ID: 1038781261

View in Genome Browser
Species Human (GRCh38)
Location 8:30569964-30569986
Sequence CTGGCTTGCCCCTGCTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038781249_1038781261 29 Left 1038781249 8:30569912-30569934 CCCGTCACAGAGAAGGTCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG No data
1038781258_1038781261 -4 Left 1038781258 8:30569945-30569967 CCACTGTGGAAAGCTCTGCCTGG 0: 1
1: 1
2: 4
3: 26
4: 246
Right 1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG No data
1038781256_1038781261 3 Left 1038781256 8:30569938-30569960 CCAGGGCCCACTGTGGAAAGCTC 0: 1
1: 0
2: 2
3: 25
4: 177
Right 1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG No data
1038781254_1038781261 12 Left 1038781254 8:30569929-30569951 CCAGGGTGTCCAGGGCCCACTGT 0: 1
1: 0
2: 1
3: 26
4: 247
Right 1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG No data
1038781257_1038781261 -3 Left 1038781257 8:30569944-30569966 CCCACTGTGGAAAGCTCTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 208
Right 1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG No data
1038781251_1038781261 28 Left 1038781251 8:30569913-30569935 CCGTCACAGAGAAGGTCCAGGGT 0: 1
1: 0
2: 0
3: 20
4: 154
Right 1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038781261 Original CRISPR CTGGCTTGCCCCTGCTCCGC CGG Intronic
No off target data available for this crispr