ID: 1038792651

View in Genome Browser
Species Human (GRCh38)
Location 8:30682011-30682033
Sequence CCTTATATTCAAAAAGTCGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038792648_1038792651 16 Left 1038792648 8:30681972-30681994 CCACAGTTGGGATGTTGTTATAA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1038792651 8:30682011-30682033 CCTTATATTCAAAAAGTCGATGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038792651 Original CRISPR CCTTATATTCAAAAAGTCGA TGG Exonic
904982068 1:34513792-34513814 GCTTATATTAAAAAAGAAGAGGG + Intergenic
907818229 1:57940960-57940982 CCTTATAGTCACTAAGTGGATGG - Intronic
918691345 1:187483811-187483833 CCTTATTTTAAAAAATTCAATGG + Intergenic
922280861 1:224122643-224122665 CCTAGTCTTCAAAAAGTCAATGG - Intronic
923239894 1:232073383-232073405 GCTTATATTAGAAAAGACGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
1065312843 10:24432753-24432775 CCTAATTTTCAAAAATTCAAGGG - Intronic
1068244889 10:54351923-54351945 CCTTATATTCACGAAACCGATGG + Intronic
1069765155 10:70851281-70851303 CCTAATATTCTCAAAGTGGAGGG + Intronic
1071469633 10:85974473-85974495 ACTTAGATTCAAAAGGTCAATGG - Intronic
1072346387 10:94511669-94511691 GCTTATATTCAAAAAACAGATGG - Intronic
1075151951 10:119941212-119941234 CCTTATTTTCAAGAAGTCCTGGG + Exonic
1077180631 11:1211864-1211886 CATTATAATCAAACAGTTGAAGG + Intergenic
1087591248 11:100190916-100190938 TCTTATATTCAAAAAGGTTAAGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1095821427 12:46482830-46482852 CCTTTTATTTAAAAAGTAAATGG + Intergenic
1096930711 12:55205833-55205855 CCAAATATTCAAAAAATGGAAGG + Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1101258249 12:103001729-103001751 CCATAAATTCAAAAAGCTGAGGG - Intergenic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1111129225 13:83953027-83953049 ACTGATATTCAAATAGTCAAAGG + Intergenic
1116287492 14:42991181-42991203 CCTTATATTCAAAAATGCCTAGG + Intergenic
1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG + Intergenic
1117071392 14:52060080-52060102 CCTTATATTCAAATAGGAAAGGG + Intronic
1131875635 15:96803171-96803193 GCTTCTAATCAAAAAGTCTATGG + Intergenic
1133793661 16:9029022-9029044 ACCTAAATTCAAAAAGTCTATGG - Intergenic
1141236693 16:82224947-82224969 CATTATCTTCAAAAAGTCCCTGG + Intergenic
1152888893 17:82868654-82868676 CCTTAGATGCAAAAAGTCAGAGG + Intronic
1153354061 18:4116288-4116310 CATTATAGTCAAAATGTAGAAGG - Intronic
1167725467 19:51209864-51209886 CCTTATATTTAAAAAGAGGATGG + Intergenic
930527639 2:52549506-52549528 CCATATATTCAAAAAGACTTGGG - Intergenic
930987044 2:57602596-57602618 CTTTATTTACAAAAAGTAGATGG - Intergenic
935431142 2:102977210-102977232 CTTTATTTTCACAAAGGCGAAGG + Intergenic
939139848 2:138341724-138341746 TCTTATATTCCAAAAGTTCAAGG - Intergenic
944638846 2:201701474-201701496 TCTTATATTAAAGAAGTTGATGG - Exonic
944706041 2:202289458-202289480 CCTTATATACAAAACCTTGAAGG - Intronic
948363010 2:237435949-237435971 CCATATATTAAAATAGTAGAAGG + Intergenic
1176705037 21:10110179-10110201 CATTATATTCAAAGATTCCAAGG - Intergenic
1177481190 21:21691347-21691369 ACTAATACTCAGAAAGTCGATGG + Intergenic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1182641246 22:31769619-31769641 CTTTAAATTCAAAAAGTGGCTGG + Intronic
956980769 3:74634627-74634649 CATTATACTCACAAAGTCCAAGG - Intergenic
966791104 3:183670346-183670368 GCTTATATGCAAAAAATCCATGG - Intronic
971900015 4:32647256-32647278 CCATTTCTTCAAAAAGTCAAAGG - Intergenic
975149712 4:71007013-71007035 CCATATATTCTCAAAGTCCATGG - Intronic
977293138 4:95184636-95184658 CCTTACATTGAAAAATTAGAGGG - Intronic
978718653 4:111877290-111877312 CCTTATTTTTAAAAAGACCATGG - Intergenic
980262694 4:130473168-130473190 ACTTATATTCTAAAAGTAAAAGG - Intergenic
980377296 4:131966849-131966871 CATTATATTCAAAGATTCCAAGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
988644137 5:33075285-33075307 CATTATATCCAAAAACTTGAAGG + Intergenic
989114548 5:37939761-37939783 CCATATATTCACAAATTCCAGGG + Intergenic
990029250 5:51236695-51236717 CCTTATATTAAAAACGTTGTTGG - Intergenic
990868060 5:60401487-60401509 CCTTATGTTAAAAAAGAGGATGG + Intronic
991438512 5:66621241-66621263 GATTATATTCAAAATGTCCAAGG + Intronic
991903485 5:71483673-71483695 CCTTATTTTTAAAAAGCCGAAGG + Intronic
995401535 5:111747744-111747766 ACTTATATTCAAGAAGGAGAAGG - Intronic
1005238121 6:23790091-23790113 CATTATATTTAAAATGTGGAAGG - Intergenic
1007915797 6:45560591-45560613 CCTTCAATTTAAAAAGTAGAAGG + Intronic
1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG + Intergenic
1013831539 6:114278738-114278760 ATTTATATTAAAAAAGACGAAGG + Intronic
1016231713 6:141814091-141814113 CCTTACATTAAAAATGTAGAGGG - Intergenic
1016469393 6:144359902-144359924 CCTTATATTCAAATTTTGGAAGG - Intronic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1022790990 7:33689028-33689050 CTTCAAATTCAAAAAGTCCAAGG + Intergenic
1024022431 7:45384511-45384533 CCGTTCATTCAAAAAGTGGATGG - Intergenic
1024187537 7:46967878-46967900 CCTAGTAGTCAAAAAGTAGAAGG + Intergenic
1024728035 7:52221791-52221813 CCTTATATTCAAAAAAGGAAAGG + Intergenic
1028217367 7:88150987-88151009 CCTAATATTCATAAAATGGATGG + Exonic
1030145352 7:106348036-106348058 CTTGATATTCATAAAGTCCAGGG + Intergenic
1030644734 7:112047474-112047496 CCATATATTCAAAAATTTAATGG + Intronic
1037171914 8:15903128-15903150 CCTTTTATTCATACAGTAGATGG + Intergenic
1038792651 8:30682011-30682033 CCTTATATTCAAAAAGTCGATGG + Exonic
1040715814 8:50250511-50250533 CATTATAATCAAAATGTCAAAGG + Intronic
1044647189 8:94456490-94456512 ACTTATTTTCAAAAGGTTGAGGG + Intronic
1045047211 8:98290883-98290905 CCTAATATTTAAAAAGATGATGG + Intronic
1045945951 8:107796343-107796365 CCTTATATTCTAAAGGTCCTTGG + Intergenic
1047702592 8:127464520-127464542 GCCTATATTCAAATAGTAGATGG - Intergenic
1048170878 8:132105012-132105034 ACTTAAATGCAAAAAGTCAAGGG + Intronic
1051918925 9:22240781-22240803 CCTTCTAATAAAAAAGTCAATGG + Intergenic
1051944041 9:22544159-22544181 TCTTATATTCAAAAAGTTAGAGG - Intergenic
1052761024 9:32591323-32591345 CCATATATTCAATAAGTTGGAGG + Intergenic
1053642294 9:40097234-40097256 CATTATATTCAAAGATTCCAAGG - Intergenic
1053763844 9:41368232-41368254 CATTATATTCAAAGATTCCAAGG + Intergenic
1054323184 9:63694618-63694640 CATTATATTCAAAGATTCCAAGG - Intergenic
1054542459 9:66279411-66279433 CATTATATTCAAACATTCCAAGG + Intergenic
1055154643 9:73045216-73045238 CCTTATATTCCAAGACTCAATGG + Intronic
1055155803 9:73061513-73061535 GCTTATATACAAACAGTCCAGGG - Intronic
1059990141 9:119857538-119857560 CCTTATATTCAAATACACAATGG + Intergenic
1202790068 9_KI270719v1_random:80278-80300 CATTATATTCAAAGATTCCAAGG - Intergenic
1186528909 X:10275772-10275794 CAATATATTCAAAAAGTACATGG - Intergenic
1187915305 X:24148972-24148994 GCTTATTTTTAAAAAGTAGACGG + Intergenic
1188555223 X:31404144-31404166 GGTTATATTAAAAAAATCGAGGG + Intronic
1191767329 X:64712432-64712454 CCTTATTTTTAAAAACTGGATGG - Intergenic
1192759391 X:74079819-74079841 ACATATATTCAAAAAGCCAAAGG + Intergenic
1194933572 X:99918895-99918917 CCTTATGTTCAACAAGTACAGGG + Intergenic
1197966238 X:132065325-132065347 CTTAATATTCAAAAAATGGAAGG - Intergenic