ID: 1038799128

View in Genome Browser
Species Human (GRCh38)
Location 8:30733386-30733408
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038799122_1038799128 8 Left 1038799122 8:30733355-30733377 CCTTCAAGTGCATGGAGCATTAT No data
Right 1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG No data
1038799121_1038799128 9 Left 1038799121 8:30733354-30733376 CCCTTCAAGTGCATGGAGCATTA No data
Right 1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG No data
1038799119_1038799128 18 Left 1038799119 8:30733345-30733367 CCTTTTTAACCCTTCAAGTGCAT No data
Right 1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038799128 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intronic