ID: 1038789709

View in Genome Browser
Species Human (GRCh38)
Location 8:30657862-30657884
Sequence GAGCGTGACCTCCACCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 440}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038789709_1038789715 -3 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789715 8:30657882-30657904 CTCAGCCTCCCGGGAGGCGGCGG 0: 1
1: 1
2: 18
3: 489
4: 13287
1038789709_1038789713 -9 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789713 8:30657876-30657898 GTCACGCTCAGCCTCCCGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 183
1038789709_1038789724 30 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789724 8:30657915-30657937 TCCCAGGGAACAGCAAGCCGGGG 0: 1
1: 0
2: 2
3: 19
4: 175
1038789709_1038789723 29 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789723 8:30657914-30657936 GTCCCAGGGAACAGCAAGCCGGG 0: 1
1: 0
2: 2
3: 23
4: 246
1038789709_1038789722 28 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789722 8:30657913-30657935 CGTCCCAGGGAACAGCAAGCCGG 0: 1
1: 0
2: 0
3: 13
4: 154
1038789709_1038789714 -6 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789714 8:30657879-30657901 ACGCTCAGCCTCCCGGGAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 176
1038789709_1038789720 15 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789720 8:30657900-30657922 GGCGGCGCGCCTGCGTCCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1038789709_1038789719 14 Left 1038789709 8:30657862-30657884 CCCGTGAGGTGGAGGTCACGCTC 0: 1
1: 0
2: 1
3: 18
4: 440
Right 1038789719 8:30657899-30657921 CGGCGGCGCGCCTGCGTCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038789709 Original CRISPR GAGCGTGACCTCCACCTCAC GGG (reversed) Intronic
900165014 1:1241067-1241089 GAGCGTGGCCTGCACCTTCCTGG - Intergenic
901512987 1:9727127-9727149 GAGCCTGAACTGCACCTAACGGG + Exonic
901577840 1:10215250-10215272 CACCGTAACCTCCACCTCCCAGG + Intronic
901578459 1:10220124-10220146 CACCGTAACCTCCACCTCCCGGG - Intronic
902599236 1:17529906-17529928 CACTGTGACCTCCACCTCCCAGG + Intergenic
903093492 1:20945539-20945561 CACCGTGACCTCCACCTCCCAGG + Intronic
903454627 1:23478682-23478704 CACTGTGACCTCCACCTCCCAGG - Intronic
903482771 1:23666311-23666333 CACCGCAACCTCCACCTCACGGG - Intergenic
903678472 1:25081645-25081667 GATCATGACACCCACCTCACAGG - Intergenic
903910518 1:26721285-26721307 CACTGTGACCTCCACCTCCCAGG + Intronic
903990160 1:27262003-27262025 CAGTGCGACCTCCACCTCCCAGG + Intronic
903997131 1:27314071-27314093 CACTGTGACCTCCACCTCCCAGG - Intergenic
905123981 1:35704111-35704133 GAGTGCAACCTCCACCTCCCGGG - Intergenic
905216116 1:36409053-36409075 CAGTGTAACCTCCACCTCCCAGG + Intergenic
905359940 1:37412304-37412326 GACAGTGACATCCACCTCACTGG - Intergenic
905419886 1:37834135-37834157 CACTGTGACCTCCACCTCCCTGG - Intronic
905563607 1:38946176-38946198 CACCGTAACCTCCACCTCCCAGG + Intergenic
905687143 1:39916563-39916585 TGGCGTGATCTCCACCTCCCGGG + Intergenic
905821178 1:40992767-40992789 CACTGTGACCTCCACCTCCCAGG + Intronic
905958594 1:42023080-42023102 GAGTGCAACCTCCACCTCCCGGG + Intronic
907061820 1:51434745-51434767 CACCGTAACCTCCACCTCCCGGG + Intronic
907294774 1:53443589-53443611 CACTGTGACCTCCACCTCCCAGG + Intergenic
908027889 1:59970689-59970711 GAGTGCAACCTCCACCTCCCAGG - Intergenic
908679618 1:66645914-66645936 GACTGCAACCTCCACCTCACGGG + Intronic
909156618 1:72085892-72085914 CACTGTGACCTCCACCTCCCAGG - Intronic
911387437 1:97194578-97194600 CACTGTGACCTCCACCTCCCGGG + Intronic
912278150 1:108282593-108282615 CACTGTAACCTCCACCTCACAGG - Intergenic
912290076 1:108411764-108411786 CACTGTAACCTCCACCTCACAGG + Intronic
914690019 1:150017526-150017548 CAGCTTAATCTCCACCTCACAGG + Intergenic
914793537 1:150900570-150900592 GACTGTAACCTCCACCTCCCGGG - Intergenic
914812703 1:151040717-151040739 CACCGCAACCTCCACCTCACCGG - Intronic
914853663 1:151334077-151334099 GACTGTAACCTCCACCTCCCAGG + Intergenic
915373428 1:155371470-155371492 TACTGCGACCTCCACCTCACAGG - Intronic
916410075 1:164538457-164538479 CACCATGACCTCCACCTCCCGGG - Intergenic
916540397 1:165748081-165748103 CACCGTAACCTCCACCTCCCGGG - Intronic
917138272 1:171808757-171808779 GAGTGGGACCTCCACCCAACAGG - Intronic
917911376 1:179650323-179650345 CACTGTGACCTCCACCTCTCAGG - Intronic
918000595 1:180490880-180490902 CAACGTAACCTCCACCTCCCAGG - Intronic
924529930 1:244884751-244884773 CATTGTGACCTCCACCTCCCAGG - Intergenic
1063212629 10:3894853-3894875 CACTGTGACCTCCACCTCCCGGG - Intergenic
1063313200 10:4975997-4976019 GAGAGTGACCTCCACACCAGGGG + Intronic
1063314756 10:4991745-4991767 GAGAGTGACCTCCACACCAGGGG - Intronic
1064047633 10:12032216-12032238 CACCGTAACCTCCACCTCCCAGG - Intronic
1064765568 10:18667788-18667810 TGGCGTGATCTCCACCTCCCAGG + Intronic
1065004302 10:21365564-21365586 CACTGTGACCTCCACCTCCCAGG - Intergenic
1065273058 10:24056250-24056272 CACCGTGACCTCCATCTCCCAGG - Intronic
1065385179 10:25126990-25127012 TACCGTAACCTCCACCTCCCAGG + Intergenic
1065676694 10:28183000-28183022 CACCGTAACCTCCACCTCCCAGG - Intronic
1065729171 10:28694885-28694907 CAGTGTAACCTCCACCTCCCGGG + Intergenic
1066068174 10:31777770-31777792 CACTGTGACCTCCACCTCCCAGG + Intergenic
1067208054 10:44236309-44236331 CAGTGTAACCTCCACCTCCCAGG - Intergenic
1067479368 10:46585127-46585149 GTGGCTGACCACCACCTCACTGG - Intronic
1069559764 10:69421112-69421134 GGACGTGAGCCCCACCTCACTGG - Intergenic
1071843690 10:89499476-89499498 CACCGTAACCTCCACCTCCCAGG - Intronic
1072099694 10:92217130-92217152 GACCGTAACCTCCGCCTCCCAGG - Intronic
1072110367 10:92313815-92313837 CACTGTGGCCTCCACCTCACAGG - Intronic
1072123890 10:92428769-92428791 CACTGTGACCTCCACCTCCCAGG - Intergenic
1072782900 10:98262213-98262235 GAGCATCACCTCCACTCCACAGG - Exonic
1075171941 10:120123717-120123739 GACCGCAACCTCCACCTCCCAGG + Intergenic
1075364070 10:121867324-121867346 GAGCTTGACGTCCACTTTACTGG - Intronic
1075467795 10:122664619-122664641 AGGCCTGAGCTCCACCTCACTGG - Intergenic
1077124941 11:929184-929206 GAACTTGACCTCCATGTCACAGG + Intronic
1077145258 11:1041661-1041683 GGGCGGGACCCCCACCTCCCCGG + Intergenic
1077806424 11:5595766-5595788 GAGTGCAACCTCCACCTCCCGGG + Intronic
1078174317 11:8958081-8958103 GACCGTAACCTCCACCTCCCAGG - Intronic
1080468951 11:32526396-32526418 GAGTGCAACCTCCACCTCCCGGG - Intergenic
1081102065 11:39014648-39014670 CACTGTGACCTCCACCTCTCAGG - Intergenic
1083584955 11:63850222-63850244 CACTGTGACCTCCACCTCCCAGG + Intronic
1083784938 11:64939171-64939193 CAGCCTCACCTCCACCTCCCAGG + Intronic
1085018856 11:73192498-73192520 GTGAGTCACCTCCACCTCCCAGG - Intergenic
1085285970 11:75361080-75361102 CTCCGTGACCTCCACCTCCCAGG - Intergenic
1085290765 11:75397688-75397710 CACCGTAACCTCCACCTCCCGGG - Intergenic
1085470523 11:76754492-76754514 CACCATGACCTCCACCTCCCTGG + Intergenic
1085513594 11:77099910-77099932 CACCGTAACCTCCACCTCCCGGG + Intronic
1087106617 11:94415884-94415906 CACCGTGACCTCCAACTCCCAGG + Exonic
1088255446 11:107899306-107899328 CAGTGTAACCTCCACCTCCCCGG + Intronic
1089155476 11:116398844-116398866 GAGAATGCCCTCCACCCCACTGG + Intergenic
1089308588 11:117542956-117542978 GAGAGAGAAGTCCACCTCACGGG - Intronic
1090016813 11:123093420-123093442 CACTGTGACCTCCGCCTCACAGG + Intronic
1091946608 12:4550713-4550735 GACCATGGCCTCCGCCTCACAGG + Intronic
1092858564 12:12698684-12698706 CACTGTGACCTCCACCTCCCGGG + Intergenic
1092881758 12:12892441-12892463 CACCGCGACCTCCACCTCCCGGG + Intronic
1093863853 12:24200983-24201005 GAACCAGACCTCCACCTCCCTGG + Intergenic
1093956892 12:25230550-25230572 CACCGTAACCTCCACCTCCCGGG - Intronic
1094021740 12:25921757-25921779 GAGTGCAACCTCCACCTCCCAGG - Intergenic
1094145816 12:27227366-27227388 GACTGTAACCTCCACCTCCCAGG + Intergenic
1096425178 12:51495549-51495571 CACTGTGACCTCCACCTCCCAGG + Intronic
1099915772 12:88891363-88891385 GATCTTGGCCTCCACCTCCCGGG + Intergenic
1100383853 12:94087253-94087275 CACTGTGACCTCCACCTCCCAGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1100644114 12:96510885-96510907 CACGGTGACCTCCACCTCCCGGG - Intronic
1101378586 12:104192379-104192401 CACGGTGACCTCCACCTCCCAGG - Intergenic
1102139747 12:110604854-110604876 CACTGTGACCTCCACCTCCCAGG - Intergenic
1103437010 12:120934501-120934523 CAACGCAACCTCCACCTCACGGG - Intergenic
1104023411 12:125009049-125009071 CAGTGTAACCTCCACCTCCCAGG + Intronic
1106953519 13:34910591-34910613 GAGTGCAACCTCCACCTCCCAGG + Intergenic
1107078557 13:36349185-36349207 CACGGTGACCTCCACCTCCCGGG - Intronic
1107275047 13:38668578-38668600 CACTGTGACCTCCACCTCCCGGG + Intergenic
1107889709 13:44903617-44903639 GAGCATGACCTCAGCCTCCCAGG + Intergenic
1108508717 13:51136006-51136028 GGGCGTGACCTCCACCCCTAGGG + Intergenic
1109924259 13:69113810-69113832 CACTGTGACCTCCACCTCCCAGG - Intergenic
1110211349 13:72977278-72977300 CAGCGCAACCTCCACCTCCCTGG + Intronic
1110928606 13:81187239-81187261 CGGCGCGACCTCCACCTCCCAGG + Intergenic
1112457176 13:99573653-99573675 CACCGCGACCTCCACCTCCCGGG + Intergenic
1112982369 13:105400852-105400874 GAGCGGGAACTCTACCTTACTGG + Intergenic
1113397878 13:109965531-109965553 CACTGTGACCTCCACCTCCCAGG - Intergenic
1114061906 14:19026179-19026201 GACCTTGTCCTCCACCCCACAGG - Intergenic
1114100357 14:19373822-19373844 GACCATGCCCTCCACCCCACAGG + Intergenic
1114256871 14:21010600-21010622 CACTGTGACCTCCACCTCCCGGG - Intergenic
1114644511 14:24247298-24247320 GAGTGCAACCTCCACCTCCCGGG + Intergenic
1115118156 14:29908367-29908389 CAACGCGACCTCCACCTCCCAGG + Intronic
1115637925 14:35308343-35308365 CACCGTAACCTCCACCTCCCAGG - Intronic
1115845044 14:37521010-37521032 CACTGTGACCTCCACCTCCCAGG + Intronic
1116892432 14:50281914-50281936 CACCGTAACCTCCACCTCCCGGG + Intronic
1118620880 14:67612867-67612889 CACTGTGACCTCCACCTCCCTGG - Intergenic
1119787460 14:77324216-77324238 CACTGTGACCTCCACCTCTCAGG + Intronic
1121000476 14:90448679-90448701 GACTGTAACCTCCACCTCCCGGG + Intergenic
1121064060 14:90944677-90944699 CACCGTAACCTCCACCTCCCGGG - Intronic
1121918536 14:97858517-97858539 CACTGTGACCTCCACCTCCCGGG + Intergenic
1122565916 14:102655875-102655897 GACCGCAACCTCCACCTCCCAGG - Intronic
1122664882 14:103322030-103322052 CAGCGCAACCTCCACCTCCCAGG - Intergenic
1123551407 15:21384383-21384405 GACCTTGCCCTCCACCTTACAGG + Intergenic
1123919202 15:25058671-25058693 GAGCATAAGCTCCTCCTCACGGG - Intergenic
1124028974 15:25991874-25991896 CACCGCGACCTCCACCTCCCAGG + Intergenic
1124249064 15:28095639-28095661 CACCGTCACCTCCACCTCCCTGG - Intronic
1126605601 15:50472832-50472854 GACCGCAACCTCCACCTCCCGGG - Intronic
1126840867 15:52716329-52716351 CACCGTAACCTCCACCTCCCAGG + Intergenic
1127946659 15:63762397-63762419 GACTGTAACCTCCACCTCCCGGG + Intronic
1128123995 15:65177142-65177164 CACCATGACCTCCACCTCCCAGG + Intronic
1128302693 15:66576782-66576804 CACTGTAACCTCCACCTCACAGG + Intergenic
1129123958 15:73421943-73421965 AACCGTAACCTCCACCTCCCGGG - Intergenic
1129673697 15:77621128-77621150 CACTGTGACCTCCACCTCCCAGG + Intronic
1131128539 15:89877717-89877739 CACCGTGACCTCCACCTCTCAGG - Intronic
1132159395 15:99524028-99524050 CACCGTAACCTCCACCTCCCAGG - Intergenic
1202959749 15_KI270727v1_random:111626-111648 GACCTTGCCCTCCACCTTACAGG + Intergenic
1132717376 16:1298539-1298561 TGGCGTGATCTCCACCTCCCGGG + Intergenic
1133508363 16:6433921-6433943 CACCGTAACCTCCACCTCCCGGG + Intronic
1134448063 16:14345721-14345743 GGGCATGACCTCCAGGTCACTGG + Intergenic
1135005177 16:18814648-18814670 CACCGTAACCTCCACCTCCCGGG + Intronic
1135095883 16:19564472-19564494 CACCGTGACCTCCACCTCCCAGG + Intronic
1135735108 16:24924785-24924807 CACTGTGACCTCCACCTCCCAGG - Intronic
1135824779 16:25716976-25716998 CACTGTGACCTCCACCTCCCAGG - Intronic
1135965439 16:27031383-27031405 GACCGCAACCTCCACCTCCCAGG + Intergenic
1136353738 16:29729708-29729730 GAGTGCAACCTCCACCTCCCAGG + Intergenic
1137395822 16:48115590-48115612 GAGCGGGGCCTCAACCTCTCTGG - Exonic
1137407410 16:48200451-48200473 GAGCGGGGCCTCAACCTCTCTGG - Exonic
1137755118 16:50895140-50895162 GAGCCTGACTTCTACATCACAGG - Intergenic
1138532405 16:57641639-57641661 CATCGTAACCTCCACCTCCCGGG + Intronic
1138837684 16:60458541-60458563 GAGTGCAACCTCCACCTCCCAGG + Intergenic
1139233666 16:65311852-65311874 CACCGCGACCTCCACCTCCCGGG + Intergenic
1139592145 16:67939284-67939306 CACAGTGACCTCCACCTCCCAGG + Intergenic
1139727732 16:68915096-68915118 CACTGTGACCTCCACCTCCCGGG - Intronic
1139906657 16:70370918-70370940 CACCGTAACCTCCACCTCCCGGG - Intronic
1139915307 16:70424523-70424545 CACCGCGACCTCCACCTCCCGGG - Intronic
1139947764 16:70653135-70653157 CACCGTAACCTCCACCTCCCAGG - Intronic
1140781607 16:78302034-78302056 GATTGTAACCTCCACCTCCCGGG + Intronic
1141838800 16:86560703-86560725 CAGCGCAACCTCCACCTCCCGGG + Intergenic
1142746867 17:1963805-1963827 GAGCGCAACCTCCACTTCACGGG + Intronic
1143531340 17:7506035-7506057 GATCGCAACCTCCACCTCCCAGG - Intronic
1143538020 17:7553123-7553145 GACCGTAACCTCCACCTCCCGGG + Intronic
1143763947 17:9125300-9125322 GACCGTAACCTCCGCCTCCCGGG + Intronic
1143949618 17:10622185-10622207 CAGTGTAACCTCCACCTCCCAGG - Intergenic
1145773093 17:27507650-27507672 CACCGTAACCTCCACCTCCCGGG + Intronic
1145890280 17:28409316-28409338 CACCGTAACCTCCACCTCCCGGG - Intergenic
1146314663 17:31797584-31797606 CAGCGCAACCTCCACCTCCCGGG + Intergenic
1146523685 17:33547623-33547645 TAGAGTGACCTCCAACCCACTGG + Intronic
1146866977 17:36345878-36345900 CACTGTGACCTCCACCTCCCAGG + Intronic
1147069847 17:37946487-37946509 CACTGTGACCTCCACCTCCCAGG + Intergenic
1147081376 17:38026025-38026047 CACTGTGACCTCCACCTCCCAGG + Intronic
1147097320 17:38149982-38150004 CACTGTGACCTCCACCTCCCAGG + Intergenic
1147933913 17:44000640-44000662 CACCGCGACCTCCACCTCCCAGG + Intronic
1148184651 17:45633389-45633411 CACTGTGACCTCCACCTCCCGGG + Intergenic
1149487681 17:57056065-57056087 CACCGCAACCTCCACCTCACGGG - Intergenic
1150712811 17:67546115-67546137 TGGCATGACCTCCACCTCCCAGG - Intronic
1151533272 17:74721506-74721528 GACTGTAACCTCCACCTCCCAGG + Intronic
1152156826 17:78639500-78639522 GGACGTGACCTTCACCACACGGG + Intergenic
1152837976 17:82546999-82547021 CACTGTGACCTCCACCTCCCGGG - Intronic
1154410897 18:14141809-14141831 CACTGTGACCTCCACCTCCCAGG + Intergenic
1154452320 18:14487811-14487833 GACCTTGCCCTCCACCTTACAGG + Intergenic
1154462374 18:14605546-14605568 GACCGCAACCTCCACCTCCCAGG - Intergenic
1155965755 18:32033741-32033763 CACCGCGACCTCCACCTCCCAGG - Intronic
1157505824 18:48225816-48225838 CACTGTGACCTCCACCTCCCAGG + Intronic
1157865380 18:51179077-51179099 GACCGCAACCTCCACCTCCCGGG + Intronic
1158071611 18:53477082-53477104 CACTGTAACCTCCACCTCACGGG + Intronic
1159230426 18:65600560-65600582 CACCATGACCTCCACCTCCCAGG - Intergenic
1160024103 18:75204739-75204761 GACCGTGACCTCGGCCTCTCCGG + Intronic
1160489803 18:79327080-79327102 GAGTGTGAACTCATCCTCACAGG + Intronic
1160755269 19:753850-753872 CACCGCAACCTCCACCTCACAGG + Intronic
1161157813 19:2742424-2742446 CACTGCGACCTCCACCTCACAGG - Intergenic
1161363457 19:3864821-3864843 CACTGTGACCTCCACCTCCCGGG + Intronic
1161400809 19:4065731-4065753 GAGGGTGACCCCCCCCCCACGGG + Intronic
1161772118 19:6236551-6236573 GGGCGTGACCTCTACCTGGCCGG - Intronic
1161944129 19:7424100-7424122 GACCGCAACCTCCACCTCCCGGG + Intronic
1162461608 19:10817116-10817138 GAGGGTGGCCTCCTCCTCAGGGG - Intronic
1162676024 19:12298910-12298932 GAGTGCAACCTCCACCTCCCAGG - Intergenic
1163029603 19:14535677-14535699 GTCCGCGACCTCCACCTCCCAGG - Intronic
1163916035 19:20241526-20241548 CACCGCAACCTCCACCTCACGGG + Intergenic
1165296677 19:34932854-34932876 CAGCGCAACCTCCACCTCCCAGG + Intronic
1165553363 19:36606999-36607021 GACCGCAACCTCCACCTCCCGGG - Intronic
1166037047 19:40176239-40176261 CACTGTGACCTCCACCTCCCAGG + Intergenic
1166057457 19:40301085-40301107 CAGTGTAACCTCCACCTCCCGGG - Intergenic
1166099322 19:40561744-40561766 CACTGTGACCTCCACCTCCCGGG - Intronic
1166516621 19:43451859-43451881 CAGTGTAACCTCCACCTCCCGGG - Intergenic
1166767661 19:45261855-45261877 CACCGCGACCTCCACCTCTCAGG - Intronic
1166797824 19:45438715-45438737 CAGCGTGACCTCCGCCTCCCTGG + Intronic
1166818451 19:45561255-45561277 CACCGTAACCTCCACCTCCCAGG - Intronic
1166834391 19:45658342-45658364 TGGCGTGACCTCCGCCTCCCGGG + Intergenic
1167078186 19:47261634-47261656 CACTGTGACCTCCACCTCCCAGG - Intronic
1167091139 19:47344847-47344869 GACCGCAACCTCCACCTCCCGGG + Intergenic
1167213199 19:48146602-48146624 CACCGCGACCTCCACCTCCCGGG - Intronic
1167812360 19:51845411-51845433 GACCATAACCTCCACCTCCCGGG - Intergenic
925688435 2:6495772-6495794 GAGCCTGACCTGCACCTCACGGG - Intergenic
927349131 2:22086057-22086079 CACTGTAACCTCCACCTCACAGG - Intergenic
927547703 2:23969436-23969458 CACTGTGACCTCCACCTCCCAGG + Intronic
928082573 2:28323941-28323963 GACCTTGACCTCCCTCTCACGGG - Intronic
928501631 2:31902320-31902342 CAGCGCAACCTCCACCTCCCAGG - Intronic
928647457 2:33369631-33369653 CAGCGCAACCTCCACCTCCCAGG + Intronic
929513379 2:42583917-42583939 CAACGTAACCTCCACCTCCCAGG + Intronic
932556248 2:72827097-72827119 CACCGTGAGCTCCACCTCCCGGG + Intergenic
932765011 2:74464033-74464055 CAGCGCAACCTCCACCTCCCTGG + Intronic
934503991 2:94877932-94877954 GAGCCTGGCTTCCACCGCACAGG + Intergenic
934728578 2:96641563-96641585 CACTGTGACCTCCACCTCCCAGG + Intronic
935091211 2:99896709-99896731 CACTGTGACCTCCACCTCCCAGG + Intronic
935564985 2:104596813-104596835 CACCGTAACCTCCACCTCTCAGG + Intergenic
935735302 2:106101984-106102006 CAGAGTGACCTGCTCCTCACTGG - Intronic
937097923 2:119247779-119247801 GGGCATGGCCTCCACCTCCCAGG - Exonic
937216846 2:120318402-120318424 AAGCTTTACCTCCACCGCACAGG - Intergenic
937824103 2:126345716-126345738 GAGCTTGAAGTCCACCTGACAGG - Intergenic
937907036 2:127057472-127057494 CAGCGTGACCACCCCCTCCCAGG - Exonic
938387456 2:130877108-130877130 GTGCATGCCCTCCAGCTCACAGG + Intronic
938479272 2:131646357-131646379 GACCTTGCCCTCCACCCCACAGG - Intergenic
938604764 2:132881248-132881270 TACTGTGACCTCCACCTCTCAGG + Intronic
939508800 2:143081426-143081448 CAGAGTGACCTGCACCTAACTGG - Intergenic
942174185 2:173315477-173315499 CACTGTGACCTCCACCTCCCGGG + Intergenic
943140182 2:183972759-183972781 GAAAGTGACCTGAACCTCACTGG - Intergenic
944557219 2:200899447-200899469 GAGGCTGACCTTTACCTCACAGG + Exonic
944750828 2:202707629-202707651 CACTGTGACCTCCACCTCCCAGG - Intronic
944804398 2:203266903-203266925 CACTGTGACCTCCACCTCCCAGG - Intronic
944836791 2:203587954-203587976 CACCGTAACCTCCACCTCCCAGG - Intergenic
945086203 2:206135092-206135114 CACTGTGACCTCCACCTCCCAGG + Intronic
945332068 2:208551397-208551419 CAGCGCAACCTCCACCTCCCAGG + Intronic
945972581 2:216245103-216245125 CACTGTGACCTCCACCTCCCAGG + Intergenic
946672878 2:222124893-222124915 CACCGTAACCTCCACCTCCCAGG - Intergenic
947118958 2:226797799-226797821 GAGCATCACCGCCACCTCCCCGG - Exonic
947215362 2:227745088-227745110 CACCGTGACCTCCACCTCCTGGG + Intergenic
1169018697 20:2312319-2312341 CATCGTGACCTCCACCTCCTGGG - Intronic
1169073860 20:2749896-2749918 GAGGGTCACCTCCACCACCCCGG - Exonic
1169313270 20:4566331-4566353 CACTGTGACCTCCACCTCTCAGG - Intergenic
1169355260 20:4899944-4899966 CACTGTGACCTCCACCTCCCAGG + Intronic
1169728443 20:8761592-8761614 GACCGCAACCTCCACCTCCCGGG + Intronic
1170118492 20:12887025-12887047 CAGCTTGACTTCAACCTCACGGG - Intergenic
1170163981 20:13343662-13343684 GAGGGGGAGCTCCACATCACAGG - Intergenic
1170599910 20:17833815-17833837 CACTGTGACCTCCACCTCCCGGG - Intergenic
1172784995 20:37462707-37462729 GATCTTGGCCTCCACCTCCCCGG + Intergenic
1173391086 20:42633708-42633730 CACTGTGACCTCCACCTCCCAGG - Intronic
1173901270 20:46591092-46591114 GAGTGCAACCTCCACCTCCCAGG - Intronic
1174223368 20:48975723-48975745 CAGTGCAACCTCCACCTCACAGG - Intronic
1176099988 20:63360520-63360542 GGGGGAGACCTCCACCTCCCTGG + Intronic
1176443706 21:6800489-6800511 GACCTTGCCCTCCACCTTACAGG - Intergenic
1176821873 21:13665528-13665550 GACCTTGCCCTCCACCTTACAGG - Intergenic
1177159059 21:17528479-17528501 CACCGTAACCTCCACCTCCCGGG + Intronic
1178364726 21:31980145-31980167 CACCGTGACCTCCACCTCCTGGG + Intronic
1178405265 21:32318128-32318150 GAGTCTGACCTGCACCCCACAGG + Intronic
1181065000 22:20301415-20301437 CACTGTGACCTCCACCTCCCTGG + Intergenic
1182180583 22:28343452-28343474 CAGTGTAACCTCCACCTCCCGGG - Intronic
1182209060 22:28658919-28658941 CACTGTGACCTCCACCTCCCAGG - Intronic
1182232090 22:28845975-28845997 CACTGTGACCTCCACCTCCCAGG - Intergenic
1182493333 22:30688915-30688937 GACCGCAACCTCCACCTCCCGGG + Intergenic
1183494757 22:38136514-38136536 TACCGTTACCTCCACCTCCCGGG - Intronic
1183527016 22:38329115-38329137 CAGGGTGATCTCCAGCTCACAGG - Intronic
1183547471 22:38462337-38462359 GATGGTGACCTCTCCCTCACTGG - Intergenic
1183700383 22:39447874-39447896 GAGAGTGAGCGCCACATCACAGG + Intergenic
1184042001 22:41949806-41949828 GAGCCTGCACTCCACTTCACCGG + Intergenic
1184193885 22:42913401-42913423 GACCGCAACCTCCACCTCCCAGG - Intronic
1185098643 22:48825762-48825784 AAGCGTGACCTCCCCCACTCAGG - Intronic
950744916 3:15080167-15080189 CACTGTGACCTCCACCTCCCAGG - Intronic
951570877 3:24061940-24061962 CATTGTAACCTCCACCTCACAGG + Intergenic
952488028 3:33835640-33835662 CACTGTGACCTCCACCTCCCAGG - Intronic
954279464 3:49565895-49565917 CACTGTAACCTCCACCTCACGGG + Intronic
955771384 3:62388235-62388257 CACCATGACCTCCACCTCCCAGG + Intergenic
955777489 3:62449202-62449224 GATAGAGACCTCCACCTCACTGG + Intronic
955924773 3:63994308-63994330 CACTGTGACCTCCACCTCCCCGG + Intronic
958515983 3:95116806-95116828 GACCACAACCTCCACCTCACAGG + Intergenic
959774714 3:110143803-110143825 CACTGTGACCTCCACCTCCCGGG - Intergenic
962127750 3:132640163-132640185 GAGTGCTACCTCCACCTCCCAGG + Intronic
963216432 3:142753687-142753709 CACTGTGACCTCCACCTCCCAGG - Intronic
964712196 3:159683123-159683145 GAGTGCAACCTCCACCTCCCAGG + Intronic
965140045 3:164820980-164821002 CAGTGTAACCTCCACCTCCCAGG - Intergenic
966791315 3:183672917-183672939 CACCGCGACCTCCACCTCCCGGG - Intronic
967083509 3:186072304-186072326 GATCTTGGCCTCCACCTCTCGGG - Intronic
967518224 3:190396990-190397012 GAGCCTGAGCTCCACCTAAATGG + Intronic
968639786 4:1707428-1707450 GAGTGCAACCTCCACCTCCCAGG - Intronic
968806213 4:2774538-2774560 CACCGTGACCTCCGCCTCCCGGG + Intergenic
971826730 4:31633155-31633177 CACCGTCACCTCCACCTCCCAGG + Intergenic
973544690 4:51969083-51969105 CACTGTGACCTCCACCTCCCAGG + Intergenic
974379402 4:61119255-61119277 CACTGTAACCTCCACCTCACAGG + Intergenic
974607520 4:64173086-64173108 GACCGCAACCTCCACCTCCCAGG + Intergenic
975330724 4:73109222-73109244 CACTGTGACCTCCACCTCACAGG - Intronic
975534287 4:75433330-75433352 CACTGTGACCTCCACCTCCCGGG + Intergenic
976177530 4:82370064-82370086 CAGCGCAACCTCCACCTCCCAGG - Intronic
976897220 4:90127415-90127437 GAGCGCGAGATCCACCTCCCCGG - Intergenic
977248292 4:94659970-94659992 CACCGTAACCTCCACCTCCCGGG + Intronic
977544359 4:98359467-98359489 GAGCCTGACATCTACCTTACTGG - Intronic
978134805 4:105244669-105244691 CACCGCGACCTCCACCTCCCAGG + Intronic
978677193 4:111332897-111332919 CACTGTGACCTCCACCTCCCTGG - Intergenic
978793820 4:112689469-112689491 CACCGTAACCTCCACCTCCCAGG + Intergenic
979223256 4:118254167-118254189 CACTGTGACCTCCACCTCCCAGG - Intronic
979854814 4:125618411-125618433 CACTGTGACCTCCACCTCCCGGG - Intergenic
981918345 4:150059283-150059305 GAGCTTCACCTCCACTTCCCAGG + Intergenic
982965136 4:161897497-161897519 CACCGTGACCTCCGCCTCCCAGG - Intronic
985114088 4:186574054-186574076 CAGTGTGACCTCCACCTCCCGGG - Intergenic
988273024 5:29041661-29041683 GAGTGCAACCTCCACCTCCCAGG - Intergenic
989037288 5:37188923-37188945 GATCTTGGCCTCCACCTCCCAGG + Intronic
989314627 5:40063392-40063414 GGGCAGGACCTCCACCTCAGTGG + Intergenic
989395991 5:40957529-40957551 CAGCGCAACCTCCACCTCCCAGG + Intronic
990191755 5:53267487-53267509 CACTGTGACCTCCACCTCCCGGG - Intergenic
990587577 5:57227126-57227148 GACCGCAACCTCCACCTCCCAGG + Intronic
990685923 5:58301007-58301029 GACCGCAACCTCCACCTCCCTGG + Intergenic
992446138 5:76835646-76835668 CACCGTAACCTCCACCTCCCGGG - Intergenic
992786571 5:80175786-80175808 CACTGTGACCTCCACCTCACAGG - Intronic
994159172 5:96536281-96536303 CACCGTAACCTCCACCTCTCAGG - Intronic
996471068 5:123861006-123861028 CAGCCTGCCCTCCACCTCACAGG + Intergenic
996841396 5:127850888-127850910 CACCGCAACCTCCACCTCACGGG - Intergenic
997313729 5:132914150-132914172 CATTGTAACCTCCACCTCACCGG - Intronic
997331567 5:133066788-133066810 CAGCGCAACCTCCACCTCCCAGG + Intronic
997508203 5:134435037-134435059 CACCGCGACCTCCACCTCCCGGG - Intergenic
997635390 5:135400225-135400247 GGCAGTAACCTCCACCTCACCGG + Intergenic
998257882 5:140602686-140602708 CACCGTAACCTCCACCTCCCAGG - Intergenic
998990360 5:147808562-147808584 CAGTGTAACCTCCACCTCCCAGG - Intergenic
1000863518 5:166485170-166485192 GAGTGCAACCTCCACCTCCCAGG - Intergenic
1001055888 5:168449647-168449669 CACTGTGACCTCCACCTCATGGG + Intronic
1001340807 5:170843535-170843557 CACTGTGACCTCCACCTCCCGGG + Intergenic
1002381992 5:178837546-178837568 GACTGTAACCTCCACCTCCCAGG - Intergenic
1002510364 5:179712020-179712042 CACCGTGACCTCCGCCTCCCGGG - Intronic
1002953987 6:1843690-1843712 CAGCGCAACCTCCACCTCATGGG - Intronic
1003460175 6:6321441-6321463 GAGTGCAACCTCCACCTCCCGGG + Intergenic
1003595427 6:7470248-7470270 CACCGTGACCTCCACCTCCTGGG + Intergenic
1004030841 6:11867968-11867990 CAGTGTAACCTCCACCTCCCAGG - Intergenic
1004253969 6:14045882-14045904 CACCGTAACCTCCACCTCCCGGG + Intergenic
1005065327 6:21812338-21812360 CACCGTAACCTCCACCTCCCAGG + Intergenic
1005145155 6:22681143-22681165 TACTGTGACCTCCACCTCCCGGG + Intergenic
1005623493 6:27642078-27642100 CACCGCAACCTCCACCTCACGGG + Intergenic
1005782645 6:29208756-29208778 CACTGTGACCTCCACCTCCCAGG - Intergenic
1006565707 6:34955210-34955232 CACTGTGACCTCCACCTCCCAGG + Intronic
1006642852 6:35497489-35497511 GAGCGTACCCTCCAGCTCGCGGG + Intergenic
1006659967 6:35632811-35632833 CACTGTGACCTCCACCTCCCAGG - Intronic
1007088806 6:39169203-39169225 GAGAGTGAGCTCCACATCACTGG - Intergenic
1007596701 6:43055281-43055303 CACTGTGACCTCCACCTCCCAGG - Intronic
1008049353 6:46884157-46884179 GAGCGTGACGTCTTCCTCCCAGG - Exonic
1008892224 6:56508108-56508130 GACTGTAACCTCCACCTCCCAGG + Intronic
1008931307 6:56943506-56943528 CACCGTAACCTCCACCTCCCAGG + Intronic
1010107507 6:72187048-72187070 CACCGCAACCTCCACCTCACAGG - Intronic
1010699766 6:79029603-79029625 CACTGTGACCTCCACCTCCCAGG + Intronic
1011456940 6:87560810-87560832 TACCGTAACCTCCACCTCCCGGG - Intronic
1011655947 6:89552220-89552242 AAGCATGTCCTCCACCTAACTGG + Intronic
1011751743 6:90461080-90461102 CACCGCAACCTCCACCTCACAGG - Intergenic
1012133765 6:95529305-95529327 GAGCATGGCCTCCATCTCAAAGG + Intergenic
1012172734 6:96039596-96039618 AAGCATTACCTCCTCCTCACAGG + Intronic
1013527239 6:110985860-110985882 GACTGTGACCTCCACCTCCCAGG - Intronic
1013855884 6:114571419-114571441 CACCGTGACCTCCGCCTCCCAGG - Intergenic
1014784824 6:125606911-125606933 CACTGTAACCTCCACCTCACAGG - Intergenic
1016938422 6:149465677-149465699 CACTGTGACCTCCACCTCCCAGG - Intronic
1017116044 6:150977974-150977996 CACGGTGACCTCCACCTCCCAGG + Intronic
1017512811 6:155129658-155129680 GAGCATTGCCTCCACCCCACCGG + Exonic
1019494309 7:1330569-1330591 GGGCCTGACCTCCACCTCCAGGG - Intergenic
1019619018 7:1980455-1980477 GAGCGTGTCCGCCTCCTCCCTGG + Exonic
1019921793 7:4167925-4167947 GAGCCTGACCTTGACCTCATGGG + Intronic
1020004793 7:4776657-4776679 CACTGTAACCTCCACCTCACAGG - Intronic
1020639297 7:10735572-10735594 CTGCCTGACCTCCACCTCACAGG + Intergenic
1021141706 7:17033752-17033774 GACTGTAACCTCCACCTCCCGGG + Intergenic
1022084082 7:27049459-27049481 CACCGCGACCTCCACCTCCCGGG - Intergenic
1025919996 7:65902940-65902962 CACCGTGACCTCCGCCTCCCGGG + Intronic
1025929894 7:65985115-65985137 CACTGTGACCTCCACCTCCCGGG - Intergenic
1026034326 7:66820256-66820278 CACTGTGACCTCCACCTCCCAGG + Intergenic
1026351000 7:69515039-69515061 CAGTGTAACCTCCACCTCCCAGG + Intergenic
1026419316 7:70216983-70217005 CACTGTGACCTCCACCTCCCAGG + Intronic
1026717927 7:72806309-72806331 CACTGTGACCTCCACCTCCCGGG + Intronic
1026743932 7:72996822-72996844 GACCGCAACCTCCACCTCCCGGG + Intergenic
1026804187 7:73419425-73419447 GACCGCAACCTCCACCTCCCGGG + Intergenic
1026844408 7:73689924-73689946 GAGCCCTACCTCCACCCCACTGG - Intronic
1026923130 7:74170991-74171013 CACCGCAACCTCCACCTCACAGG + Intergenic
1026995506 7:74613436-74613458 TACTGTGACCTCCACCTCCCAGG + Intergenic
1027030042 7:74881517-74881539 GACCGCAACCTCCACCTCCCGGG + Intergenic
1027099804 7:75368260-75368282 GACCGCAACCTCCACCTCCCGGG - Intergenic
1027245853 7:76366919-76366941 CACCGTAACCTCCACCTCCCAGG + Intergenic
1027812901 7:82928454-82928476 TGGCATGACCTCCACCTCACAGG + Intronic
1029684390 7:102135896-102135918 CACTGTGACCTCCACCTCCCGGG - Intronic
1030674284 7:112368243-112368265 CACCGCAACCTCCACCTCACAGG - Intergenic
1030733696 7:113018806-113018828 CACCGTAACCTCCACCTCCCAGG + Intergenic
1031187233 7:118498287-118498309 CACTGTGACCTCCACCTCTCAGG + Intergenic
1032622368 7:133549077-133549099 CACCGTAACCTCCACCTCCCAGG + Intronic
1034560338 7:151876114-151876136 GAGCGCGGGCTCCACCTCCCCGG + Intronic
1034587041 7:152102903-152102925 CATCGTGACCTCCGCCTCCCAGG - Intronic
1034657490 7:152741105-152741127 CACCGTCACCTCCACCTCCCGGG - Intergenic
1034968317 7:155404720-155404742 CAGCGTGGCCTCCACACCACGGG + Intergenic
1035211579 7:157332537-157332559 CACCGTGACCTCCACCTCCTAGG + Intergenic
1035387533 7:158484436-158484458 CACCGTAACCTCCACCTCCCAGG + Intronic
1035529037 8:336912-336934 GAGCCTGCCGTTCACCTCACAGG + Intergenic
1036643921 8:10600696-10600718 GAGCCTGCCCTCCGCCTCCCCGG + Intergenic
1037462040 8:19120833-19120855 CAGTGTAACCTCCACCTCCCGGG - Intergenic
1037695883 8:21223519-21223541 CACTGTGACCTCCACCTCCCAGG - Intergenic
1038789709 8:30657862-30657884 GAGCGTGACCTCCACCTCACGGG - Intronic
1039824724 8:41163486-41163508 CACTGTGACCTCCACCTCCCAGG + Intergenic
1042652663 8:71060351-71060373 GAGCGTTACCTCCACATCCAAGG + Intergenic
1044754520 8:95447463-95447485 CACCGTGACCTCCATCTCCCGGG + Intergenic
1045931314 8:107630177-107630199 CACTGTGACCTCCACCTCCCAGG + Intergenic
1048157681 8:131975490-131975512 CACCGCGACCTCCACCTCCCAGG + Intronic
1049130674 8:140837651-140837673 CAGTGTAACCTCCACCTCCCAGG - Intronic
1049564548 8:143331442-143331464 CAGTGTGGCCTCCACCTCACGGG + Intronic
1049972068 9:830220-830242 CAGTGTAACCTCCACCTCCCTGG + Intergenic
1051851106 9:21509586-21509608 CACCGCAACCTCCACCTCACTGG + Intergenic
1051910599 9:22151064-22151086 CACCGCGACCTCCACCTCCCGGG + Intergenic
1054421217 9:64932926-64932948 CACTGTGACCTCCACCTCCCGGG - Intergenic
1054780004 9:69157308-69157330 GAGTTGGACCTCCACCTCATGGG - Intronic
1055032790 9:71787818-71787840 CACCGTAACCTCCACCTCCCAGG + Intronic
1055091618 9:72369143-72369165 GACCGCCACCTCCACCTCCCGGG - Intergenic
1055279644 9:74659564-74659586 TGGTGTGACCTCCACCTCCCAGG + Intronic
1056338179 9:85598793-85598815 CACTGTGACCTCCACCTCCCAGG + Intronic
1056756164 9:89383249-89383271 GAGAGTGAGCCCCACCTCCCAGG - Intronic
1057294109 9:93825516-93825538 GAGACTGAGCTCCCCCTCACAGG + Intergenic
1057738502 9:97690284-97690306 CAGTGTAACCTCCACCTCTCGGG + Intronic
1058865334 9:109156755-109156777 GACTGTAACCTCCACCTCCCCGG + Intronic
1058901652 9:109447441-109447463 AAGGGTGAGCTCCCCCTCACTGG + Intronic
1059656805 9:116365088-116365110 GCGCCTGACTTCCACCTCCCAGG + Intronic
1061332177 9:129901834-129901856 CAGTGTGACCTCCACTTCCCAGG - Intronic
1061446450 9:130640873-130640895 GAGCGTGACCACCGCCTCCTGGG + Intergenic
1062002192 9:134221950-134221972 GATCCTGAGATCCACCTCACTGG + Intergenic
1203525493 Un_GL000213v1:84038-84060 GACCTTGCCCTCCACCTTACAGG + Intergenic
1203745228 Un_GL000218v1:37651-37673 GAGCCTGGCTTCCACCGCACAGG - Intergenic
1203564880 Un_KI270744v1:81833-81855 GAGCCTGGCTTCCACCGCACAGG + Intergenic
1188064734 X:25645089-25645111 CACCGTAACCTCCACCTCCCAGG - Intergenic
1188474726 X:30579040-30579062 CACTGTGACCTCCACCTCTCGGG - Intergenic
1188488861 X:30714477-30714499 GAGGGTGGCCTCCATCTGACAGG - Intronic
1190001165 X:46688519-46688541 CACCGTAACCTCCACCTCCCAGG - Intronic
1190516740 X:51231530-51231552 GAGTGCAACCTCCACCTCCCAGG - Intergenic
1192194261 X:69018154-69018176 GAGCCAAATCTCCACCTCACAGG - Intergenic
1192375762 X:70560224-70560246 GACCGTGACCTCCGCTTCCCGGG + Intronic
1193348889 X:80434059-80434081 CACTGTGACCTCCACCTCCCAGG - Intronic
1193926144 X:87487754-87487776 CACTGTGACCTCCACCTCTCAGG - Intergenic
1193990185 X:88297219-88297241 GAGTGCAACCTCCACCTCCCTGG - Intergenic
1195110972 X:101649090-101649112 GACTGCTACCTCCACCTCACTGG + Intergenic
1195348634 X:103976197-103976219 GTGCGTGACCATCACCTCCCGGG + Intergenic
1195355983 X:104040300-104040322 GCGCGTGACCATCACCTCCCGGG + Exonic
1195358808 X:104062643-104062665 GTGCGTGACCATCACCTCCCGGG - Intergenic
1196265485 X:113639520-113639542 GACCGCAACCTCCACCTCCCAGG - Intergenic
1196921607 X:120591068-120591090 CACCGTAACCTCCACCTCCCGGG - Intergenic
1198035323 X:132796008-132796030 GATAGTATCCTCCACCTCACAGG + Intronic
1198863150 X:141092102-141092124 CACCGCGACCTCCACCTCCCAGG - Intergenic
1198899540 X:141495285-141495307 CACCGCGACCTCCACCTCCCAGG + Intergenic
1200312391 X:155091345-155091367 CAGTGTAACCTCCACCTCCCGGG + Intronic
1201279530 Y:12329740-12329762 CACTGTGACCTCCACCTCCCTGG - Intergenic
1201355623 Y:13094190-13094212 CACTGTGACCTCCACCTCCCAGG - Intergenic
1202278732 Y:23153975-23153997 GAGTATTACCTCCAACTCACCGG - Intronic
1202286007 Y:23247634-23247656 GAGTATTACCTCCAACTCACCGG + Intronic
1202286472 Y:23254789-23254811 GAGTATTACCTCCAACTCACCGG + Intronic
1202431556 Y:24785315-24785337 GAGTATTACCTCCAACTCACCGG - Intronic
1202431859 Y:24790072-24790094 GAGTATTACCTCCAACTCACCGG - Intronic
1202432162 Y:24794828-24794850 GAGTATTACCTCCAACTCACCGG - Intronic
1202438106 Y:24868090-24868112 GAGTATTACCTCCAACTCACCGG + Intronic
1202438409 Y:24872847-24872869 GAGTATTACCTCCAACTCACCGG + Intronic