ID: 1038792894

View in Genome Browser
Species Human (GRCh38)
Location 8:30684352-30684374
Sequence ACAGCTGGCAAGTTTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038792889_1038792894 27 Left 1038792889 8:30684302-30684324 CCAGAATCTCCAAGAAACCATGA 0: 1
1: 0
2: 1
3: 21
4: 237
Right 1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136
1038792891_1038792894 10 Left 1038792891 8:30684319-30684341 CCATGAGACTCAGCTGCAACACG 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136
1038792890_1038792894 18 Left 1038792890 8:30684311-30684333 CCAAGAAACCATGAGACTCAGCT 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038792894 Original CRISPR ACAGCTGGCAAGTTTCAAGC TGG Intronic
902276649 1:15344881-15344903 ACAGCTGGAAAGGATCAACCTGG + Intronic
902880360 1:19368234-19368256 ACAGCTGGCACGTCTCAGGATGG - Intronic
903998477 1:27323049-27323071 TCAGCTGTCAAGGTTGAAGCAGG - Intronic
904459246 1:30665775-30665797 ACAGTTCGCAAGATTAAAGCTGG + Intergenic
907115035 1:51960628-51960650 ACATCAGGCAGGTTCCAAGCAGG + Intronic
907473940 1:54692911-54692933 ACAGGTGGCAAGTGGTAAGCTGG - Intronic
907649832 1:56284660-56284682 ACAGGTGGAGAATTTCAAGCAGG + Intergenic
909567342 1:77067942-77067964 AAAGCTGTCAAGTTTAAAGCAGG - Intergenic
910313643 1:85857272-85857294 ACAGCTGGGAAGTTTGTGGCAGG + Intronic
912537253 1:110383923-110383945 ACAGCTTGGAAGTTAGAAGCAGG + Intronic
915431441 1:155869908-155869930 ACGGCTGGCAAGTGGTAAGCTGG - Intronic
916815333 1:168346267-168346289 TCAACTGACAAGTTTCAAGAAGG + Intergenic
920957319 1:210631402-210631424 CCAGCTAGCAAGCCTCAAGCTGG - Intronic
923238734 1:232060111-232060133 ACAGTTGGCAAATTTCCAACAGG + Intergenic
1067209874 10:44251189-44251211 ACAGCTGGCATGTTCCACACCGG - Intergenic
1073881836 10:107990885-107990907 AAAGCTGACGAGCTTCAAGCTGG - Intergenic
1074140428 10:110667517-110667539 AAAGCTGGCAAAGTTCAAGCTGG - Intronic
1074536389 10:114331178-114331200 ACTACTGGTAAGGTTCAAGCAGG + Intronic
1075402713 10:122172636-122172658 TCAGCTGGGAAGTTCCATGCAGG - Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1081860805 11:46332590-46332612 GCAGCTGGCAGGTTTGGAGCGGG - Intergenic
1082026043 11:47573071-47573093 ACAGCTGGCAATCTTCCAGAGGG + Exonic
1083157988 11:60837126-60837148 GCAGCTGGGAGGTCTCAAGCTGG + Intergenic
1089154003 11:116386488-116386510 ACAGCTTGCAGGTTCCAAACAGG - Intergenic
1094161809 12:27398621-27398643 TCAGTTGGCAAATTTCTAGCTGG - Intronic
1098763880 12:74460164-74460186 ACAGCTGGCCATCTGCAAGCTGG + Intergenic
1098797551 12:74910226-74910248 ATAGTTGGCAAGTTGGAAGCAGG + Intergenic
1101327043 12:103724643-103724665 AAAGCTGGGAAGTATCAAACAGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101801503 12:108026191-108026213 AGGGCTGGGAAGTTTCCAGCAGG - Intergenic
1103599083 12:122042907-122042929 ACAGCTGGCACGTTTGAAACAGG + Intronic
1107061817 13:36167369-36167391 ACAGCTTGTAAGTTTCACGGTGG - Intergenic
1108368670 13:49745337-49745359 ACAACTGAAAAGTTTCAAGACGG + Intronic
1122349864 14:101082882-101082904 ACAGCTTCCAAGTGGCAAGCTGG + Intergenic
1122914032 14:104848355-104848377 ACAGCTGGCAAAATCCAGGCTGG - Intergenic
1125963924 15:43857521-43857543 CCAGCTGTCAAGTTTCTAGTTGG - Intronic
1126958640 15:53964067-53964089 ACATCTTTCATGTTTCAAGCTGG - Intergenic
1127208571 15:56747054-56747076 AAAGCAGGCAAGTTTCAGGTGGG - Intronic
1129850717 15:78791996-78792018 ACAGCTGGCAGGTTCCCAGAGGG + Intronic
1131973434 15:97916332-97916354 AAAGCTGCCATGTTTCAATCTGG - Intergenic
1132140672 15:99390965-99390987 ACACCTGGCAAGCTCCAATCCGG - Intergenic
1132755698 16:1483826-1483848 ACATCTGGGTAGTTTCCAGCTGG - Intergenic
1133359961 16:5166391-5166413 ACAGCTGGTGGGTCTCAAGCTGG - Intergenic
1133403295 16:5504288-5504310 ACAGCTGCCAACTTTGAGGCAGG + Intergenic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1139958747 16:70705759-70705781 TCAGCTGGCAAGTTCCAGGAGGG + Intronic
1140116342 16:72044679-72044701 ACATCTGACCAGTTTCATGCTGG + Intronic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1141698519 16:85631987-85632009 GCAGCTGGCAGGGTTCAGGCTGG + Intronic
1143002472 17:3803392-3803414 ACAGTTGGCAAATTTGAAACAGG + Intergenic
1144794921 17:17884618-17884640 ACAGCGGGTAAGCTTCCAGCTGG - Exonic
1145260948 17:21354443-21354465 ACAGCTGGAAGGTTTTAAGCAGG - Intergenic
1147471478 17:40666170-40666192 CCAGCTGGCAAGATTAAACCAGG - Intergenic
1149291033 17:55217826-55217848 ACAATTAGCATGTTTCAAGCAGG + Intergenic
1151171447 17:72249645-72249667 CCAGCTGCCAAGTTTCAGCCAGG - Intergenic
1152119895 17:78412031-78412053 ACAACTGGGAAGTTTCCAACGGG - Intronic
1154399543 18:14023495-14023517 ACAGCTGCCAAACTTCCAGCAGG + Intergenic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1157526907 18:48390590-48390612 GCTGCTGGCAGGTTTTAAGCAGG - Intronic
1165797656 19:38528225-38528247 ACAGCTGGGCAGTTTCATCCAGG + Intronic
1166006460 19:39911003-39911025 ACATCTGGCAGTTGTCAAGCTGG - Intronic
1166681464 19:44770006-44770028 ACAGCTGGCAATTTGCATACAGG + Intergenic
1168487206 19:56773882-56773904 ACAGTTGGCTTGTTTCAATCTGG - Intergenic
925510803 2:4622822-4622844 AAAACAGGCAAGTTTCCAGCAGG + Intergenic
925981322 2:9179837-9179859 ACAGCTAGCAAGTGCCTAGCTGG + Intergenic
926248586 2:11139758-11139780 ACAAATGCCAAGTGTCAAGCAGG - Intronic
926336501 2:11866489-11866511 ACAGCTGGCTATTCTCAGGCAGG - Intergenic
926429850 2:12774579-12774601 ACAGCTGTGAAATTTCAAGGGGG - Intergenic
927437989 2:23086915-23086937 CCAGCTGACCAGATTCAAGCAGG - Intergenic
931504794 2:62913069-62913091 ACAGCTGGTGAGTTTCCAGAGGG - Intronic
933011345 2:77068242-77068264 ACAACTTACAAGTTTCTAGCTGG - Intronic
934858960 2:97748323-97748345 CCACTTGGCAAGTTTAAAGCAGG + Intergenic
940237003 2:151522534-151522556 CCAGATGGAAAGTTTCATGCAGG + Intronic
943219294 2:185084168-185084190 CCTGCTAGCAAGTTTCTAGCTGG - Intergenic
947291315 2:228577794-228577816 ACTTCTGCCAAGTTTCATGCTGG - Intergenic
1169620138 20:7496945-7496967 ACAGCTGACAGGTCTCAAGAGGG + Intergenic
1171171265 20:23017467-23017489 ACAGCTGGCAAATGTCAGCCAGG + Intergenic
1172080825 20:32339276-32339298 ACAGCAGGCAAACTTAAAGCAGG - Intergenic
1173222846 20:41143577-41143599 ACAGGTGGCAAGACTCAAGGTGG + Intronic
1174362286 20:50036534-50036556 ACAGCTAGCAAGTGACAACCAGG + Intergenic
1177016688 21:15798231-15798253 ATAGCTGGCACATTTCAAGGAGG - Intronic
1177397858 21:20561212-20561234 TCTGCTGAGAAGTTTCAAGCAGG + Intergenic
951143325 3:19195150-19195172 ACTCCTGGCAAGCCTCAAGCTGG - Intronic
952043312 3:29286002-29286024 ACAACTGGCAAGTTACCAACTGG - Intronic
952974196 3:38680271-38680293 ACAGTGGGAAAGTCTCAAGCAGG - Intergenic
954060660 3:48063990-48064012 ACAGCTGGGAGGTTAGAAGCAGG - Intronic
957128714 3:76196669-76196691 AAAACTGGCAAAGTTCAAGCAGG + Intronic
958636695 3:96754635-96754657 ACAGCTGGCAAATCTCTAACTGG - Intergenic
959373477 3:105558790-105558812 GCAGCTGGCAGGTTACATGCAGG - Intronic
960165217 3:114393819-114393841 CCAGCTGGCAAGTTTCTTGATGG + Intronic
960448279 3:117775189-117775211 AATGCTGGCAAGTTTAAAACGGG + Intergenic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
968468529 4:765517-765539 TCAGCTGGCACCTTCCAAGCTGG - Intronic
970906243 4:21219704-21219726 ACAGCAGGAAGGTTTCAAGTGGG + Intronic
971501488 4:27323129-27323151 AGAGCTTGCATGTTTCAATCAGG + Intergenic
975461190 4:74655248-74655270 ACATCTGGCAGTATTCAAGCTGG + Intergenic
975527938 4:75371845-75371867 ATAGCTGTCAAATTTCATGCAGG - Intergenic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
976267600 4:83199023-83199045 ACAGCTTACAAGTTTGAAGAGGG + Intergenic
976687339 4:87829084-87829106 ACAGAGGGCAAGTTTTAAGAGGG + Intronic
981171735 4:141633086-141633108 AAAGATGTCTAGTTTCAAGCTGG - Intergenic
984403138 4:179292695-179292717 ACAGATGGCAAGTGTACAGCAGG - Intergenic
985915528 5:2915893-2915915 AAACCTGCCAAGTTTCAAGTAGG + Intergenic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
986520710 5:8614769-8614791 ATAGCTGGGAAGTTCCAAGCTGG + Intergenic
986735118 5:10662643-10662665 ACTGCTGGCAGGTTTTGAGCAGG - Intergenic
986746932 5:10753270-10753292 ACAGCTGGCAAGCGGCAAACTGG + Intronic
989098953 5:37807027-37807049 GCAGCTGGCAATATTCAAGATGG - Intergenic
995155980 5:108913737-108913759 ACATCTGGACAGTTTCTAGCTGG - Intronic
998094712 5:139390700-139390722 ACAACTGGCCATTTTCTAGCTGG - Exonic
999653727 5:153792882-153792904 AAATGTGGCAATTTTCAAGCTGG - Intronic
999757290 5:154674099-154674121 ACAACTGGCAATGTTCAAGTTGG + Intergenic
1006695345 6:35926163-35926185 GCAGCTGGCATTTTCCAAGCAGG + Intergenic
1007446268 6:41908762-41908784 ACAGCTGGCAAGTAGGAAGCGGG - Intronic
1010404920 6:75493861-75493883 ACAGCTGAGAAGTTTGGAGCCGG + Intergenic
1011836245 6:91434768-91434790 ACAGCTGGTAAATATCAAACTGG + Intergenic
1012531040 6:100236674-100236696 ACAGAGGGCAAATTTCATGCTGG + Intergenic
1015216522 6:130756323-130756345 CCAGCTGCCATGTTTCAAGCTGG + Intergenic
1016372190 6:143386690-143386712 TGAGCTGGCCAGTTCCAAGCAGG + Intergenic
1017603200 6:156105670-156105692 ACAGCCGGGAAGTTTCAAATTGG - Intergenic
1018275403 6:162125070-162125092 ACAGCTGGCAGGTTGGAAGGTGG - Intronic
1018742746 6:166743173-166743195 ACAGTTTGCAAGTTTAATGCTGG - Intronic
1019361343 7:605703-605725 ACGGCTGGGACGTTCCAAGCTGG + Intronic
1021555552 7:21914696-21914718 ACATCTGGGAAGTACCAAGCTGG - Intronic
1024350175 7:48355477-48355499 ACTGCTGGAGAGTTTCGAGCAGG + Intronic
1026111303 7:67460816-67460838 ACAACTGGTCAGTTTCAGGCAGG - Intergenic
1026817659 7:73524655-73524677 ACAGCTGGGAAGGTACAGGCTGG - Intergenic
1028946427 7:96585494-96585516 GCAGCTGGCAAGTTCCAACTGGG - Intronic
1028976735 7:96923110-96923132 CCAGCTCCCAAGTTACAAGCTGG + Intergenic
1030482321 7:110120060-110120082 GAAGCTGGGAAGTTTCAACCGGG + Intergenic
1030525814 7:110653579-110653601 AGAGCTGGGGAGTTTCAAGCTGG - Intergenic
1032924639 7:136589488-136589510 ACAGTTGTCAAGTGTCAAGCTGG + Intergenic
1035606754 8:934470-934492 AGAGGTGGCCTGTTTCAAGCAGG - Intergenic
1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG + Intronic
1040597117 8:48849116-48849138 ACAGCTGGCAACTGTCAAGAAGG - Intergenic
1041070603 8:54124433-54124455 ACAACATGCAAATTTCAAGCGGG + Intergenic
1046430567 8:114121158-114121180 AAAGCTGGAAATTTTCAGGCGGG + Intergenic
1046892568 8:119438977-119438999 ACTGCTGGCCATATTCAAGCTGG + Intergenic
1047202283 8:122777369-122777391 ACAGCTGATAAGTTAGAAGCAGG - Intergenic
1049101596 8:140583283-140583305 ACAGCAGGCCATTTACAAGCTGG - Intronic
1050391909 9:5153093-5153115 ACAGCTGGCCAGTTTTGTGCTGG - Intronic
1050703997 9:8374798-8374820 TGAGCTGGCAAGTTCCAAACAGG - Intronic
1052610139 9:30760711-30760733 ACAGCTGGTCAGGTACAAGCAGG + Intergenic
1054853980 9:69878399-69878421 AGAGGTGGCAAGTCTCTAGCAGG - Intronic
1054861840 9:69961855-69961877 ACTACTGGCGAGTTTCAAGCAGG + Intergenic
1057481936 9:95451483-95451505 CCAGCTGCCAGGTTTCCAGCTGG + Intronic
1057631932 9:96726324-96726346 ACAGCTGAAAATTTTCAAGAGGG - Intergenic
1058102364 9:100931600-100931622 ACAGCTGGCAGGTCTCCAGCAGG - Intergenic
1059093027 9:111381804-111381826 ACAGTTGGCATGTTTGAATCAGG + Intronic
1059831213 9:118098276-118098298 ACAGCTGGGAAGTTCCAAATGGG + Intergenic