ID: 1038803716

View in Genome Browser
Species Human (GRCh38)
Location 8:30771926-30771948
Sequence AACTCCCTCTTCTGCGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038803716_1038803721 1 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803721 8:30771950-30771972 ATACTCAAGGATAGTTTGGTGGG No data
1038803716_1038803723 8 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803723 8:30771957-30771979 AGGATAGTTTGGTGGGCAGAGGG No data
1038803716_1038803726 21 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803726 8:30771970-30771992 GGGCAGAGGGCTAGGAAATAGGG No data
1038803716_1038803722 7 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803722 8:30771956-30771978 AAGGATAGTTTGGTGGGCAGAGG 0: 42
1: 106
2: 280
3: 515
4: 829
1038803716_1038803720 0 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803720 8:30771949-30771971 AATACTCAAGGATAGTTTGGTGG No data
1038803716_1038803724 13 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803724 8:30771962-30771984 AGTTTGGTGGGCAGAGGGCTAGG No data
1038803716_1038803719 -3 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803719 8:30771946-30771968 GTTAATACTCAAGGATAGTTTGG No data
1038803716_1038803725 20 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803725 8:30771969-30771991 TGGGCAGAGGGCTAGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038803716 Original CRISPR AACTCCCTCTTCTGCGTGGT CGG (reversed) Intergenic
No off target data available for this crispr