG - Intergenic
1203710244 Un_KI270742v1:91393-91415 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1203540811 Un_KI270743v1:86059-86081 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1185514439 X:688574-688596 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1185514492 X:688885-688907 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1185644654 X:1608441-1608463 TGCCCCAGCTCCTGGGCAGGTGG - Intergenic
1185752093 X:2620209-2620231 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1185891890 X:3829149-3829171 TGTACAAACCCCTGAGCAGGAGG + Intronic
1185896995 X:3867563-3867585 TGTACAAACCCCTGAGCAGGAGG + Intergenic
1185902113 X:3905989-3906011 TGTACAAACCCCTGAGCAGGAGG + Intergenic
1186856539 X:13631671-13631693 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1187332059 X:18350163-18350185 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1187384420 X:18834272-18834294 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1187499103 X:19823933-19823955 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1187541749 X:20203374-20203396 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1187685939 X:21815473-21815495 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1187710324 X:22046679-22046701 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1188391959 X:29631679-29631701 TGCCTCAGCCTCCGAGTAGGTGG - Intronic
1188494286 X:30767117-30767139 TGCCTCAGCCACTGAGTAGCTGG + Intergenic
1188654806 X:32680026-32680048 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1188852175 X:35145286-35145308 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1189112839 X:38311581-38311603 TTGCCCAACCCCTGAGAAGGTGG + Intronic
1189311481 X:40021373-40021395 TGCCTCAGCTCCTGAGTAGGTGG + Intergenic
1189393013 X:40593131-40593153 TGCCTCAGCCACTGAGTAGCTGG - Intronic
1189425585 X:40897170-40897192 AGCCCCAGCCTCTAGGCAGGGGG - Intergenic
1189443305 X:41057106-41057128 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1189465046 X:41272067-41272089 TGCCTCAGCCCCTGAGTAGCTGG - Intergenic
1189565218 X:42234836-42234858 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1189811758 X:44787635-44787657 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1189823586 X:44894727-44894749 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1190031466 X:46977243-46977265 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1191705847 X:64093856-64093878 TGCCCCAGCCTCAAAGTAGGAGG - Intergenic
1192784919 X:74326010-74326032 CGCCCCGGCCCCTGAGCAGGCGG + Intergenic
1193033415 X:76923958-76923980 AGTCTCTGCCCCTGAGCAGGAGG - Intergenic
1193333815 X:80264137-80264159 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1193378520 X:80790069-80790091 TGCCTCAGCCCCTGAGTAGCTGG - Intronic
1194504490 X:94715437-94715459 TGCCTCAGCCGCCGAGCAGCTGG - Intergenic
1195393199 X:104384602-104384624 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1195680054 X:107538772-107538794 TGCCTCAGCCCCCGAGGAGCTGG + Intronic
1195707592 X:107749260-107749282 TGCCTCAGCTCCTGAGTAGCTGG - Intronic
1195998629 X:110757931-110757953 TGACCCAGACCCAGAGCATGGGG - Intronic
1198218249 X:134576420-134576442 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1198381105 X:136084392-136084414 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1198821440 X:140652352-140652374 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1199332876 X:146582384-146582406 TGCCCCTGCCCCTGACCAAGGGG + Intergenic
1199848804 X:151710773-151710795 TGCCCTAGCCTCTCAGCTGGGGG + Intergenic
1200022292 X:153222272-153222294 TGCCCCAGCCCATGGGCAGTAGG + Intergenic
1200174879 X:154107106-154107128 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1200396956 X:155996665-155996687 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1201059397 Y:10031795-10031817 TGCCTCAGCCACTGAGTAGCAGG - Intergenic
1201165228 Y:11203047-11203069 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1201235766 Y:11909701-11909723 TGACTCAGCCCCTGAGTAGCTGG - Intergenic
1201331048 Y:12821759-12821781 TGCCTCAGCTCCTGAGTAGCTGG + Intronic
1201575489 Y:15457229-15457251 TGCCTCAGCCTCTGAGTAGCGGG - Intergenic
1201781148 Y:17724257-17724279 TGCCTCAGCTCCTGAGTAGCTGG - Intergenic
1201820405 Y:18181733-18181755 TGCCTCAGCTCCTGAGTAGCTGG + Intergenic
1201891847 Y:18951046-18951068 TGCCTCAGCCCCCGAGTAGTTGG + Intergenic