ID: 1038781103

View in Genome Browser
Species Human (GRCh38)
Location 8:30569024-30569046
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781086_1038781103 24 Left 1038781086 8:30568977-30568999 CCCTTCAGATTAGCCCTCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781095_1038781103 -2 Left 1038781095 8:30569003-30569025 CCATTCCGCCTGCTCAGGGGCTG 0: 1
1: 1
2: 1
3: 21
4: 253
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781089_1038781103 11 Left 1038781089 8:30568990-30569012 CCCTCCTAGGCAGCCATTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781091_1038781103 7 Left 1038781091 8:30568994-30569016 CCTAGGCAGCCATTCCGCCTGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781090_1038781103 10 Left 1038781090 8:30568991-30569013 CCTCCTAGGCAGCCATTCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781085_1038781103 30 Left 1038781085 8:30568971-30568993 CCTTCTCCCTTCAGATTAGCCCT 0: 1
1: 0
2: 1
3: 11
4: 214
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781088_1038781103 23 Left 1038781088 8:30568978-30569000 CCTTCAGATTAGCCCTCCTAGGC 0: 1
1: 0
2: 0
3: 5
4: 142
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781100_1038781103 -10 Left 1038781100 8:30569011-30569033 CCTGCTCAGGGGCTGGGGCATTG 0: 1
1: 3
2: 1
3: 28
4: 273
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data
1038781099_1038781103 -7 Left 1038781099 8:30569008-30569030 CCGCCTGCTCAGGGGCTGGGGCA 0: 1
1: 0
2: 11
3: 155
4: 1345
Right 1038781103 8:30569024-30569046 TGGGGCATTGGGAAGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr