ID: 1038803720

View in Genome Browser
Species Human (GRCh38)
Location 8:30771949-30771971
Sequence AATACTCAAGGATAGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038803716_1038803720 0 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803720 8:30771949-30771971 AATACTCAAGGATAGTTTGGTGG No data
1038803717_1038803720 -4 Left 1038803717 8:30771930-30771952 CCACGCAGAAGAGGGAGTTAATA No data
Right 1038803720 8:30771949-30771971 AATACTCAAGGATAGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038803720 Original CRISPR AATACTCAAGGATAGTTTGG TGG Intergenic
No off target data available for this crispr