ID: 1038781100

View in Genome Browser
Species Human (GRCh38)
Location 8:30569011-30569033
Sequence CAATGCCCCAGCCCCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 3, 2: 1, 3: 28, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781100_1038781104 3 Left 1038781100 8:30569011-30569033 CCTGCTCAGGGGCTGGGGCATTG 0: 1
1: 3
2: 1
3: 28
4: 273
Right 1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG No data
1038781100_1038781105 11 Left 1038781100 8:30569011-30569033 CCTGCTCAGGGGCTGGGGCATTG 0: 1
1: 3
2: 1
3: 28
4: 273
Right 1038781105 8:30569045-30569067 GGTTCATTACCCAGGAAAGCTGG No data
1038781100_1038781103 -10 Left 1038781100 8:30569011-30569033 CCTGCTCAGGGGCTGGGGCATTG 0: 1
1: 3
2: 1
3: 28
4: 273
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781100 Original CRISPR CAATGCCCCAGCCCCTGAGC AGG (reversed) Intronic
900122542 1:1054964-1054986 CCCTGCCCCACCCCATGAGCTGG + Exonic
900695342 1:4006196-4006218 CAACCCCACAGCCCCTGGGCCGG + Intergenic
902615102 1:17619391-17619413 CAAGCCCCCAGCCCCAGAGCTGG + Exonic
902817195 1:18923063-18923085 CAATTCCAAAGCCGCTGAGCAGG + Intronic
903008621 1:20314896-20314918 CAATGTGCCAGACACTGAGCTGG + Intronic
903161317 1:21491167-21491189 CAATGCCAAAGCCCCAGAGGGGG - Intergenic
903750566 1:25618010-25618032 CCATGCCCCGGCCCGCGAGCAGG + Exonic
904372520 1:30058859-30058881 CTATGCCCCAGGCACTGAGATGG + Intergenic
904470616 1:30733799-30733821 CCAGGCCCCAGCCCCAGTGCTGG - Exonic
904477474 1:30774578-30774600 CCCTGCCCCATGCCCTGAGCAGG + Intergenic
904690921 1:32292649-32292671 CCCTCCCCCAGCCTCTGAGCGGG + Intronic
904972647 1:34431249-34431271 CTGTGCCCCAGCGCCTGAGATGG - Intergenic
907581072 1:55573212-55573234 CCAGGCCCCAGCCCCTGCTCTGG - Intergenic
908404078 1:63796815-63796837 CAATGCACCGAGCCCTGAGCTGG + Intronic
912673037 1:111649195-111649217 AATGGCCCCAGTCCCTGAGCTGG + Intronic
914952046 1:152124763-152124785 CAATGAGGCAGACCCTGAGCTGG + Intergenic
915079196 1:153339999-153340021 CAGAGCCCCAGCCTCTGAGTAGG + Intronic
915330855 1:155111546-155111568 CAGGGCCCCAGCCCCTGGCCTGG + Intergenic
916436454 1:164782184-164782206 CCATCCCCCGGCCCATGAGCTGG - Intronic
920966243 1:210703858-210703880 AATTGGCCCAGCCCCAGAGCAGG + Intronic
921220810 1:212972464-212972486 CCATCCCCCTGCCTCTGAGCAGG - Intronic
921631167 1:217435649-217435671 GAATAGCCCAGCCCCTCAGCTGG - Intronic
922795928 1:228339838-228339860 CAGGGCCCCAGCCCTTGTGCAGG + Intronic
1063492595 10:6478533-6478555 CAGTGAGCAAGCCCCTGAGCTGG - Intronic
1067078728 10:43202410-43202432 CCATGCCCTAGGCCCTGTGCTGG - Intronic
1068630203 10:59290261-59290283 CAATTCACCAGTCCCAGAGCAGG + Intronic
1068819682 10:61359991-61360013 CACTGCCCCACCTCCTGACCTGG + Intergenic
1068969111 10:62944712-62944734 CAATGACACAGCCCCTAAGGGGG - Intergenic
1069603965 10:69728389-69728411 CAGTGCCCCAGGCTCTGTGCTGG - Intergenic
1069778459 10:70940454-70940476 CTGTGCTCCAGCCCTTGAGCTGG + Intergenic
1070595829 10:77832510-77832532 CACTGCCCCAGCCCCTCCCCAGG + Intronic
1072597059 10:96883319-96883341 CACTGCCCCAGCCTGTGTGCAGG + Intronic
1072734023 10:97867138-97867160 AAGAGCCCCAGCCCCTGGGCAGG - Exonic
1073132119 10:101196331-101196353 CACAGCCCCAGCCCCTGACAGGG + Intergenic
1073145172 10:101275914-101275936 CATTTCTCCAGCCCCAGAGCAGG - Intergenic
1074711050 10:116177838-116177860 AAGTGTCCCAGCACCTGAGCTGG + Intronic
1075345981 10:121682170-121682192 AAATGCCCCAGCTCGAGAGCAGG + Intergenic
1076497116 10:130904584-130904606 CCAAGCCCCTGCCCCTGAGTCGG + Intergenic
1076791373 10:132778721-132778743 CACTGTCCCAGGCCCAGAGCAGG + Intronic
1076843133 10:133056372-133056394 CCAGGCCCCAGCACCTGTGCTGG + Intergenic
1077168189 11:1153085-1153107 CCCTGCCTCAGCCCCTGAGAAGG - Intergenic
1077502760 11:2916761-2916783 CATTGCCCCAGCATCTGGGCAGG - Intronic
1078143417 11:8707564-8707586 CATTTCCCCAGCTCCTGTGCTGG - Intronic
1078564340 11:12401530-12401552 CAATGCCACAGACACTGGGCTGG - Intronic
1081993640 11:47350526-47350548 CCCGGCCCCAGCCGCTGAGCTGG - Exonic
1083271929 11:61577070-61577092 CTATGCCCCAGCCCTCAAGCGGG + Intronic
1084211838 11:67628018-67628040 CAGACCCTCAGCCCCTGAGCAGG + Exonic
1084793793 11:71491086-71491108 GAATGGTCCTGCCCCTGAGCTGG + Intronic
1084981304 11:72830139-72830161 CAAAGCCCCAGGCCCAGATCTGG - Intronic
1085016497 11:73177490-73177512 CACAGGCCCAGCCCCTGGGCTGG - Intergenic
1085051347 11:73381788-73381810 CCATGTCCCAGCCCCTGTACAGG - Intronic
1087161989 11:94958170-94958192 AGATGCCCCAGTTCCTGAGCTGG - Intergenic
1089366222 11:117922704-117922726 CTGTGCACCTGCCCCTGAGCAGG - Intronic
1090561646 11:127938873-127938895 CAATGCTCAAGCCCCTGGGTTGG - Intergenic
1092525152 12:9305335-9305357 CACTGCCCCAGCCCCTGAGCAGG + Intergenic
1092542115 12:9426480-9426502 CACTGCCCCAGCCCCTGAGCAGG - Intergenic
1094510897 12:31095953-31095975 CACTGCCCCAGCCCCTGAGCAGG + Intronic
1094523982 12:31219751-31219773 CCCAGCCCCAGCCCCTGTGCAGG + Intergenic
1095092617 12:38121235-38121257 GAATGCCCCTGCACCTGTGCAGG - Intergenic
1095952657 12:47790177-47790199 CCATGCCCCCTCCCCTGACCGGG - Intronic
1096025275 12:48355435-48355457 CAATGCTCTAGCCCCTCATCAGG - Intergenic
1103447223 12:121002115-121002137 CAAGGCCCGAGCAGCTGAGCAGG + Exonic
1106024384 13:25943006-25943028 CAATGCCCAAGACTCTCAGCGGG - Intronic
1106033385 13:26022664-26022686 AAATGACACAGCCCCTGAGTTGG - Exonic
1110226198 13:73122262-73122284 CACTGCCCCACCCCCTGAGGTGG + Intergenic
1112046092 13:95599991-95600013 GAATGCCCTAGCCCCACAGCTGG + Intronic
1112711844 13:102138352-102138374 CAATGCCTCAGCCACCGAGGAGG + Intronic
1112711886 13:102138644-102138666 CAATGCCTCAGCCACCGAGGAGG + Intronic
1113682514 13:112254258-112254280 CCACGCCCCAGTGCCTGAGCCGG - Intergenic
1113773420 13:112927585-112927607 CAATTCCACAGCCTCTGATCAGG + Intronic
1113848067 13:113403659-113403681 CAATGCTCTTGCCCCTGAGGGGG + Intergenic
1114806784 14:25846881-25846903 CCATTCCCCAGCCCCTCAGCAGG + Intergenic
1118356375 14:65017241-65017263 CAATCCCCAGGCCCCCGAGCTGG - Intronic
1118711822 14:68525744-68525766 AAATCCCCCAGACCCTGTGCTGG - Intronic
1119027473 14:71165518-71165540 CATGGCCGCAGCCCCTGTGCTGG + Intergenic
1119520193 14:75279258-75279280 CAAGTCCCGAGCCCCCGAGCCGG - Intronic
1121492052 14:94368056-94368078 CAAGGCCCCAGCCTCTGAGGAGG - Intergenic
1122159677 14:99774049-99774071 CAGTACCCCAGCCCCTCAGAAGG - Intronic
1122324598 14:100874866-100874888 CACAGCCCCAGCCCCTCAGTGGG - Intergenic
1122994234 14:105253988-105254010 GAGTGCCCCAGCCCCTGTGCTGG + Intronic
1123112707 14:105880662-105880684 CAAAGCACCCGCCCCTCAGCAGG + Intergenic
1202930332 14_KI270725v1_random:28939-28961 CAATGACCCTGGCCCTGAACTGG + Intergenic
1123583371 15:21736596-21736618 ACAGGCCCCAGCCCCAGAGCAGG - Intergenic
1123620021 15:22179193-22179215 ACAGGCCCCAGCCCCAGAGCAGG - Intergenic
1125402705 15:39321197-39321219 AAATGGCCCAGCCTCTGTGCTGG - Intergenic
1125428860 15:39576520-39576542 CAATGCCCCTGCCCCTTCACTGG + Intergenic
1128344935 15:66847759-66847781 CACTGCCCCAGGCCCAGAGTGGG + Intergenic
1128355458 15:66923428-66923450 CACAGCCCCAGCCCCAGAGATGG - Intergenic
1129169249 15:73797817-73797839 CACTCCCCCAGCCCCTGACCCGG - Intergenic
1129666331 15:77581642-77581664 TAACGCCCCAGCCCCTGCCCCGG + Intergenic
1130069409 15:80633991-80634013 CATTGCCACTGCACCTGAGCAGG + Intergenic
1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG + Intergenic
1131619202 15:94049210-94049232 TAAAGCCCCAGACCCTGTGCTGG + Intergenic
1132027397 15:98415210-98415232 CACTGCCCCAGACTCTGATCAGG + Intergenic
1132391098 15:101438833-101438855 CAAGTCCGCAGCCTCTGAGCAGG + Intronic
1132789346 16:1676856-1676878 CAACACCCCACTCCCTGAGCTGG - Exonic
1132859831 16:2064691-2064713 CAAAGCCCCAGCCCCAGGTCTGG - Intronic
1133281008 16:4665225-4665247 CCAAGCCCCAGCCCCTGCTCAGG - Intronic
1134131205 16:11651380-11651402 CAAAGCCCCAGCCCCAGCTCAGG + Intergenic
1134748985 16:16610851-16610873 CCATGCTCCAGCCCCTGGGCTGG - Intergenic
1134802514 16:17098661-17098683 CACTGCCCCGTCCCCTTAGCAGG - Intergenic
1134996478 16:18742778-18742800 CCATGCTCCAGCCCCTGGGCTGG + Intergenic
1135742282 16:24986173-24986195 CTATGCCCCAGACACTGGGCTGG + Intronic
1139577630 16:67852075-67852097 CAATGCTCCAGCTTCAGAGCTGG - Intronic
1139910814 16:70396386-70396408 CAATCTCCCATCCCCTGAGCAGG - Intronic
1139962989 16:70728574-70728596 CAGAGCCTCAGGCCCTGAGCGGG + Intronic
1141701193 16:85642871-85642893 CAAAGCCACAGGCCCTGACCAGG - Intronic
1141869628 16:86775790-86775812 CAAATGCTCAGCCCCTGAGCCGG - Intergenic
1142264158 16:89055912-89055934 CAAAGCCCCATCCCCAGAGCAGG + Intergenic
1142422729 16:89982378-89982400 CAAAGCCCCAGCCGCTGTCCAGG - Intergenic
1144520148 17:15947703-15947725 CCAGGCACCAGCCCCTGAGAGGG - Intronic
1147967395 17:44200339-44200361 CGCTGCCCCCGCCCCCGAGCCGG - Intergenic
1148225295 17:45894830-45894852 CCTGGCCCCAGCCCCCGAGCAGG - Intronic
1148632244 17:49120176-49120198 CTATGAGCCAGCCCCTGTGCTGG + Intergenic
1148783237 17:50133235-50133257 AATAGCCCCAGCCCCTGTGCTGG - Intergenic
1148810521 17:50287748-50287770 CATAGTCCCAGCCCCTGAGCTGG - Intergenic
1148818525 17:50347004-50347026 CAGAGCCCCAGCCGCAGAGCAGG + Intronic
1152299034 17:79484768-79484790 CACTGCACCAGGCCCTGGGCAGG + Intronic
1152309056 17:79538050-79538072 CTCTGCCCCAACCCCTGTGCTGG - Intergenic
1152424882 17:80213580-80213602 GAAGGCCCCAGCCCAGGAGCAGG + Intronic
1153025660 18:670153-670175 CCATTCCTCAGCCCCAGAGCTGG + Intronic
1153544135 18:6188727-6188749 CGAAACCCCAGACCCTGAGCTGG + Intronic
1157146361 18:45166857-45166879 CTATGCCCCTGTCCCTGAGCTGG + Intergenic
1157502948 18:48203662-48203684 CACTGCCCCACCCCCTGGGTTGG + Intronic
1158507831 18:58062311-58062333 CAAAGCACCACCACCTGAGCCGG - Intronic
1158879045 18:61758857-61758879 CACTGCCCCAGCCTCTGGGTAGG - Intergenic
1160697669 19:492412-492434 CACTGCCCCAGCCCCTCACCAGG + Intronic
1163255364 19:16152968-16152990 CAAGTCCCCAGCCCTTGGGCCGG - Intronic
1163303573 19:16463106-16463128 TGGTGCCCCAGCCCCAGAGCTGG + Intronic
1164438546 19:28253397-28253419 CCATGCCCCAGCCCCAGGGGTGG + Intergenic
1164782135 19:30901349-30901371 CAATGACCCAGACCTTGAGGAGG - Intergenic
1165039380 19:33058309-33058331 GAATGCCCCAGAACCTGAGGAGG + Intronic
1165315572 19:35053425-35053447 CCCTGCCCCAACCCCAGAGCAGG + Intronic
1165315660 19:35053881-35053903 CCCTGCCCCAACCCCAGAGCAGG + Intronic
1165902406 19:39174909-39174931 CACTGACCCAGCCCCTGCACAGG + Exonic
925266843 2:2571673-2571695 CACTGCCCCCGGCCCTGATCTGG + Intergenic
925309700 2:2873863-2873885 CCAGGCCCCAGGCCCAGAGCTGG - Intergenic
926968894 2:18446204-18446226 CAATGCAACAGTCACTGAGCTGG - Intergenic
927148078 2:20179931-20179953 CACTGGGCCAGCCCCTGAGTCGG - Intergenic
928254783 2:29712749-29712771 AAAAGCACCAGCCCCTGAACTGG + Intronic
933722500 2:85407248-85407270 CAGTGCCCAAGCCCCTGGTCTGG + Intronic
933760522 2:85668852-85668874 CTATGCCCCAGCCCCTACCCTGG - Intergenic
937098395 2:119250487-119250509 CAAAGCACCAGCCCCTTGGCAGG + Intronic
937274299 2:120674264-120674286 CACTGTCTCAGCCCCTGACCAGG + Intergenic
940954481 2:159712645-159712667 CATTACCCCGGCTCCTGAGCCGG - Intronic
944298101 2:198090864-198090886 CAATTGCCCAGCCCCAGACCAGG - Intronic
945229855 2:207575354-207575376 CAATGCAGCAGCCACTCAGCCGG + Exonic
948094893 2:235325540-235325562 CATTGCCCCAGCCCCTATCCCGG + Intergenic
948139378 2:235661457-235661479 CACTGCCCCATCCCCTCAGTAGG - Intronic
948542174 2:238698907-238698929 CATTGCACCAGCCACTGACCAGG - Intergenic
948675495 2:239594363-239594385 CCAAGCCCCAGCCTCTGATCTGG - Intergenic
948793619 2:240391464-240391486 CAAGGCCCCGGGCCCTGGGCTGG - Intergenic
949014833 2:241702967-241702989 CACTGTCTCAGCCCCTGGGCGGG - Intronic
1168805011 20:667332-667354 AAATGTGCCAGCCACTGAGCTGG - Intronic
1169417897 20:5433192-5433214 CACTGCCCCACTCCCTGGGCTGG + Intergenic
1169846564 20:9999683-9999705 AAATGCTCCAGGCCCTGAGAAGG + Intronic
1170550917 20:17475189-17475211 CAATGCTCCTGCCCCCAAGCGGG - Intronic
1171819126 20:29817273-29817295 CTATGCCCTAGCCCCAGAGGTGG - Intergenic
1172213200 20:33215395-33215417 CCAGTCCCCAGCCCCTGAGCAGG + Intergenic
1172626741 20:36351801-36351823 CTATGCCCCAGACACTGTGCTGG + Intronic
1173383994 20:42571842-42571864 GAATGCCCCAGCCCCTTCACTGG + Intronic
1173405140 20:42757907-42757929 CTATGTGCCAGCCCCTGAGCTGG + Intronic
1174174376 20:48635782-48635804 CGATGTGCCAGGCCCTGAGCTGG - Intronic
1174398249 20:50261102-50261124 TAAAGCCCCAGCCCCTCAGCCGG + Intergenic
1175743526 20:61437007-61437029 CCATGTCCCAGGCCCTGCGCTGG - Intronic
1175779835 20:61675455-61675477 CAAAGCCTCAGCCCCTGCGATGG - Intronic
1175779900 20:61675766-61675788 CAAAGCCTCAGCCCCTGCGATGG - Intronic
1175779911 20:61675818-61675840 CAAAGCCTCAGCCCCTGCGATGG - Intronic
1175946521 20:62561455-62561477 TAGGGCCCCAGCCCCTGCGCTGG - Intronic
1175960925 20:62636022-62636044 CCATGCCCCAGCCCCTCCTCAGG - Intergenic
1176181108 20:63749944-63749966 CAGTGCCCCAGAGCCTGGGCGGG - Intronic
1179280209 21:39927577-39927599 AAAAGCCCCAGCCAGTGAGCAGG - Intronic
1179805253 21:43833122-43833144 CACTGCCCCTGACCCTGTGCAGG - Intergenic
1179818441 21:43922693-43922715 CTGAGCCACAGCCCCTGAGCTGG - Intronic
1179960130 21:44763525-44763547 CATGGCCCCAGCCTCTGTGCGGG - Intergenic
1179984713 21:44913993-44914015 CCCCACCCCAGCCCCTGAGCTGG + Intronic
1180001121 21:44996008-44996030 CAAGGCCCCAGCTCCAGTGCAGG + Intergenic
1180802131 22:18636868-18636890 CAAACCCCCCGCCCCTGAGCCGG + Intergenic
1180844383 22:18973332-18973354 CAGGGCCCCAGCCCCTGTGGGGG - Intergenic
1180853369 22:19032420-19032442 CAAACCCCCCGCCCCTGAGCCGG + Intergenic
1180996293 22:19967315-19967337 CAATGGCCTAGGCCTTGAGCAGG - Intronic
1181034089 22:20161645-20161667 CAATGCTGCAGCCCCTGCCCTGG + Intergenic
1181096900 22:20511581-20511603 CAATGCCCCAGAGCATGAGCTGG + Intronic
1181219591 22:21358391-21358413 CAAACCCCCCGCCCCTGAGCCGG - Intergenic
1181489974 22:23255651-23255673 CAGTGCCCCAGTCCCTGTCCGGG + Intronic
1181625337 22:24119034-24119056 CCATACCCCAGCCCCAGAGGTGG + Intronic
1181784586 22:25217795-25217817 ACATGCCCCAGCCCCCTAGCTGG - Intergenic
1182301073 22:29337464-29337486 CACCTCCCCACCCCCTGAGCTGG - Intronic
1183723954 22:39578242-39578264 CCCTGCCCCTGCCTCTGAGCAGG + Intronic
1183948242 22:41338804-41338826 GAAGGCCACAGCCCCAGAGCAGG - Intronic
1184109674 22:42387516-42387538 CAAAGCCCCGGCCCCTGTGAGGG + Intronic
1184171974 22:42765253-42765275 CCATGCCCCAGCCCCCGGCCTGG + Intergenic
1184252397 22:43268173-43268195 CCAAGCCCCAGGCCCAGAGCAGG + Intronic
1184473258 22:44707594-44707616 AGATGCCCCAGACCCAGAGCAGG + Intronic
1185032954 22:48454604-48454626 CAACATCCCAGCCCCAGAGCAGG + Intergenic
1185176395 22:49329703-49329725 TCATGCCTGAGCCCCTGAGCAGG + Intergenic
950000050 3:9649650-9649672 CCAAGCCCCAGCTCCTGAGGCGG - Exonic
952978000 3:38712479-38712501 CAATGCCCCACCCCCTCTGCTGG + Intronic
953392467 3:42541379-42541401 CAATGCCCCAGCCTCTATACAGG + Intergenic
954369790 3:50164110-50164132 GAAAGCCCCAGCCCCTGGCCTGG - Intronic
956074886 3:65494376-65494398 CCATAGCCCAGCACCTGAGCTGG - Intronic
957060775 3:75479641-75479663 ACATGCCCCAGCCCCAGATCAGG - Intergenic
961292603 3:125859760-125859782 ACATGCCCCAGCCCCAGATCAGG + Intergenic
962263587 3:133929895-133929917 CAATCCTCCAGGCCCTGAGCAGG + Intergenic
962744055 3:138384355-138384377 CAATGCCCAAGCCCATCATCAGG - Intronic
967114036 3:186320527-186320549 CAATGAGCCAGGCCCTGGGCTGG - Exonic
968674847 4:1871703-1871725 CGGTCCCCCAGCCCCTGAGCCGG - Intronic
968933719 4:3598096-3598118 CATGGCCTCAGCCCCAGAGCTGG + Intergenic
968941897 4:3643296-3643318 CCATGCCCCAGCAACAGAGCAGG - Intergenic
968956303 4:3721507-3721529 CAGTGCCCCAGGGCCAGAGCAGG + Intergenic
969004676 4:4009705-4009727 ACATGCCCCAGCCCCAGATCAGG - Intergenic
969123202 4:4924697-4924719 CAAGACCCCAGCCCTGGAGCTGG - Intergenic
969809220 4:9635002-9635024 ACATGCCCCAGCCCCAGATCAGG + Intergenic
970172020 4:13299717-13299739 CAATGTCCCAGACACTGTGCTGG - Intergenic
972604978 4:40605355-40605377 CTGTGCTCCAGCCCCAGAGCTGG - Intronic
978702627 4:111667021-111667043 CAATACCACAGCCCTTCAGCTGG + Intergenic
979259880 4:118636049-118636071 CACTGCCTCTGCCCCAGAGCTGG - Intergenic
979986253 4:127319380-127319402 AAATGGCCCAGACCCTCAGCCGG - Intergenic
981299130 4:143167008-143167030 CTATGCCCCACCCCCAGAGGTGG - Intergenic
982067340 4:151665940-151665962 CGCTGGCGCAGCCCCTGAGCTGG + Intergenic
982071707 4:151701277-151701299 CACTGCCCCATCTGCTGAGCCGG + Intronic
983524130 4:168743170-168743192 CCTTGCCCCAGCCCCTGCCCTGG + Intronic
985546809 5:514065-514087 CAAGGCCCCAGCCCCGGCTCGGG + Intronic
985640672 5:1062128-1062150 CAGCTCCCCAGCTCCTGAGCAGG - Intronic
986419522 5:7564703-7564725 CAAAGCCCAAGGCCCTTAGCAGG - Intronic
988894983 5:35663108-35663130 CAATGACCCTGCTCCTGAGAAGG - Intronic
989066790 5:37471168-37471190 CACTGCACCAGCCCATTAGCAGG + Intronic
992649348 5:78842455-78842477 GCATGCCCCAGACCCTGCGCAGG + Intronic
993511061 5:88771939-88771961 TCATGCCCCAGACTCTGAGCAGG - Intronic
997358655 5:133280548-133280570 CAAGTCCCCAGCCCCAAAGCAGG + Intronic
998348581 5:141485965-141485987 CAATGCCTCAGACCCGGACCTGG + Exonic
999202618 5:149826849-149826871 CTCGGCCCCAGCCCCTGAGGTGG + Exonic
999678297 5:154029528-154029550 AAATGCCCCAGCCACTGGGGAGG + Exonic
1002073187 5:176692821-176692843 CACACCCCCAGCTCCTGAGCAGG + Intergenic
1002185464 5:177452762-177452784 TAATGCCCCACCTGCTGAGCTGG + Intronic
1002778021 6:344940-344962 CAATGCCCCAGCAGCACAGCAGG - Intronic
1003325598 6:5087606-5087628 CCATCCCCCATCCCCTGCGCTGG - Exonic
1003405536 6:5824364-5824386 CAATGACCATGCCCCAGAGCAGG + Intergenic
1005913082 6:30327368-30327390 CAATGCCCCAGCCCCAGATCTGG + Intronic
1005993349 6:30917032-30917054 CAATGCCTGGGTCCCTGAGCAGG + Intronic
1006435029 6:34021639-34021661 CAATGTCCCTGCCCCTTACCTGG + Intronic
1006579995 6:35071675-35071697 CAGAGCCACACCCCCTGAGCTGG + Intronic
1008707516 6:54181294-54181316 CACCGCCCCAGCCCATGTGCTGG - Intronic
1014826202 6:126051032-126051054 CCACGCCCCAGCCCCAGGGCAGG - Intergenic
1015795008 6:137002595-137002617 CAACGCCCCAGCCCCAGCCCTGG - Intronic
1018170633 6:161140553-161140575 CTGAGCCCCAGTCCCTGAGCGGG - Intronic
1019451972 7:1103757-1103779 CATCTCCCCAGCCCCTGAGACGG + Intronic
1019596226 7:1859659-1859681 CACAGCCCCAGCCCCTCAGCTGG + Intronic
1019710079 7:2514148-2514170 CCAGGCCCCAGGCCCTGTGCGGG + Intronic
1022766881 7:33423158-33423180 TAATGTCTCAGCCCCTCAGCAGG - Intronic
1023541879 7:41274685-41274707 CAAGACCCCAGCCCCTCAGTGGG + Intergenic
1023815444 7:43946098-43946120 CTTTGCCCCAGCCCCTGCGTTGG + Intronic
1024242275 7:47444884-47444906 GGAGGCCCCAGCACCTGAGCTGG + Intronic
1024260943 7:47573382-47573404 CAATGCCCCAGCGACCTAGCGGG - Intronic
1025177212 7:56808047-56808069 CACTGCCTCTGCCCCAGAGCTGG + Intergenic
1025694580 7:63768339-63768361 CACTGCCTCTGCCCCAGAGCTGG - Intergenic
1026891534 7:73985548-73985570 AACTGCCCCAGGCCCTGACCAGG - Intergenic
1026946726 7:74320925-74320947 CCATGCCCCAGCCCCAGGGTTGG - Intronic
1028621462 7:92833449-92833471 CAGCGCCCGAGCGCCTGAGCCGG - Exonic
1029286430 7:99468890-99468912 CAATGCCCGATCCCCTGGGGTGG + Intergenic
1031979094 7:128112840-128112862 CAAAGCCCCAGCCAATAAGCAGG + Intergenic
1032784936 7:135193477-135193499 TAATGCCCCATCTCCTGTGCAGG - Intronic
1033282819 7:140017844-140017866 CCCTGCCCCTGCCTCTGAGCAGG - Intronic
1034765946 7:153721461-153721483 CTTTGCCCCAGACCCTGAGATGG + Intergenic
1036172606 8:6503830-6503852 CACTCCCACAGCCCCTGTGCTGG - Intronic
1037755816 8:21709569-21709591 CACTACCCCGGCCCCTTAGCTGG - Intronic
1037826363 8:22162901-22162923 CAAGGCCCCTGCCCCGCAGCAGG + Intronic
1038349205 8:26761018-26761040 CAGTACTCCAGCCCCTAAGCAGG - Intronic
1038781100 8:30569011-30569033 CAATGCCCCAGCCCCTGAGCAGG - Intronic
1041143609 8:54847780-54847802 CACTGCCCCAGAGCCTGAGCTGG - Intergenic
1041302719 8:56429646-56429668 CTATGCCCCACCCCCAGAGGTGG - Intergenic
1042745604 8:72102763-72102785 CAATACCCCAGACCCTGACAGGG - Intronic
1046638456 8:116699102-116699124 CCATGCCCCAGCAACAGAGCTGG + Intronic
1047505265 8:125474692-125474714 CTACGCTCCAGCCCCTGAGCTGG + Intergenic
1048276034 8:133066862-133066884 CAACCCCCCAGCCCCTGCACGGG - Intronic
1048450991 8:134533881-134533903 CCATGCCACAGCCCCTGGTCAGG + Intronic
1049346585 8:142142476-142142498 CCCAGCCCCAGCCCCTCAGCAGG - Intergenic
1052846839 9:33344303-33344325 CAGAGAACCAGCCCCTGAGCCGG - Intronic
1053458491 9:38250328-38250350 CCAAGCCTCAGACCCTGAGCAGG - Intergenic
1053530676 9:38878462-38878484 CAATGTCCCAGACCCTCAGTGGG - Intergenic
1053576959 9:39363534-39363556 CAAGGGCCCAGCAGCTGAGCTGG + Intergenic
1054098529 9:60922224-60922246 CAAGGGCCCAGCAGCTGAGCTGG + Intergenic
1054119928 9:61197853-61197875 CAAGGGCCCAGCAGCTGAGCTGG + Intergenic
1054202900 9:62102895-62102917 CAATGTCCCAGACCCTCAGTGGG - Intergenic
1054456427 9:65433720-65433742 CATGGCCTCAGCCCCAGAGCTGG - Intergenic
1054587828 9:66984709-66984731 CAAGGGCCCAGCAGCTGAGCTGG - Intergenic
1054635463 9:67485470-67485492 CAATGTCCCAGACCCTCAGTGGG + Intergenic
1056580828 9:87887247-87887269 CGCTGCCCCACCGCCTGAGCAGG + Exonic
1056778557 9:89532402-89532424 CAAGACCCCAGCCACTCAGCTGG - Intergenic
1056833072 9:89932151-89932173 CAGTCCCCCAGCTCCAGAGCAGG - Intergenic
1057742691 9:97726011-97726033 CTAGCCCCCAGCCCCTGACCAGG - Intergenic
1060776153 9:126376455-126376477 CAGGGCTCCAGCCCATGAGCTGG - Intronic
1061419589 9:130466130-130466152 CCAGGCCCCTGCCTCTGAGCAGG - Intronic
1062367551 9:136218465-136218487 CACCGCCCCAGCCCCAGTGCTGG + Intronic
1062590630 9:137272941-137272963 CATGGCCCCAGCACCCGAGCAGG - Exonic
1203622398 Un_KI270749v1:136368-136390 CAATGACCCTGGCCCTGAACTGG + Intergenic
1185644655 X:1608444-1608466 GGATGCCCCAGCTCCTGGGCAGG - Intergenic
1186076762 X:5887886-5887908 CACTGTCCCAGGCCCTGTGCTGG - Intronic
1186543243 X:10422444-10422466 CAATGTCCCAGCCACTGTGCAGG - Intergenic
1192263766 X:69524836-69524858 CAATTCCTCAGCCCCACAGCCGG - Intronic
1192588391 X:72339282-72339304 CAATGGCCTAGGCCCTGTGCTGG + Intronic
1192784916 X:74326007-74326029 CCCCGCCCCGGCCCCTGAGCAGG + Intergenic
1195095059 X:101493895-101493917 CTCTTCCCCAGCCCCTGATCTGG - Exonic
1196334778 X:114518827-114518849 CAGTGCCCCACCCCCAGAACTGG + Intergenic
1201263323 Y:12181386-12181408 CAATGCCCCACCCCCAGAGGTGG - Intergenic
1201518518 Y:14846080-14846102 CACTGCCTCAGGCCCTGTGCTGG + Intergenic