ID: 1038784319

View in Genome Browser
Species Human (GRCh38)
Location 8:30597173-30597195
Sequence TGCTAGGCCCAGAACTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038784319_1038784321 0 Left 1038784319 8:30597173-30597195 CCACTAAAGTTCTGGGCCTAGCA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1038784321 8:30597196-30597218 CATATTCCTGTCCCTCGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038784319 Original CRISPR TGCTAGGCCCAGAACTTTAG TGG (reversed) Intronic
901798849 1:11695656-11695678 TTCTAGGCCCAGAGCTTTATAGG - Intronic
904568696 1:31444435-31444457 TCCTAGGCTCAGAACCTTATTGG - Intergenic
905371851 1:37486647-37486669 AGCTAGGAGCAGAACTTTAGAGG + Intergenic
906923018 1:50084917-50084939 TGTTAGGCCCAGACCTATAAAGG - Intronic
916144014 1:161723919-161723941 TGCTGGACAGAGAACTTTAGGGG + Intronic
921614419 1:217249685-217249707 TGCTTTGCCCAGATCTTTTGAGG - Intergenic
922686910 1:227646892-227646914 TGGTAATTCCAGAACTTTAGTGG + Intronic
923392638 1:233529454-233529476 TGCTGTGCCCAAAAGTTTAGGGG + Intergenic
924234729 1:241991093-241991115 TGCCAGGCCCAGCACTTTTGAGG + Intergenic
924941551 1:248815722-248815744 TGCTAGGCCCTGGGCTATAGGGG - Intronic
1069504665 10:68987089-68987111 TGGTAATCCCAGCACTTTAGGGG + Intergenic
1071967470 10:90867112-90867134 TGCTAAACCTAGAACTCTAGTGG - Intergenic
1077244712 11:1530894-1530916 TGTTAGGCCCAGAAGTTTCAGGG + Intergenic
1083157742 11:60835550-60835572 TGCAAGGCTTAGAGCTTTAGAGG + Intergenic
1088847759 11:113682210-113682232 TCCTAGGCCCAGAACTTCTCTGG - Intergenic
1089594962 11:119572809-119572831 TGATAGTCTCAGAACTTTGGAGG + Intergenic
1092968569 12:13669677-13669699 TGCTAGGCACAGAGGTATAGTGG + Intronic
1105377013 13:19855096-19855118 TGCTAATCCCAGCACTTTTGGGG + Intronic
1107985279 13:45770596-45770618 TGCGAGGGACTGAACTTTAGTGG - Intergenic
1110266544 13:73543711-73543733 TGTTGGGCCCAGAATTTTAAAGG + Intergenic
1118730093 14:68659807-68659829 TCCTTGCCCCAGAACTTTTGGGG - Intronic
1128858963 15:71048786-71048808 TGCCAGACCCAGAAGTTGAGTGG + Intronic
1129184202 15:73895921-73895943 TGCTAGGCACTGAACTTTGTGGG + Intergenic
1130795836 15:87208539-87208561 GGCTGGGCCCAGAACACTAGAGG + Intergenic
1131437432 15:92434600-92434622 TTCTAAGCCCAGAACCTCAGCGG - Intronic
1133461999 16:5994808-5994830 TGCTAGGCCCTGAAATATAGTGG - Intergenic
1137055313 16:35743230-35743252 GCCTTGGGCCAGAACTTTAGGGG + Intergenic
1141077295 16:81018907-81018929 TTCTAGGCTCAGAGCTTTAAAGG + Intronic
1141221513 16:82073479-82073501 AGATATGCCCAGAACTTTGGGGG - Intronic
1143903682 17:10193563-10193585 TTCTGGGCCCAGACCTTAAGAGG + Intronic
1144839109 17:18174789-18174811 TGCTGGGCCCAGACCTGGAGGGG - Intronic
1145296149 17:21593788-21593810 TGCTTGGCCTTGAACTTTTGTGG - Intergenic
1145367640 17:22278274-22278296 TGCTTGGCCTTGAACTTTTGTGG + Intergenic
1146357614 17:32147367-32147389 TGCTAATCCCAGCACTTGAGAGG + Intronic
1148398131 17:47326674-47326696 TGCTATGCACAGTAGTTTAGAGG + Intronic
1148979695 17:51561789-51561811 TTCTTTGCCCAGAACTTTAGGGG + Intergenic
1152503192 17:80726742-80726764 CGCTAAGCCCAGAACATTATAGG + Intronic
1162849927 19:13423175-13423197 TGCTGGCCACAGGACTTTAGGGG + Intronic
1163872511 19:19834141-19834163 CGGTAAGCCCAGAAATTTAGTGG + Intergenic
1164129619 19:22349855-22349877 TGCTGGGCCCAGCACTCAAGTGG + Intergenic
1164169928 19:22716174-22716196 TGCTGGGCCCAGCACTCAAGTGG - Intergenic
1166712678 19:44947471-44947493 TGCTGGGCCCAGAACTGTTTAGG + Intronic
926473435 2:13291079-13291101 TGCTAGGCACTGAACTTCTGAGG + Intergenic
928131399 2:28654044-28654066 TGCTAACTCCACAACTTTAGAGG + Intergenic
928422028 2:31144796-31144818 TGCTAAGCCCAGAAGTTTCTAGG + Intronic
937425258 2:121793745-121793767 TTCTTGGCCCAGACCTTCAGAGG + Intergenic
937982752 2:127624812-127624834 TGCTGCCCCCAGAACTTCAGGGG - Intronic
938878340 2:135557463-135557485 TGCCAGGTCCAGAAGTTAAGAGG + Intronic
939186109 2:138862659-138862681 TGCTAGGAAGAGAACTATAGTGG - Intergenic
940700731 2:157039570-157039592 TGCCTGTCCCAGCACTTTAGGGG + Intergenic
942598729 2:177618582-177618604 TGCTGGGCCGAGAACTGCAGCGG - Exonic
943406413 2:187493263-187493285 AGCTAGGGCCAGAGCTTCAGAGG - Intronic
1172755166 20:37278677-37278699 TTCTAAGCCCAGCACTTTGGGGG + Intergenic
1173502037 20:43561031-43561053 TGGTTGGCCCAGGACTATAGCGG + Intronic
1182495873 22:30707047-30707069 CCCTAGGCCCAGCACTCTAGAGG - Intronic
951599370 3:24356312-24356334 TCCTAGACCCAAGACTTTAGTGG + Intronic
957855428 3:85870347-85870369 TGCTAGGCTCAAGACTTTGGTGG - Intronic
958028324 3:88075390-88075412 TGATAGGCCTAGAACTTTCAAGG - Intronic
959973243 3:112430195-112430217 TTCAAGGCCCAGAACTTCAGAGG + Intergenic
963376305 3:144470039-144470061 TGCTACTCCCATAACTTTATTGG + Intergenic
964610117 3:158604309-158604331 TGTTAGGGCCAGAAATTTATAGG - Intronic
974800491 4:66811756-66811778 CGGTAGTCCCAGCACTTTAGAGG + Intergenic
979226438 4:118291145-118291167 TTCAAGGCTCAAAACTTTAGTGG + Intronic
980160785 4:129159506-129159528 TCCTTTTCCCAGAACTTTAGAGG - Intergenic
987377277 5:17247633-17247655 TGCTGGGCCAGGAACTTTATAGG - Intronic
998857860 5:146411284-146411306 CTCTAGGCCCACAAATTTAGGGG - Intergenic
1006256570 6:32837488-32837510 TGCTAGCCCCAAATCTTTATAGG - Intronic
1007514228 6:42398635-42398657 TGCCAGGCCCAGAAGGTTTGGGG - Intronic
1007900446 6:45406661-45406683 TGCTAACCCCAGCACTTTGGGGG - Intronic
1009817856 6:68759015-68759037 TGGTAGGCCATGAACTCTAGAGG + Intronic
1013760891 6:113516181-113516203 GGTTAGACCCAGAAATTTAGAGG - Intergenic
1015988866 6:138914397-138914419 TGCTAGACCCAGGACATTAATGG + Intronic
1016593257 6:145769549-145769571 TGCTAATCCCAGCACTTTGGGGG + Intergenic
1023958804 7:44909893-44909915 TGCGAGGCAGAGAACTTCAGTGG + Intergenic
1024945049 7:54799878-54799900 TGCCTGACCCTGAACTTTAGAGG + Intergenic
1026570095 7:71521896-71521918 TTCTAGAACCAAAACTTTAGGGG - Intronic
1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG + Intronic
1036651461 8:10646645-10646667 TCCTAGGCCCTGGACTTTAGAGG - Intronic
1038784319 8:30597173-30597195 TGCTAGGCCCAGAACTTTAGTGG - Intronic
1040702267 8:50080845-50080867 TGTAATGCCCAGAACTTGAGTGG - Intronic
1046590873 8:116205199-116205221 TGCTAGAACCAGAATTTTACTGG - Intergenic
1050222484 9:3409139-3409161 TTCTAGGCCAACAACTTTTGGGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1058277238 9:103059697-103059719 TTCTAGGCCCACAACTTAATGGG + Intergenic
1058671565 9:107364788-107364810 TGCTAGACCAGGAACTTTGGAGG - Intergenic
1185984189 X:4811992-4812014 CTCTAGTCCCAGCACTTTAGAGG - Intergenic
1187965087 X:24603828-24603850 TGATAGACACAGAATTTTAGAGG + Intronic
1189186430 X:39059412-39059434 TGCTAGGGCCAGAGTTTTAAAGG + Intergenic
1189305399 X:39983204-39983226 TTCTAGGCCTAGACCTTTAGAGG - Intergenic
1195500083 X:105586763-105586785 TGCTTGGCCAAAAACTTGAGAGG + Intronic
1196469939 X:116013077-116013099 TCCTTGGGCCAGAGCTTTAGGGG - Intergenic
1199596940 X:149513434-149513456 TGCTAGGCCCTGTGCTTTAAGGG + Intronic