ID: 1038803722

View in Genome Browser
Species Human (GRCh38)
Location 8:30771956-30771978
Sequence AAGGATAGTTTGGTGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1772
Summary {0: 42, 1: 106, 2: 280, 3: 515, 4: 829}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038803716_1038803722 7 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803722 8:30771956-30771978 AAGGATAGTTTGGTGGGCAGAGG 0: 42
1: 106
2: 280
3: 515
4: 829
1038803717_1038803722 3 Left 1038803717 8:30771930-30771952 CCACGCAGAAGAGGGAGTTAATA No data
Right 1038803722 8:30771956-30771978 AAGGATAGTTTGGTGGGCAGAGG 0: 42
1: 106
2: 280
3: 515
4: 829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038803722 Original CRISPR AAGGATAGTTTGGTGGGCAG AGG Intergenic
901290898 1:8123563-8123585 AAAGATAATTTGGTGGGTAGGGG + Intergenic
901383705 1:8892708-8892730 GAGGATAATTTGGTGGGTGGGGG - Intergenic
901411383 1:9086707-9086729 AAAGATAGTTTGGTGGGCAGTGG + Intronic
901702214 1:11051505-11051527 AAGGATAACCTGGTGGGTAGGGG + Intergenic
902453718 1:16516325-16516347 AAAGATAGTTTGGTGGGGAGGGG + Intergenic
902473772 1:16668989-16669011 AAAGATAGTTTGGTGGGGAGGGG + Intergenic
902485031 1:16738453-16738475 AAAGATAGTTTGGTGGGGAGGGG - Intergenic
902498766 1:16893936-16893958 AAAGATAGTTTGGTGGGGAGGGG - Intronic
902692096 1:18116379-18116401 AAGGATACTTTGTTAGGAAGTGG - Intronic
902738846 1:18420163-18420185 ATAGATAGTTTGGTGAGCAGGGG + Intergenic
903055126 1:20630997-20631019 ATGGATAATTTGGTGAGTAGGGG - Intergenic
903817947 1:26078840-26078862 AAAGATAATTTGGTGAGTAGGGG - Intergenic
904112465 1:28136931-28136953 AAGGATAATTTGGTGAGCTGGGG + Intergenic
904531518 1:31172863-31172885 AAGGATAATTTAGTGGGTAGGGG - Intergenic
904532734 1:31180143-31180165 AATGATAGATTGGAGGGTAGTGG + Exonic
905494658 1:38375328-38375350 AAGGATTGTTTGGTGGGAAGGGG + Intergenic
905563842 1:38947784-38947806 AAGGATAATTTGGCAGGCAGGGG - Intergenic
906019785 1:42617586-42617608 AAGGAAAATTTGGTGGGTAGGGG + Intronic
906304967 1:44712017-44712039 AAGAATAGTGTGGTGGTGAGGGG - Intronic
906330923 1:44883613-44883635 AAGGATGGTTTGGTGGGCAGGGG - Intronic
906394067 1:45445242-45445264 GAGGATAGTTTGGCAGGCAGGGG - Intronic
906454410 1:45981388-45981410 AAGGATAGTTTGGTGGGCAGGGG + Intronic
906515560 1:46437044-46437066 GTGGGTAGTTGGGTGGGCAGAGG - Intergenic
906758581 1:48347952-48347974 AAGGATGCTTTGGTGGTCAGGGG - Intronic
907081862 1:51631078-51631100 AAAGATAGTTTGGTGTGCTGGGG + Intronic
907120932 1:52007343-52007365 AAGGATAATTTGGAGGGTGGGGG + Intergenic
907133700 1:52119609-52119631 AAAGATAATTTGGCGGGTAGGGG - Intergenic
907765177 1:57402938-57402960 AAAGCCAGTTTGTTGGGCAGGGG - Intronic
907964427 1:59315441-59315463 AAGGGAAGTGTGGTGGGGAGAGG - Intronic
908227051 1:62066789-62066811 ATGGACAGTTTGGTGGGCAGGGG + Intronic
908240345 1:62183935-62183957 AAGGATAACTTGGTGGGTTGGGG + Intergenic
909211911 1:72834886-72834908 AAGGGTAGTTTGATGGGAATAGG - Intergenic
909327920 1:74375721-74375743 AAGGAAAACTTGGTGGGTAGGGG - Intronic
909330491 1:74404014-74404036 AAGGACATTGGGGTGGGCAGTGG - Intronic
909755201 1:79217179-79217201 AAATATAGTTTGGTGCTCAGTGG - Intergenic
910096504 1:83528511-83528533 ATGGAGAGTGTGGTGTGCAGGGG - Intergenic
910136586 1:83979218-83979240 AAGAATAGTTTAGTAGGCAAGGG + Intronic
910195566 1:84636439-84636461 AAGGATGGTTTGGCAGGCAAGGG + Intergenic
910458776 1:87426033-87426055 AAAGATAATTTGGGGGGCGGGGG + Intergenic
910725383 1:90332700-90332722 AAGGATAGTGTGGAGGGTGGAGG + Intergenic
910794475 1:91084380-91084402 AAGGATAACTTGGTGGGTGGGGG - Intergenic
910795182 1:91090811-91090833 AAGGATAACTTGGTGGGTGGGGG - Intergenic
911592845 1:99767737-99767759 AAAGATAATTTGGCGGGTAGGGG + Intergenic
911691400 1:100838716-100838738 AAGGATAGTTTGGGGGACAGAGG - Intergenic
911798137 1:102099748-102099770 AGGGATAATTTGGTGGGTAGGGG - Intergenic
912020552 1:105103912-105103934 AAAGATAGTTTGATGGGCAGGGG - Intergenic
912020837 1:105107602-105107624 AAGGATAATTTTGTGGGCGGGGG - Intergenic
912146381 1:106799072-106799094 ATGGATAATTTGGTGGGCAGGGG + Intergenic
912583689 1:110742524-110742546 AAAGATAATTTGGCGGGCAGAGG + Intergenic
912824547 1:112893802-112893824 GAGGATAATTTGGTGGGTGGGGG + Intergenic
912988440 1:114458574-114458596 AAGGATAGTTTGGTGGGCAGGGG - Intronic
913066296 1:115258572-115258594 ATGGATAATCTGGTGGGCAGGGG - Intergenic
914001102 1:143695092-143695114 TTGGATAGTTTGGCAGGCAGGGG - Intergenic
914001831 1:143700886-143700908 AAGGATAATTTGGTGGATGGGGG + Intergenic
914005838 1:143731668-143731690 AAAGACAGTTTGGTGGGGAGGGG + Intergenic
914098308 1:144562910-144562932 AAAGACAGTTTGGTGGGGAGGGG + Intergenic
914198941 1:145467327-145467349 AAGGATAATTTGGTGGCTGGGGG + Intergenic
914300672 1:146374705-146374727 AAAGACAGTTTGGTGGGGAGGGG - Intergenic
914377643 1:147086282-147086304 AAGGATAATTTGGTGGGTGGGGG + Intergenic
914478053 1:148040463-148040485 AAGGATAATTTGGTGGCTGGGGG + Intergenic
914502797 1:148262360-148262382 AAGGATAATTTGGTGGTTGGGGG - Intergenic
914511063 1:148332452-148332474 AAGGATAGTTTGGCAGGCAGGGG - Intergenic
914511507 1:148336299-148336321 AGGGATAATTTGGTGGGTGGGGG + Intergenic
914513991 1:148358006-148358028 TAGGATAGTTTGGCAGGCAAGGG - Intergenic
914518017 1:148390689-148390711 AAAGACAGTTTGGTGGGGAGGGG + Intergenic
914930023 1:151922689-151922711 AGGGATAATTTGGTGGGTAGAGG + Intergenic
914930088 1:151923148-151923170 AAGGACAGCTTGGAGGGTAGAGG + Intergenic
915529189 1:156493710-156493732 AAGGAAAACTTGGTAGGCAGAGG - Intronic
915640921 1:157225425-157225447 AAGGATAGTTTGGTGGGTACGGG + Intergenic
916041957 1:160969266-160969288 AAAGGTAGTTTGGTGGGCAGGGG - Intergenic
916231235 1:162543531-162543553 AAGCATAATTTAGTGGGCATGGG + Intergenic
916409210 1:164528636-164528658 AAGGATAATTTGGTGGACAAGGG + Intergenic
916688308 1:167167666-167167688 AAGGACAACTTGGTGGGCAGGGG + Intergenic
916895954 1:169162128-169162150 ATGGACAATTTGGTGGGCAAGGG - Intronic
916918437 1:169437073-169437095 AAGGACAATTTGGTGGGTGGGGG + Intronic
916945290 1:169720154-169720176 AAGGATAATTTGGCAGGCAGAGG - Intronic
916974701 1:170063474-170063496 AAGGACAGTTTGGAGGGCAGAGG - Intronic
917071817 1:171159714-171159736 AAGGATAGTTTGGTAGTCAGGGG + Intronic
917200966 1:172514883-172514905 AAGGACAGCTTGGTGGGTGGGGG - Intergenic
917296785 1:173528036-173528058 AAGTCTAGTTTGGTGTGAAGGGG - Intronic
917472111 1:175334721-175334743 ATGGATAATTTGGTGGGCAAGGG - Intronic
917557290 1:176102950-176102972 TAGGATAATTTGGTGGGTGGGGG - Intronic
917899819 1:179531030-179531052 CAAGATAGTTTGGTAGGCAGGGG + Intronic
918075893 1:181171279-181171301 AAGGTTATTTTGGCAGGCAGGGG + Intergenic
918452549 1:184673519-184673541 AAGGATAATTTGGTGGGTGGGGG - Intergenic
918621564 1:186611533-186611555 ATGGATAATTTGGTGGGCAAGGG - Intergenic
919276767 1:195428397-195428419 AAAGATAGTTTGGCAAGCAGGGG + Intergenic
919540833 1:198843347-198843369 ATGGATAATTTGGCAGGCAGTGG + Intergenic
919771950 1:201167308-201167330 AAAGGTAGTTTGGTGGGCAGGGG + Intronic
919828054 1:201517979-201518001 AAGGATAATTTGGTGTGTAGGGG - Intergenic
920801905 1:209196214-209196236 AAGTATAATTTGGTAAGCAGGGG - Intergenic
920927863 1:210359601-210359623 AAGGATAATTTGGCAGGTAGAGG - Intronic
921278561 1:213543281-213543303 AAGGATGGATTGGAGGCCAGCGG + Intergenic
921403867 1:214757516-214757538 ATGGATAATTTGGTGGGCAGGGG + Intergenic
921420977 1:214947950-214947972 AAGGATAATTTGGTGGGTAGGGG + Intergenic
921521155 1:216155587-216155609 ATGGATAATTTAGTGGGCAGAGG - Intronic
921771258 1:219042408-219042430 ATGGATAATTTGGTGGGCAGGGG - Intergenic
921883092 1:220276055-220276077 AAGGATAACTTGGTGGGTGGGGG - Intergenic
922107077 1:222521837-222521859 ATGGATAGTTTGGTGGGGGAGGG - Intergenic
922154953 1:223033771-223033793 AAGGATAGTTTGGCAGGCACAGG + Intergenic
922160415 1:223075559-223075581 AAGGATAATTTGGTGGGTAGGGG + Intergenic
922190612 1:223315514-223315536 AACGATAGTTTGGCGGGCCAGGG - Intronic
922203838 1:223429634-223429656 AAGGATATTTTGGGCTGCAGAGG - Intergenic
922334199 1:224605806-224605828 AAAGATAGTTTGGTGGGCAGGGG - Intronic
922389083 1:225120141-225120163 AAGGATAATTTGGCAGGTAGGGG + Intronic
922978518 1:229804964-229804986 AAAGATAGTTTGGCCTGCAGGGG + Intergenic
923057123 1:230435307-230435329 ATGGATAGTTTCTTGGGCAGAGG - Intergenic
923110272 1:230884698-230884720 AAGAATGATTTGGTGGGCAGGGG - Intergenic
923250843 1:232178482-232178504 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
923328622 1:232902107-232902129 AAGAATAACTTGGTGGGTAGGGG + Intergenic
923382336 1:233434145-233434167 AAGGATAGTTTGGCAGGCCAGGG + Intergenic
923387227 1:233477082-233477104 AAGCATAGTTTGGGGGGAGGTGG - Intergenic
923388478 1:233489737-233489759 ATGGAAAATTTGGTGGGCAGGGG - Intergenic
923467029 1:234258153-234258175 AAGAATAGTTTGGTGGGCAAGGG + Intronic
923483716 1:234408746-234408768 AAGGATAATTTGGTGGGAGGGGG - Intronic
923702811 1:236316157-236316179 GAGGATAATTTGGTGGGTAGGGG - Intergenic
923709053 1:236370545-236370567 AAGGATGACTTGGTGGGTAGGGG + Intronic
923779439 1:237009125-237009147 CAGGATAGTATGGGGGGCAGGGG - Intergenic
923861359 1:237894983-237895005 AAGCATAGTTTGGTGGGCAGGGG + Intergenic
923876462 1:238054420-238054442 AAGAATAGTTTGGCAGTCAGAGG - Intergenic
924200456 1:241653115-241653137 AAGGAGAATATGGTGGACAGTGG + Intronic
924512112 1:244736245-244736267 AAGGATAATTTGGTGGGTTGAGG + Intergenic
924512624 1:244740341-244740363 AAGGATAATTTGGTGGGCGGAGG - Intergenic
924651053 1:245927767-245927789 AAGGATAGGTTGCTGGGGAGAGG + Intronic
924666895 1:246082532-246082554 ATGGACAGTTTGGCGGGCAAGGG - Intronic
1063155042 10:3371607-3371629 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1063221276 10:3970636-3970658 AAAGATAATTTGGTGAGTAGGGG - Intergenic
1063330193 10:5150993-5151015 AAGAATAACTTGGTGGGTAGGGG + Intergenic
1063482791 10:6391131-6391153 AAGGATAATTTGGTGGGTGAGGG - Intergenic
1064103330 10:12481409-12481431 AAAGATAGTTTGGTGGGTCAAGG - Intronic
1064648168 10:17481570-17481592 ATGGATAATTTGGTGGATAGGGG + Intergenic
1064691182 10:17920055-17920077 AAGGATTATTTGATGGGTAGGGG - Intergenic
1064766999 10:18685212-18685234 AAAGATAATTTGGTAGGTAGGGG - Intergenic
1064804874 10:19119446-19119468 AAGGATAACTTGGTGGGTTGGGG + Intronic
1065007746 10:21395334-21395356 AAGGATAATTTGGCAGGGAGGGG - Intergenic
1065168348 10:23004107-23004129 AAAGACAGGTTGGAGGGCAGTGG - Intronic
1065207899 10:23374545-23374567 ATGGACAATTTGGTGGGAAGGGG + Intergenic
1065217056 10:23459336-23459358 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1065247076 10:23769148-23769170 AAGGACAGTTTGATGGGTAGGGG + Intronic
1065493737 10:26308269-26308291 AAGGATAGTTTGGAGGGCCAGGG - Intergenic
1065799926 10:29342794-29342816 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
1065901327 10:30210677-30210699 AAGGATGATTTGGTGGGTAGGGG + Intergenic
1065908239 10:30278720-30278742 AAGGATAATTTGGTGGATAGGGG - Intergenic
1066207653 10:33205531-33205553 AAGGGTAATTTGTTGAGCAGGGG + Intronic
1066299420 10:34083644-34083666 AAGGAAACTTTGGTGGTGAGGGG + Intergenic
1066330568 10:34417110-34417132 ATGTACAATTTGGTGGGCAGAGG - Intronic
1066403021 10:35093164-35093186 ATGGACAATTTGGTGAGCAGGGG - Intergenic
1067098937 10:43320840-43320862 AAGCAATGTTTTGTGGGCAGGGG - Intergenic
1067104345 10:43355997-43356019 AAGGATAACTTGGTGGGTAGAGG + Intergenic
1067399926 10:45962306-45962328 AAGGATAATTTGGTGGGTTGGGG - Intergenic
1067823412 10:49550656-49550678 AAGGATAGTTTGGTGGGTAGGGG + Intergenic
1067825455 10:49569226-49569248 TAGGATAGTTTGGCAGGAAGGGG + Intergenic
1067868256 10:49931605-49931627 AAGGATAATTTGGTGGGTTGGGG - Intronic
1067895293 10:50173025-50173047 AAAGATTATTTGGTGGGTAGGGG + Intergenic
1067953692 10:50768953-50768975 AAAGATAATTTGGTGGGTAGGGG - Intronic
1067956621 10:50798049-50798071 AAGGATAGTTTGGCTGGCTAGGG - Intronic
1068089932 10:52421047-52421069 AAAGATAGTTTGGCAGGCAGTGG - Intergenic
1068149935 10:53118873-53118895 AAGGCCAGTTTGGTGGGCAAGGG - Intergenic
1068302553 10:55163117-55163139 AAGGACAGTTTGGCAGGCAGAGG - Intronic
1068522881 10:58096352-58096374 AAGGATAGTTTGGTAGGCAGGGG - Intergenic
1068526677 10:58138292-58138314 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1068527247 10:58144260-58144282 AGGGATAGTTTAGTGGGCAGGGG - Intergenic
1068596378 10:58906531-58906553 AAGGATTGTTTGATGGGAAGAGG - Intergenic
1068751264 10:60595331-60595353 AAAGAGAGTTTGGCAGGCAGGGG + Intronic
1069112223 10:64462245-64462267 AAGGGCAGGTTGGTGAGCAGGGG - Intergenic
1069134428 10:64746225-64746247 GAGAATAGTTAGGTGGGCAAAGG + Intergenic
1069323681 10:67204825-67204847 AAGGATAGTTTGGTGGGACAAGG + Intronic
1069806515 10:71128597-71128619 AAAGATAGCTTGGTGAGCAGGGG - Intergenic
1069935001 10:71909324-71909346 AAGGACAGTTTGGTGGGCAGGGG + Intergenic
1069996474 10:72344931-72344953 AAAGGTAGATGGGTGGGCAGGGG - Exonic
1070016794 10:72541620-72541642 ATGGATAGTTTGGTGGGCAGGGG - Intronic
1070047316 10:72851495-72851517 AAGGATAGTTTGGTGGGCAGGGG + Intronic
1070123088 10:73597580-73597602 AAGGCTACTTTGGTGGTTAGAGG - Intronic
1070510543 10:77156921-77156943 CAGGATGGTTTGGTGGGCAGGGG - Intronic
1070899590 10:80016465-80016487 AAGGATAGTTTGGCAGGTAAGGG - Intergenic
1071054883 10:81498108-81498130 AAGGGTACTTTGGCGGTCAGGGG + Intergenic
1071217514 10:83425406-83425428 AAGAATAGTTTGGTAGGCAGAGG + Intergenic
1071219360 10:83445658-83445680 ATGGACAATTTGGTGGGCAGGGG - Intergenic
1072118470 10:92385746-92385768 AAGAGTACTTTGGTGGGCAGGGG + Intergenic
1072121342 10:92407798-92407820 AAGGGTAATTTGGTGGGTGGGGG + Intergenic
1072248001 10:93560026-93560048 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1072275684 10:93820472-93820494 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1072419209 10:95275238-95275260 AAAGATAGTTCGGCAGGCAGGGG - Intronic
1072584653 10:96770700-96770722 ATGGATAGCTCAGTGGGCAGGGG + Intergenic
1072584848 10:96772515-96772537 ATGGCAAATTTGGTGGGCAGGGG - Intergenic
1072588375 10:96803283-96803305 GTGGACAATTTGGTGGGCAGGGG - Intergenic
1072767420 10:98106846-98106868 AAGGACACTTTGGAGGGCAGGGG - Intergenic
1072770373 10:98132882-98132904 ATGGACATTTTGGTGGGCAGGGG + Intergenic
1072972367 10:100028422-100028444 ATGGACAATTTGTTGGGCAGGGG - Intergenic
1073748531 10:106497465-106497487 AAGGATAGTTTGATGGTCCGGGG - Intergenic
1073931381 10:108580572-108580594 AAGAATAGTTTGGTGGGTGGGGG - Intergenic
1074011828 10:109489995-109490017 ATGGACAATTTGGTGGGAAGGGG - Intergenic
1074299470 10:112220223-112220245 TAGGATAGTTTGGTGGGCCAGGG - Intergenic
1074515853 10:114168672-114168694 AAGGATAATTTGGTGGGCAGGGG - Intronic
1074710390 10:116172560-116172582 AAGAATGGGTTGGGGGGCAGAGG + Intronic
1075243584 10:120800120-120800142 AAAGATAGTTTGGTGGGCAGGGG - Intergenic
1075601249 10:123771182-123771204 AAGGAGAGTGTTCTGGGCAGAGG - Intronic
1075628075 10:123978310-123978332 AAAGATAGTTTGGTGAGCAGGGG + Intergenic
1075883528 10:125876205-125876227 AAGGATAGTTTGGTGGGCAGGGG - Intronic
1075887206 10:125911118-125911140 AAGGATTGTGAGATGGGCAGAGG + Intronic
1075975727 10:126692412-126692434 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1076099693 10:127766190-127766212 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1076105790 10:127822737-127822759 AAGTATAGCTTGGTGGGCAGAGG - Intergenic
1076436680 10:130451005-130451027 AAGCATTGTTTGGTGGGCAATGG - Intergenic
1076653678 10:132007180-132007202 AAGGACAATGTGGTGGGTAGGGG + Intergenic
1076823682 10:132956406-132956428 AAGGATAATTTGATGGGCAGGGG - Intergenic
1076901937 10:133343645-133343667 AAGGATAATTTGGTGGGTAGGGG + Intronic
1077085161 11:746590-746612 AAGAATAATTTGGTGGGTAGGGG - Intergenic
1077335918 11:2004308-2004330 AAGGATCATTTGGTGGGTAGGGG - Intergenic
1077790016 11:5429187-5429209 AAGGGTAGTTTGGTGGGCAGGGG - Intronic
1077885411 11:6383864-6383886 TAGGATAATTTGGTGGGTAGGGG - Intergenic
1078176426 11:8974907-8974929 AGGGATAGATTGGGGGGCAGAGG - Intergenic
1078408407 11:11091497-11091519 AAGGATAATTTGGCAGACAGGGG - Intergenic
1078410067 11:11107333-11107355 AAGAATAATTTGGTGGGTTGGGG - Intergenic
1078751145 11:14164769-14164791 AAGGATAACTTGGTGGGTGGGGG + Intronic
1078752421 11:14177350-14177372 AAGGATAGCTTGGTGGGTAGAGG + Intronic
1078827356 11:14941948-14941970 TAGGATAATTTGGTGGGTAGGGG + Intronic
1078834246 11:15011796-15011818 AAGGATAATTTGGTGGGTAGGGG + Intronic
1078835691 11:15027031-15027053 AAGGATAATTTGGTGGGTAGGGG + Intronic
1079232234 11:18658757-18658779 AAGAATAATTTGGTGGGTAGAGG - Intergenic
1079563723 11:21854502-21854524 AAGGACAGTTTGGTGGGCAGGGG + Intergenic
1079613088 11:22457303-22457325 AAGTACAATTTGGTGGGTAGAGG - Intergenic
1079645079 11:22852683-22852705 AAGGATAGTTTTGTGGGCAGGGG - Intronic
1079725281 11:23872749-23872771 AAGGATAGTTTGGTAGGCAGAGG - Intergenic
1079884790 11:25973479-25973501 AAGGATAATTTGGTAGGTAAGGG - Intergenic
1079891248 11:26055786-26055808 AAGAATAATTTGGTGGGTAGGGG - Intergenic
1080028751 11:27638585-27638607 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1080219294 11:29881620-29881642 AAGGGTGGTTTAGTGGGCAGGGG - Intergenic
1080224661 11:29947269-29947291 AAGGATAATTTGACAGGCAGGGG + Intergenic
1080250395 11:30227173-30227195 ATGGATAATTTGGTGGGCAGGGG + Intergenic
1080649120 11:34209022-34209044 AAGGATAGTTAGATGTGCAAAGG - Intronic
1080703443 11:34666002-34666024 AAGGATAACTTGGTGGGTGGAGG - Intergenic
1080812384 11:35717481-35717503 AAGGATAATTTGGCAGACAGGGG - Intronic
1080982664 11:37427130-37427152 TAGTATAGTTTTGTGGGTAGGGG + Intergenic
1080990868 11:37533168-37533190 AAGGATAATTTGGTAGGTAAGGG + Intergenic
1081151984 11:39644212-39644234 GAGGATAGTTTGGTGAGTAGGGG - Intergenic
1081185076 11:40032481-40032503 AAGGATAGTTTGGAGGGCAAGGG + Intergenic
1081395801 11:42585055-42585077 AAGGATAATTTGGTCAGTAGGGG + Intergenic
1081488564 11:43549481-43549503 AAGGATAATTTGATGGGTAGAGG - Intergenic
1081530504 11:43955556-43955578 AAGGATAGTTGGGTGGGCCACGG + Intergenic
1081530866 11:43958435-43958457 CAGGATAATTTGGTGGGTAGGGG - Intergenic
1081724577 11:45319182-45319204 AAGGATAATTTGTTGTGCAGGGG + Intergenic
1081809872 11:45908734-45908756 GAGGATGCTTTGGTGGGCAGAGG - Intergenic
1081956828 11:47100025-47100047 AAGCATGGTGTGGTGGGCAGTGG - Intronic
1082051799 11:47776525-47776547 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1082652397 11:55809367-55809389 AGGGACAATTTGGTGGGAAGTGG + Intergenic
1082685720 11:56236691-56236713 AAAGATAGTTTGATGGGCAGAGG - Intergenic
1083084355 11:60127277-60127299 AAGGATAGTTTGGTTTGTAAGGG + Intergenic
1083107229 11:60369852-60369874 AAGGATAATTTGGTGAGTAAGGG - Intronic
1083262881 11:61532616-61532638 AGGGAAAGGCTGGTGGGCAGAGG - Intronic
1083539212 11:63500485-63500507 AAGGATAGTTTGGCAGGCCAGGG - Intergenic
1084181257 11:67447624-67447646 AAGGATAACTTGGTGGGTGGTGG - Intergenic
1084359958 11:68662771-68662793 AAGGATAGTTTGGCAAGCAGGGG + Intergenic
1084405852 11:68972729-68972751 AAAGATCATTTGGTGGGTAGGGG + Intergenic
1084709438 11:70834981-70835003 ATGGCTATTTTGGGGGGCAGCGG + Intronic
1084710659 11:70841924-70841946 AAGGATGGTTTGGGAGGCTGTGG - Intronic
1084932754 11:72570231-72570253 AAGTATAGTTTGGTGGGCAGGGG - Intergenic
1085363642 11:75916732-75916754 AAGGATAGTTTGGTAGGCAGAGG + Intronic
1085416762 11:76323677-76323699 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1085505641 11:77057111-77057133 AAGAATAATTTGGTGGGTAGGGG + Intergenic
1085580353 11:77644681-77644703 AAGGATAATTTGGTGGGTATGGG + Intergenic
1085689204 11:78651850-78651872 AAGGATAGTGTAGTTGGCAGCGG + Intergenic
1085746891 11:79122735-79122757 ATGGACAGTTGTGTGGGCAGTGG - Intronic
1086068036 11:82767424-82767446 AAGGACAGCTTGGTGGGTGGGGG - Intergenic
1086312833 11:85554988-85555010 AAGGATACTTTGGTGGGCAGGGG - Intronic
1086350367 11:85937775-85937797 TTGGATAATTTGGTGAGCAGGGG + Intergenic
1086576047 11:88340052-88340074 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1086794272 11:91081182-91081204 AAGGGTAGGGTGGGGGGCAGTGG - Intergenic
1086881940 11:92159866-92159888 AAAAATAGTTTGGTAGTCAGGGG + Intergenic
1087643526 11:100781378-100781400 AAGGAGACTTTGGTGAGCATGGG + Intronic
1087797838 11:102473087-102473109 AAGGATAATTTGGTGGATGGGGG + Intronic
1087870495 11:103287960-103287982 AAAGATGATTTGGTGGGTAGGGG + Intronic
1087886949 11:103492916-103492938 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1087887076 11:103493855-103493877 AAGGATAATTTGGTGGGTGAAGG - Intergenic
1087971952 11:104494929-104494951 AAGGATAATTTGGTAGGTGGGGG - Intergenic
1088221752 11:107577281-107577303 AAAGATAATTTGGTGGGTAAGGG - Intergenic
1088312127 11:108471098-108471120 AAGGACAATTTGGTGGGTAGGGG + Intergenic
1088412012 11:109544595-109544617 AAAGAGAGTTTGCTGGGCATGGG - Intergenic
1088422859 11:109668174-109668196 AAGGATAATTTGGTGAGTAGGGG + Intergenic
1088507827 11:110543039-110543061 AAGGAGAGTGTTGTGGCCAGTGG + Intergenic
1088801818 11:113313876-113313898 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1088846836 11:113675354-113675376 AAGAATACTTGGGTGTGCAGTGG + Intergenic
1089192674 11:116665007-116665029 AAGCAGAGTTTTGTGGGCTGGGG - Intergenic
1089389706 11:118092354-118092376 AAGGATAACTTGGTGGGTGGGGG + Intronic
1089956547 11:122576581-122576603 AAAGATAGTTTGGTGGACAAGGG + Intergenic
1090288407 11:125520153-125520175 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
1090844367 11:130518609-130518631 AGGGATAGCTTGGTGGGCAGGGG - Intergenic
1091099296 11:132855335-132855357 ATGGATAATTTGGTGAGCAGGGG - Intronic
1091160924 11:133419043-133419065 AAGGATAGTTTGGTGGGCAGGGG - Intronic
1202818902 11_KI270721v1_random:59490-59512 AAGGATCATTTGGTGGGTAGGGG - Intergenic
1091757418 12:3063382-3063404 AAGGAATGTTTGCTGGGTAGGGG - Intergenic
1091757430 12:3063462-3063484 AAGGATAGTTTGGTGGGTAGGGG - Intergenic
1092270879 12:7022316-7022338 AAAGACAGTTTGGTGGGCAGGGG - Intronic
1092623696 12:10302594-10302616 ATGGACAATTTGGTGGGCAGGGG + Intergenic
1092938207 12:13383663-13383685 ATGGATAATCTGGTGGGCAGGGG - Intronic
1093101037 12:15029705-15029727 AAAGATAATTTGGTTGGTAGTGG + Intergenic
1093197448 12:16145548-16145570 AAGGATAGTTTGTCAGGCAGGGG - Intergenic
1093354964 12:18155484-18155506 AAAGATAATTTGGTGAGCAGGGG - Intronic
1093616727 12:21234116-21234138 AAAGATAATTTGGTGGGTAGGGG + Intronic
1093691471 12:22114378-22114400 AAAGATAATTTGGTGGGTTGGGG - Intronic
1093700354 12:22213184-22213206 AAGGATAATTTGGTGGGCAGGGG - Intronic
1094212140 12:27904004-27904026 AAGGATAATTTGGCAGGTAGGGG + Intergenic
1094234541 12:28148568-28148590 AAGAATAATTTGGCAGGCAGGGG + Intronic
1094353338 12:29550741-29550763 CAGCATAGTTTGGTGAGCAATGG + Intronic
1094366766 12:29691381-29691403 AAGGATAATCTGGCGGGTAGGGG - Intronic
1094430955 12:30368651-30368673 AAGGATAACTTGGTGGGTTGGGG + Intergenic
1094482904 12:30899114-30899136 AAGGATAATTTGGCAGGCATGGG - Intergenic
1094580995 12:31733801-31733823 AAGGATAAATTGGTGGGTTGGGG + Intergenic
1095215631 12:39544120-39544142 AAGGATAACTTGGTGGGTGGGGG + Intergenic
1095360802 12:41336708-41336730 AAAGATAATTTGGTGGGTTGGGG + Intronic
1095422417 12:42039244-42039266 ATGGATAATTTGGCAGGCAGGGG + Intergenic
1095636179 12:44436216-44436238 AAGAAGAGTTTAGTGGGAAGGGG + Intergenic
1095887568 12:47205119-47205141 AAGGATAATTTGATGGGTAGGGG + Intronic
1095887676 12:47205965-47205987 AAGGACAATTTGGTGGGTTGGGG + Intronic
1096048467 12:48585427-48585449 AGGGATAGTTTGGTAGGCAGGGG - Intergenic
1097339592 12:58422287-58422309 AAGGATAATTTGGCAGGTAGGGG + Intergenic
1097340652 12:58434077-58434099 AAGGACAATTTGGTGGATAGGGG + Intergenic
1097792572 12:63830301-63830323 AAGGATAATTTGATGCGCAGGGG + Intergenic
1097931713 12:65194411-65194433 AAGGATAGTTTGGTGGACAAGGG + Intronic
1097979013 12:65717871-65717893 AAGGATAATTTGGAAGGTAGGGG - Intergenic
1098132679 12:67366863-67366885 AATGATAGCTTGGCAGGCAGAGG - Intergenic
1098198172 12:68024391-68024413 AAGGATGGTGAGGTGGGCAAGGG - Intergenic
1098282781 12:68878598-68878620 AAGGATAATTTTGTGGGTTGGGG - Intronic
1098291937 12:68964782-68964804 AAGGATACCTTGGTGGGTAGGGG - Intronic
1098631070 12:72721920-72721942 AAGGACAGTTTGGTGGAAGGGGG - Intergenic
1098729261 12:74012031-74012053 AAAGATAATTTGGCGGGTAGGGG - Intergenic
1098864711 12:75748481-75748503 AAAGATAATTTGGCGGGTAGGGG - Intergenic
1098901759 12:76118523-76118545 ATGGACAATTTCGTGGGCAGGGG - Intergenic
1098909966 12:76198917-76198939 AAGGATGGATTGGCAGGCAGGGG - Intergenic
1098921450 12:76305863-76305885 AAAGATAGTTTGGTGTGCAGGGG - Intergenic
1099120995 12:78689050-78689072 AAGGATAACTTGGTGGGTTGGGG - Intergenic
1099335569 12:81352346-81352368 AGGGAAAGGTGGGTGGGCAGTGG + Intronic
1099374678 12:81884804-81884826 AAGGATAGTTTGTTGAGCCTGGG + Intergenic
1099666856 12:85642150-85642172 AAGGATAGTTTGGCAGGCAGGGG - Intergenic
1099799550 12:87440479-87440501 AAGGATAATTTGGAGGGCAGGGG - Intergenic
1099809882 12:87567612-87567634 AAGGATATTTTGATGGGCAGGGG + Intergenic
1100262254 12:92943356-92943378 AAGGATAGTTTGGTGGGTAGAGG - Intergenic
1100284189 12:93149290-93149312 AAGGATAGTTTGGTGGGCCAGGG + Intergenic
1100294577 12:93248820-93248842 AAGGATAATTTGGTGGGTGGGGG + Intergenic
1100426740 12:94494593-94494615 AAAGATAGTTTGGTGGGCACAGG - Intergenic
1100705654 12:97197568-97197590 ATGAATAATTTGGTGGGCATGGG - Intergenic
1100759623 12:97792794-97792816 ATGGACAATTTGGTGGGCAGGGG + Intergenic
1100782700 12:98046496-98046518 AAGGAGAGGTGGGTGGGGAGAGG - Intergenic
1100829113 12:98501946-98501968 AAGGATAATTTGTTGGGTAGGGG + Intronic
1100881111 12:99017649-99017671 GTGGACAATTTGGTGGGCAGGGG - Intronic
1101132154 12:101699835-101699857 AAGGATAGCTGGGTTGGAAGTGG + Intronic
1101219850 12:102627222-102627244 AAAGATAGTTTGGTGGGCAGGGG - Intergenic
1101569932 12:105944397-105944419 AACCATATTTTGCTGGGCAGTGG - Intergenic
1101912614 12:108871803-108871825 AAGGGTAATTTGGTGGGTAGGGG - Intronic
1102075366 12:110055701-110055723 AAGGATAACTTGGTGGGTTGGGG + Intronic
1102192847 12:111002024-111002046 AAGGATAATTTGTTGGGTAGGGG + Intergenic
1102605211 12:114063203-114063225 AAGCAATGTTTTGTGGGCAGGGG - Intergenic
1102740758 12:115205568-115205590 AAGGATAATTTGGAGGGTGGGGG - Intergenic
1102963020 12:117105822-117105844 AAGGATACTTTGGTGGGCAGGGG - Intergenic
1103133694 12:118489681-118489703 AAGGATAATTTGGTGGGCAGGGG - Intergenic
1103243082 12:119431275-119431297 AAGGATAATTTGGAGGGTGGAGG + Intronic
1103246222 12:119459814-119459836 AATGATAGCTTGGTGGGCAGGGG - Intronic
1103305046 12:119957445-119957467 AAGGATAGTTTGGTTGGCCAGGG + Intergenic
1103539682 12:121657506-121657528 AAGGATAACTTGGTGGGTGGGGG - Intronic
1103539757 12:121658057-121658079 AAGGATAACTTGGTGGGTGGGGG - Intronic
1103618001 12:122167299-122167321 AAGGGTTGTTTGGTGGGCAGAGG - Intergenic
1103681421 12:122697021-122697043 AAGGCTAATTTGGTGGGTAGGGG + Intergenic
1104197381 12:126554036-126554058 AAGGATATTTTGGTGGGTAGGGG + Intergenic
1104320367 12:127745134-127745156 AAGGATAATTTGGTGGGTGGGGG + Intergenic
1104355625 12:128082693-128082715 AAGGATAATTTGGTGGGTGGGGG - Intergenic
1104364938 12:128168243-128168265 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1104541557 12:129670580-129670602 AAGGATAACTTGGTGGGTAGGGG - Intronic
1104563779 12:129862026-129862048 AAGGATAGTTTGGTGGGCAGAGG - Intronic
1104641045 12:130467501-130467523 AAGGATAATGTGGTGGCTAGGGG - Intronic
1104784787 12:131442633-131442655 AAAGATAGTTTGGTGGGTCGAGG - Intergenic
1104808681 12:131606283-131606305 AAGGATAATTTGGTGGGTAGAGG + Intergenic
1104952253 12:132446519-132446541 AAAGATAGTTTGGCAGGCAGGGG - Intergenic
1105348775 13:19597956-19597978 AGGGATAATTTGGTGGGTAGGGG - Intergenic
1105873237 13:24528997-24529019 AAGGATAGTTTGGTCAGTAGGGG - Intergenic
1106005957 13:25770478-25770500 AAGGATAACTTGGTGGGTGGGGG - Intronic
1106122908 13:26876476-26876498 AAGGACAGTTTGGCAGGTAGGGG + Intergenic
1106164518 13:27231121-27231143 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1106229262 13:27809187-27809209 AAGGATAATTTGGTAGGTACAGG - Intergenic
1106459959 13:29959950-29959972 AAGGATAACTTGGTGGGCAGGGG + Intergenic
1106576819 13:30982390-30982412 AAGGATAGTTTGGCGGGTAGGGG - Intergenic
1106590529 13:31094679-31094701 AAGGATAATTTGGTGGGTATGGG + Intergenic
1106612899 13:31300524-31300546 TTGGATAATTGGGTGGGCAGGGG + Intronic
1106928084 13:34633852-34633874 CAGGATAGTTTCATAGGCAGGGG - Intergenic
1107021591 13:35757750-35757772 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1107426267 13:40296219-40296241 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1107427339 13:40306961-40306983 AAGGATAGTTTAGTGGGCGGGGG + Intergenic
1107481166 13:40787506-40787528 AGGGATAATTTGGTGGGTAGGGG - Intergenic
1107664523 13:42675095-42675117 AAGAATAATTTGGTGGGTAGTGG + Intergenic
1107868581 13:44727105-44727127 AAGGGTAATTTGGTGGGTAGGGG - Intergenic
1107868670 13:44727854-44727876 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1108027313 13:46191509-46191531 AAGGATAGATTGGTGGTCACGGG - Intronic
1108253335 13:48588395-48588417 AACAATAGTTTGGTGGGCAGGGG - Intergenic
1108315770 13:49235779-49235801 ATGGATAATTTGGTGGGCAGGGG + Intergenic
1108352805 13:49602715-49602737 AAAGACAGTTTGGTGGGTACAGG + Intergenic
1108414905 13:50187875-50187897 AAGGTCAGTGTGGTGTGCAGGGG - Intronic
1108584338 13:51856073-51856095 ATAGATGATTTGGTGGGCAGGGG + Intergenic
1108846036 13:54679289-54679311 AAAGATAGTTTGGTGGGTAGGGG - Intergenic
1108871941 13:54998785-54998807 AAGGATTATTTGTTGTGCAGGGG + Intergenic
1108944801 13:56008783-56008805 AAGTATGGTTTGGTGGAAAGTGG + Intergenic
1109054898 13:57534589-57534611 ATGGATAATTTGGTAAGCAGGGG + Intergenic
1109163004 13:58999943-58999965 AAGGACAATTTAGTGGGTAGGGG + Intergenic
1109300354 13:60584545-60584567 AATGATAATTTGGTGGGTGGGGG - Intergenic
1109300918 13:60589279-60589301 AAGGATAATTTGGTGGGTAAGGG - Intergenic
1109690508 13:65881835-65881857 AAGGATAATTTGGGTGGCAGGGG + Intergenic
1110380823 13:74848485-74848507 ATGGATAATTTCGTGGGCAGAGG - Intergenic
1110509892 13:76337186-76337208 AAGGATATTTTGGGGGGTTGAGG + Intergenic
1110911964 13:80976675-80976697 AAAGATAGTTTGGTGGGCAGGGG - Intergenic
1110953987 13:81529848-81529870 TAAGGTGGTTTGGTGGGCAGGGG - Intergenic
1110978008 13:81864619-81864641 AAGGATAATTTGGTAGGTAGGGG - Intergenic
1111190107 13:84795777-84795799 AAGGATAATTTGGTAGGTATGGG - Intergenic
1111529428 13:89517852-89517874 AAGGATAATTTGGTGGGCAGGGG + Intergenic
1111565022 13:90002882-90002904 AAGGATAATTTGGTGGGCAGGGG + Intergenic
1111607600 13:90561212-90561234 AAGGATAACTTGGTGGGTAGGGG - Intergenic
1112019264 13:95357566-95357588 AAAGATAATTTGCTGGGTAGGGG + Intergenic
1112338616 13:98534806-98534828 AAGGATAATTTGGTGGGTAGGGG - Intronic
1112541051 13:100313427-100313449 AAGAATAATTTGGTGGGCAGGGG + Intronic
1112595866 13:100806411-100806433 AGGTATAGTTTAGTGGTCAGAGG - Intergenic
1112672790 13:101660246-101660268 AAAGATAGTTTGGTGGATAGGGG + Intronic
1112765349 13:102735981-102736003 AAGGATACATTTGAGGGCAGAGG - Exonic
1113018412 13:105855160-105855182 AAGGATAGTTTGGTGGGAAGAGG - Intergenic
1113225340 13:108153311-108153333 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
1113386997 13:109858017-109858039 AAGGACAGCTTGGTGGGCCGGGG - Intergenic
1114343661 14:21771982-21772004 ATGGATAATTTGGTGGGCAGGGG - Intergenic
1114416879 14:22550772-22550794 TAGGAGAGTTTGGTGGGCTCAGG - Intergenic
1114575520 14:23709223-23709245 AAAGATAGTTTGGTAGGCAGGGG - Intergenic
1114935486 14:27531679-27531701 ATGGACAATTTGGTGAGCAGAGG - Intergenic
1115169002 14:30481679-30481701 GAGGATAATTTTGTGGGTAGGGG - Intergenic
1115349029 14:32373287-32373309 AAGGATAACTTGGTGGGTGGGGG + Intronic
1115534243 14:34357758-34357780 AAAGATAATTTGGCGGGTAGGGG + Intronic
1115617665 14:35111848-35111870 AAGGATAGTTTGGTAGGCAGGGG - Intronic
1115646376 14:35371052-35371074 AAGTATAGCTTGGTGGGCAGGGG - Intergenic
1115658441 14:35466468-35466490 AAGGATAGTTTGGGAGGCAGGGG + Intergenic
1115704808 14:35988027-35988049 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1115767201 14:36635428-36635450 TAGGATTGTTTTGGGGGCAGTGG - Intergenic
1115992795 14:39166862-39166884 AAGGATAGTTTGGTAGGCTGGGG - Intronic
1116585445 14:46697454-46697476 AAAGATAATTTGGCAGGCAGGGG - Intergenic
1117181703 14:53198559-53198581 AAGGATAGTTTAGTGGGCCAGGG + Intergenic
1117305955 14:54473253-54473275 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1117330412 14:54706698-54706720 AAGGAGAGTCTGGAGGGGAGGGG + Intronic
1117445591 14:55800911-55800933 AAAGATAATTTGGTGTGCAAGGG - Intergenic
1117445741 14:55802147-55802169 AAAGATAGTTTGGCAGGCAGGGG - Intergenic
1117447921 14:55822334-55822356 AAGGATAATTTGGGGGGTAGGGG + Intergenic
1117632482 14:57708315-57708337 AAAGATAATTTGGTGGGTCGGGG - Intronic
1118088504 14:62445978-62446000 AAGGATAGTTTGGTGGGACAAGG - Intergenic
1118208560 14:63745982-63746004 ATGGACAATTTGGTGGGCAGTGG + Intergenic
1118354093 14:64997419-64997441 AAGGATAGTTTGGTGGGCAGGGG - Intronic
1118487576 14:66228380-66228402 AAAGATAGTTTGGCAGGCAGAGG + Intergenic
1119366791 14:74099680-74099702 AAGGATAATTTGGTGGGTTGGGG + Intronic
1119418451 14:74492150-74492172 AAGGATAATTTGGCGGGTATGGG - Intronic
1119449694 14:74698647-74698669 AAGCAAAGTATGGAGGGCAGAGG + Intronic
1119568629 14:75650215-75650237 AAGGAATGTGGGGTGGGCAGTGG - Exonic
1119752736 14:77091824-77091846 ATGGATAATTTGGTGGGCAGGGG + Intergenic
1120056489 14:79930215-79930237 AAGGATAATTTTGTGGGTGGAGG - Intergenic
1120268059 14:82276358-82276380 AAGGATAATTTGATGGGTAGGGG + Intergenic
1120401761 14:84041372-84041394 AAGGATAATTTGGTGGGCACAGG + Intergenic
1120838590 14:89063086-89063108 TAGAATAGTTTGGTGGGCAGAGG - Intergenic
1120897382 14:89545843-89545865 AAGGTTAGTTTGGGGAGCAGTGG - Intronic
1121042649 14:90761489-90761511 AAGGATAGTGTGGCAGGCAAGGG - Intronic
1121292377 14:92786439-92786461 AAAGATAGCTTGGTGGCCTGGGG - Intergenic
1121303885 14:92892905-92892927 AAGAATAGTTTGGTGGACAGGGG - Intergenic
1121658247 14:95614412-95614434 AAGGATAGTATGGTGGGCCAGGG + Intergenic
1121702532 14:95965592-95965614 CAGGACAGTTTGGTGGGCAAGGG - Intergenic
1122482806 14:102058473-102058495 AAAGAAAGTATGGTGGGCGGGGG - Intergenic
1122655598 14:103257351-103257373 AAGGATAGTTTGGTGGGCATGGG - Intergenic
1123064581 14:105610980-105611002 AAGGATGGTTTTGTGGGCCATGG + Intergenic
1123087883 14:105726204-105726226 AAGGATGGTTTTGTGGGCCATGG + Intergenic
1123093842 14:105755577-105755599 AAGGATGGTTTTGTGGGCCATGG + Intergenic
1123138633 14:106054132-106054154 AAGGATAGCTTGGTGGGTTGGGG - Intergenic
1202870914 14_GL000225v1_random:162860-162882 AAGGATTGTGAGATGGGCAGAGG - Intergenic
1123831894 15:24147855-24147877 ATAGATAGTTTTGTGGGCAGGGG + Intergenic
1123836873 15:24203872-24203894 ATAGATAGTTTTGTGGGCAGGGG + Intergenic
1123842987 15:24268294-24268316 AAGGATAATTTGGTGGGTGGGGG - Intergenic
1123846142 15:24303977-24303999 ATAGATAGTTTTGTGGGCAGGGG + Intergenic
1123858025 15:24434366-24434388 AAGGATAATTTGGTGGGTGGGGG - Intergenic
1123862655 15:24484828-24484850 AAGGATAATTTGGTGGGTGGGGG - Intergenic
1123865178 15:24511686-24511708 ATAGATAGTTTTGTGGGCAGGGG + Intergenic
1123872740 15:24593221-24593243 GTAGAGAGTTTGGTGGGCAGGGG + Intergenic
1123899020 15:24857868-24857890 AAGAATAATTTGGTGGGTAGGGG + Intronic
1124025108 15:25958695-25958717 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1124097028 15:26658239-26658261 AGAGATAGTTTGGTGGGCAAGGG - Intronic
1124150886 15:27177078-27177100 AAGGATAACTTGATGTGCAGGGG + Intronic
1124438849 15:29672749-29672771 AAGGATAATTTGGTGGGTTGGGG + Intergenic
1124600710 15:31130802-31130824 AAGGATAATTTGGCAGGTAGCGG - Intronic
1124640985 15:31396467-31396489 AAGGATAATTTGGTGGTTGGGGG + Intronic
1125029465 15:35061745-35061767 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1125041314 15:35190361-35190383 AAGGATAAGTTGGTGGGTAGGGG + Intergenic
1125163523 15:36676203-36676225 AGGGATAGGTAGGTGAGCAGAGG - Intronic
1125323442 15:38512580-38512602 AAGGACAGTGTGGAGGGGAGGGG - Intronic
1125342543 15:38689104-38689126 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1125537409 15:40449952-40449974 GAGGAGAGTTTGGAGGTCAGAGG + Intronic
1125546344 15:40508630-40508652 AAGGATAGTGGGGAGGGTAGTGG + Intergenic
1125630378 15:41142351-41142373 AAGGATAGTTTGGGAGGCAAGGG - Intergenic
1125631449 15:41151004-41151026 AAGGATAACTTGGTGGGTGGAGG - Intergenic
1125818095 15:42603648-42603670 AAGGATAGTTTTGCAGGCAGGGG + Intronic
1125845009 15:42843984-42844006 AAGGATAGTTTGGTGGGCAGGGG - Intronic
1126128808 15:45320869-45320891 AAGGATAATTTGGCAGGCAGGGG - Intergenic
1126504047 15:49382102-49382124 TATGATTGTTTGGTGGGGAGGGG + Intronic
1126568271 15:50123580-50123602 AAGGATAATTTTGTGGGTAGGGG - Intronic
1126699269 15:51353242-51353264 AAAGATAGTTTGGCAGGCAGAGG - Intronic
1127041991 15:54987573-54987595 ATGAATAATTTGGTGGGCAGTGG + Intergenic
1127196163 15:56588182-56588204 AAGGATAGTTTGGTGCAAAGGGG - Intergenic
1127388889 15:58489435-58489457 AAGGATAGTTTGATGTACAGGGG + Intronic
1127467391 15:59257633-59257655 GATGAGAGTTTGGTGGGGAGGGG + Intronic
1127506114 15:59599520-59599542 AAGGATAATTTGGTGGGTAGGGG + Intronic
1127506549 15:59603581-59603603 AAAGGTATTTTGGTGGGTAGGGG - Intronic
1127506660 15:59604397-59604419 AAGGATAGTTTGGTAGGCAGGGG + Intronic
1127553247 15:60061850-60061872 AAGGATAATTTGGCAGGCAGGGG - Intergenic
1127950174 15:63797573-63797595 AAGGATAGTTTGATGGGTGGGGG - Intronic
1128218659 15:65952311-65952333 GAGGTTTATTTGGTGGGCAGTGG + Intronic
1128351764 15:66895473-66895495 AAGGATAACTTGGTGGGTGGGGG + Intergenic
1129381149 15:75167897-75167919 AAGGATAAGTTGGTGGGTAGGGG + Intergenic
1129441143 15:75581585-75581607 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1129801652 15:78419393-78419415 ATGGACAATTTAGTGGGCAGGGG + Intergenic
1129926788 15:79371567-79371589 AAGGATACTTTGGTGGGCAGGGG + Intronic
1130657471 15:85801902-85801924 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1130740609 15:86595804-86595826 ATGGATAATTTGATGGGCAGGGG + Intronic
1130823187 15:87516718-87516740 AAGGAGAGTTTTGGGGACAGTGG - Intergenic
1130837183 15:87662822-87662844 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1130998687 15:88920827-88920849 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1130999692 15:88929936-88929958 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1131289064 15:91089296-91089318 AAGGATAATTTTGTGGAAAGAGG + Intergenic
1131414142 15:92237426-92237448 AAGAATAATTTGGTGGGTGGGGG - Intergenic
1131577958 15:93611108-93611130 AAGGATAATTTGGTAGGCAGGGG - Intergenic
1131665436 15:94566525-94566547 AAGGATAGGATGGTAGGCAAGGG + Intergenic
1132276000 15:100564482-100564504 AAGGATAATTTGGTGGGAAGGGG - Intronic
1132288304 15:100681830-100681852 AAATATAGTTTGGTGGGCGGGGG + Intergenic
1132742547 16:1422365-1422387 AAAGATAATTTGGAGGGTAGAGG - Intergenic
1132991128 16:2794851-2794873 ATGGACAATTTGGTGGGCAGTGG - Intergenic
1132991211 16:2795747-2795769 AACGATAGTTTGATGGGCTGGGG + Intergenic
1133111721 16:3551854-3551876 ATGGATGGTTGGGTGGGTAGTGG - Intronic
1133455898 16:5942253-5942275 AAATATAGTTTGATTGGCAGGGG + Intergenic
1133524312 16:6589391-6589413 CAGGATTATTTGGTGGGTAGGGG + Intronic
1133763939 16:8822118-8822140 AAGGATAACTTGCTGGGTAGGGG + Intronic
1133764812 16:8830446-8830468 AAGGATAACTTGGTGGGTAGGGG + Intronic
1133900836 16:9972929-9972951 AAGGATAATTTGGTGGGTAGAGG + Intronic
1133945206 16:10342150-10342172 ATGGATAATTTGGTGGGCAGCGG - Intronic
1134280196 16:12810297-12810319 AAGGATAATTTGGTGGTTAGTGG - Intergenic
1134370600 16:13620520-13620542 AAAGATAGTTTGGCAGGCAGGGG - Intergenic
1134392659 16:13833797-13833819 AAGGACAACTTGGTGGGCTGGGG - Intergenic
1134740620 16:16540483-16540505 AGAGATAATTTGGTGGGTAGCGG - Intergenic
1134926882 16:18171689-18171711 AGAGATAATTTGGTGGGTAGCGG + Intergenic
1135034464 16:19065262-19065284 ATGGATAATTTGGTGGGTAGGGG + Intergenic
1135125452 16:19805851-19805873 AAAGATAGTTTGGTGGGGTGGGG + Intronic
1135203551 16:20461903-20461925 AAAGATAATTTGGAGGGCAGGGG + Intronic
1135215453 16:20563033-20563055 AAAGATAATTTGGAGGGCAGGGG - Intronic
1135356320 16:21772064-21772086 AAAAATAGTTTGGTGGGCAGAGG + Intergenic
1135454810 16:22588208-22588230 AAAGATAGTTTGGTGGGCAGAGG + Intergenic
1135469044 16:22712788-22712810 AAGGGTGATTTGGTGGGTAGGGG + Intergenic
1135602533 16:23795660-23795682 AAGGATAGATTGGTGGGTGGGGG - Intergenic
1135638650 16:24100838-24100860 AAGGACAGTTTAGTGGTAAGTGG + Intronic
1135788492 16:25372130-25372152 AAGGATAATTTGGTGGGCAGGGG - Intergenic
1135809770 16:25576583-25576605 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1135855517 16:26006567-26006589 AAGGATAGTTTGGCAGGCAAGGG + Intronic
1135959407 16:26983336-26983358 AAGGATAATTTGGCAGGCAGTGG - Intergenic
1135963802 16:27019488-27019510 AAGGGTAGTTTGGCAGGCAGGGG - Intergenic
1135998374 16:27270461-27270483 AAGGATAATTTGGTGGCTGGAGG + Intronic
1136924404 16:34358575-34358597 AAGAATAATTTGGTGGGTAGGGG - Intergenic
1136980169 16:35053231-35053253 AAGAATAATTTGGTGGGTAGGGG + Intergenic
1137814577 16:51386281-51386303 AAGGATAATTTGGCACGCAGGGG - Intergenic
1137839788 16:51629711-51629733 AAGGATAGTGTGTTGGTCTGGGG - Intergenic
1137924965 16:52532004-52532026 AAGGGGAGTTTGGGGGGCAGTGG + Intronic
1137976217 16:53034339-53034361 AAGGATACTTTGGTAGACGGGGG + Intergenic
1138016016 16:53429406-53429428 AAGGATAATTTGCTGGGCAGGGG - Intergenic
1138206434 16:55128786-55128808 AAGGATGGTTTGGCAGGCAAGGG + Intergenic
1138403895 16:56772641-56772663 AAGGAGAGTATGTAGGGCAGTGG - Intronic
1138407549 16:56809666-56809688 AAGGATAGGTAGGTTGGCAAAGG + Intronic
1138605251 16:58084622-58084644 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1138860438 16:60749765-60749787 AAAGATAGCTTGATGGGCAGAGG + Intergenic
1138878057 16:60977156-60977178 AAGGATAATTTGGTGAGTAGGGG + Intergenic
1138902855 16:61295624-61295646 AAAGACAGTTTGGTGGGCAGGGG - Intergenic
1139014847 16:62677607-62677629 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1139014915 16:62678140-62678162 AGGGATAGTTTGGTGAGCCAAGG - Intergenic
1139066723 16:63324617-63324639 AATGGTAGTTTGGTAGGCAAGGG - Intergenic
1139371209 16:66470502-66470524 AAAGATAAATAGGTGGGCAGTGG + Intronic
1139605661 16:68016437-68016459 AAAGATAATTTGGTGGGTGGTGG + Intronic
1139647436 16:68341724-68341746 AAGGATAGTTTGGCAGGCGAGGG + Intronic
1139655717 16:68386234-68386256 TTTGATAGTTTAGTGGGCAGTGG + Intronic
1140199449 16:72882588-72882610 CAGGATGGTCAGGTGGGCAGTGG - Intronic
1140426615 16:74866564-74866586 AAGGATAGTTTGGCAGGCCAAGG + Intergenic
1140466467 16:75187222-75187244 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1140616930 16:76676346-76676368 AAGGATAATTTGGTGGGCAGGGG + Intergenic
1140642307 16:76990381-76990403 ATGGATACCTTGGTGGGCAGGGG + Intergenic
1140713894 16:77704578-77704600 AAAGATAGTTGGGTGGGCAGAGG - Intergenic
1141756524 16:85994984-85995006 AAGGGGAGTTTGGTGCTCAGTGG + Intergenic
1141917473 16:87109578-87109600 AAAGATAATTTGGTGGGTAGGGG + Intronic
1203141567 16_KI270728v1_random:1770658-1770680 AAGGATAATTTGGTGGGTGGGGG + Intergenic
1142633355 17:1240696-1240718 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1142951048 17:3480362-3480384 AAGGATAATTTGGTGGGTAGGGG + Intronic
1142953610 17:3504977-3504999 AAGGCTAGAGGGGTGGGCAGAGG - Intronic
1143222251 17:5272457-5272479 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1143282738 17:5766924-5766946 AAGGATAGGGAGGTGGGCAGGGG - Intergenic
1143605622 17:7983679-7983701 AAGGATAATTTGGTGGGTGTGGG + Intergenic
1143668655 17:8381204-8381226 AAGGATAATTTGGCAGGTAGGGG - Intronic
1143804757 17:9417098-9417120 AAGGATAGTTTGGTGGGCAGGGG - Intronic
1144171174 17:12661388-12661410 GGGGATAGTGTGGTGAGCAGAGG - Intergenic
1144189579 17:12832204-12832226 AAGGATAATTTGATGGATAGGGG + Intronic
1144238640 17:13287626-13287648 AATTATAGTTTGGTAGGCAAGGG + Intergenic
1144631824 17:16877411-16877433 AAGGATAATTTGGTAGGTGGTGG - Intergenic
1145024279 17:19456081-19456103 AAAAGTAGTTTGGTGGGCAGGGG + Intergenic
1145324994 17:21815452-21815474 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1145724671 17:27107526-27107548 AAGGGCAGTTTGGCAGGCAGAGG + Intergenic
1146081304 17:29783041-29783063 AAGGATAATTTGTTGGGTAGGGG + Intronic
1146146843 17:30426386-30426408 AAAGATAGTTTGATGGACAAGGG + Intronic
1146359372 17:32161184-32161206 AAGGATAGTTTGGTGGGTGGGGG + Intronic
1146502306 17:33374477-33374499 ACGGATAATTTGGTGGGCAGAGG - Intronic
1146509740 17:33436601-33436623 ATGGATAATTTGGTGGACAGAGG - Intronic
1146602739 17:34232895-34232917 AAAGATAGTCTGGTGGGCAGGGG - Intergenic
1146663405 17:34680526-34680548 AAGGATAGTTTGATGGGCAAGGG - Intergenic
1146809066 17:35889053-35889075 AAAGGTAGTTTGGCGGGCAGGGG + Intergenic
1147230520 17:39014693-39014715 AAGGATAATTTGGTGGGTGGAGG - Intergenic
1147235753 17:39056198-39056220 AAGGATAGTTTGGCAGGCTGGGG - Intergenic
1147282887 17:39377348-39377370 AAGGACAGCTTGGTGGGTGGGGG - Intronic
1147363873 17:39947690-39947712 AAGGATAACTTGGTGGGTTGCGG - Intergenic
1147745138 17:42690253-42690275 AAGGATAGAGTGGTGGGTGGGGG + Intronic
1147841643 17:43376001-43376023 AAGGACAACTTGGTGGGTAGGGG + Intergenic
1148061185 17:44837547-44837569 AAGGATAATTTGGCGGGCAGGGG - Intergenic
1148260772 17:46181364-46181386 AAGGATAGTTTGGGGCACTGAGG - Intronic
1148464159 17:47854953-47854975 CAGGAGAGTATGGTGGGGAGAGG - Intronic
1148592612 17:48827973-48827995 AAAGATAGTTTGGCAGGCAGGGG + Intergenic
1148627314 17:49079542-49079564 AAAGATAGTTTAATGGGCAGGGG - Intergenic
1148648707 17:49234233-49234255 AAGGATAATTTGGTGGGTAGTGG + Intergenic
1148966703 17:51441772-51441794 GAGGTTAGTTAGGTGGGCAGTGG + Intergenic
1150318455 17:64189492-64189514 AAGCATAGTACGGGGGGCAGAGG + Intronic
1150737952 17:67756156-67756178 AAGAATTGTTTGGCGAGCAGGGG - Intergenic
1150753291 17:67886434-67886456 AATGAAAGTTTGGTGGGGGGTGG + Intronic
1150973161 17:70053540-70053562 AAGGATAGTTTGTCGGGTATGGG + Intronic
1151000544 17:70370406-70370428 ATGGATAATTTGGTGGGCAGAGG + Intergenic
1151103121 17:71578511-71578533 AAGGGTGGTTAGGTGGGAAGGGG - Intergenic
1151241990 17:72765363-72765385 AAGGATAGTTTGACAGGCAAGGG - Intronic
1151247839 17:72808880-72808902 ATGGATAATTTGTTGGGCAGGGG - Intronic
1151255504 17:72873374-72873396 AAGGGTAGTTTAGCAGGCAGAGG - Intronic
1151751125 17:76038434-76038456 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1151875701 17:76867179-76867201 AAGGAGATGTTGGAGGGCAGAGG - Intergenic
1152416077 17:80162926-80162948 AAGGATTTTTTGGGGGGCAGGGG - Intergenic
1152416233 17:80164153-80164175 AAGGATAGTTTGGGGGCCCTGGG - Intergenic
1152675536 17:81638615-81638637 AAGGATAATTTGGTGGGTATGGG + Intronic
1152824590 17:82456689-82456711 ATGGACAATTTGGTGGGCAGGGG - Intergenic
1153617742 18:6950212-6950234 AAGGATAGTTTGGCAGCCGGGGG - Intronic
1153846416 18:9053508-9053530 CAAGATAGTTTGGTGGGCAGGGG + Intergenic
1153886154 18:9468586-9468608 AAGGATAGTTTGACAGGCAGTGG + Intergenic
1154090960 18:11362763-11362785 AAGGATAATTTGGTGGGTTGGGG + Intergenic
1154205906 18:12336474-12336496 AAGGATAGTTTGGCAGGTAAGGG - Intronic
1154400348 18:14031075-14031097 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1154994092 18:21623389-21623411 GAGGATAGTTTGGTGGAATGGGG + Intronic
1155357144 18:24964284-24964306 AAGGATAGTTTGGTAGGCAGAGG + Intergenic
1155714087 18:28918393-28918415 AAGGATGGTTTGGCAGGCAGGGG - Intergenic
1155915589 18:31553996-31554018 AAGGATAGTTTGGCCAGCAGGGG - Intergenic
1155921095 18:31603637-31603659 AAGCATAGTTTGGTGGGCAGGGG - Intergenic
1155938452 18:31778449-31778471 AAGTATAATTTGGTGGGCAGGGG - Intergenic
1156301587 18:35841081-35841103 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1156363253 18:36403029-36403051 GAGGATAGTTTTGTTGGGAGGGG + Intronic
1156592673 18:38509307-38509329 AAGGATTATTTGGTAGACAGGGG + Intergenic
1156740156 18:40316310-40316332 AAGGAAGGATTGGTGTGCAGTGG - Intergenic
1156866623 18:41895789-41895811 AAGGATAATTTTGTGGACAAGGG - Intergenic
1156902841 18:42321406-42321428 AAGGATAATTTGGTGGGTGGGGG - Intergenic
1157217011 18:45792631-45792653 AAGGATAATTTGGTGGGTGGAGG - Intergenic
1157235205 18:45958996-45959018 AAGGATAACTTGGTGGGTTGGGG - Intronic
1157766321 18:50299665-50299687 AAGGATAAATTGGTGGGTAGAGG + Intergenic
1158005629 18:52669068-52669090 AAGGATGACTTGGTGGGCAGGGG + Intronic
1158023655 18:52870784-52870806 CAAGATAGTTTGGTGGGTAGGGG - Intronic
1158125041 18:54091865-54091887 CATGGTAGTTTGGTAGGCAGAGG + Intergenic
1158743068 18:60165719-60165741 AAGGATAATTTGGTAGGTAGGGG - Intergenic
1158743091 18:60165853-60165875 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1158780050 18:60637844-60637866 AAGTATAATTTGGTAGGCAGAGG + Intergenic
1158863059 18:61611919-61611941 AAGGATAATTTGGTGGGTTGGGG + Intergenic
1159086778 18:63801599-63801621 AAGGATAGTTTGGTGGGCAGCGG + Intronic
1159112623 18:64076831-64076853 AAGGATAATTTGGTGGGTGAGGG - Intergenic
1159165038 18:64687938-64687960 AAAGATAATTTGGTGGGAAGGGG - Intergenic
1159279520 18:66267761-66267783 AAGGATAATTTGGCAGGCAGGGG - Intergenic
1159536291 18:69719202-69719224 AAAGAAAATTTGGAGGGCAGGGG + Intronic
1159618147 18:70606188-70606210 AAGGATAGTTTGATGAGTTGTGG - Intergenic
1159655257 18:71025164-71025186 AAGGATAACTTGGTGGGTGGAGG - Intergenic
1159775651 18:72600773-72600795 AAGGATGGTTTGGTGGGTGGGGG + Intronic
1159851753 18:73533794-73533816 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1159894971 18:73987897-73987919 AAAGATAGTTTGGCAGGCAGGGG - Intergenic
1159920559 18:74223884-74223906 AAGGATATGCTGGTGGGCAGGGG - Intergenic
1160201099 18:76796064-76796086 AAGGACAACTTGGTGGGTAGGGG - Intronic
1161823238 19:6544245-6544267 ATGGATAGTGTGGTCTGCAGAGG + Intergenic
1161989614 19:7677210-7677232 AAGGAGAGATTGGGGGGCCGGGG + Intronic
1162086395 19:8251863-8251885 AAGGACAGTGGGGTGGGCGGAGG + Intronic
1163614995 19:18321907-18321929 AAAGATAATTTGGCGGGTAGGGG - Intronic
1164188916 19:22897761-22897783 AAGAATAATTTGGTGGGTGGGGG - Intergenic
1164414320 19:28033624-28033646 AAAGATAGTTTATTGGGCAGGGG - Intergenic
1164429765 19:28177048-28177070 TAAGGTAGTTTGGTGGGCAGGGG - Intergenic
1164523126 19:28994056-28994078 AAGGACAGTTCGGTGGGCAGGGG - Intergenic
1164566906 19:29332439-29332461 AAACAGAGTTTGGTGGGCTGTGG - Intergenic
1165045374 19:33100632-33100654 AAGAATGGTTTTGTGGGGAGGGG + Intronic
1165126505 19:33601645-33601667 AAGGATAATTTGGTGGGCAGGGG - Intergenic
1165192427 19:34076265-34076287 ATGTATAGTTTGGTGGGCAGGGG - Intergenic
1165300738 19:34966974-34966996 AGGGATAATTTGGTGGGTGGGGG - Intergenic
1165591272 19:36972386-36972408 AGGGATAGTTGGGTCTGCAGCGG - Intronic
1166037213 19:40177547-40177569 AAGGATAGTTTGGCAAGCAGGGG - Intergenic
1166235846 19:41455721-41455743 ATGGATAATTTGGAAGGCAGGGG + Intergenic
1166262421 19:41649919-41649941 AAGGAGTGTTTGGAGAGCAGGGG + Intronic
1166432059 19:42736464-42736486 AAGGATAGTTTCAGGGGCACAGG - Intronic
1166452435 19:42913883-42913905 AAGGATAGTTTCAGGGGCACAGG - Intronic
1166454938 19:42933125-42933147 AAGGATAGTTTCAGGGGCACAGG - Intronic
1166464722 19:43022452-43022474 AAGGATAGTTTCAGGGGCACAGG - Intronic
1166470852 19:43078641-43078663 AAGGATAGTTTCAGGGGCACAGG - Intronic
1166482001 19:43182560-43182582 AAGGATAGTTTCAGGGGCACAGG - Intronic
1166585030 19:43938061-43938083 AAGATAAGTTTGGTGGGCAGGGG + Intergenic
1166621891 19:44308730-44308752 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1167206686 19:48107162-48107184 AAGGAAACTTTGGTGGGCAAGGG + Intronic
1167213065 19:48145659-48145681 CAGCAGAGTGTGGTGGGCAGGGG + Intronic
1167256935 19:48436218-48436240 AAAGATAATTTGGCGGGTAGGGG + Intronic
1167389844 19:49187771-49187793 AAAGATAATTTGGTGGGTAGAGG + Intronic
1167624390 19:50577964-50577986 AAGGACAGCTTGGTCGGAAGTGG - Intergenic
1167839186 19:52100031-52100053 AAGGATAATTTGATGGGTAGGGG - Intergenic
1168288385 19:55345616-55345638 ATGGACAGTTGGGTGGACAGTGG + Intronic
1168433589 19:56300985-56301007 AAGGATGGCGTAGTGGGCAGAGG + Intronic
1168481718 19:56725527-56725549 AAGGCTAGTTTGGTGGGCCAGGG - Intergenic
1168614657 19:57827850-57827872 AAGGATAATTTGGTAGATAGGGG - Intronic
1168622482 19:57890468-57890490 AAGGATAATTTGGTAGATAGGGG + Intronic
1202705964 1_KI270713v1_random:24064-24086 AAAGATAGTTTGGTGGGGAGGGG + Intergenic
925204270 2:1993063-1993085 AAGGATAACTTGGTGGGTAGGGG - Intronic
925438911 2:3867203-3867225 ATGGACAATTTGGTGGGCAGGGG - Intergenic
925980289 2:9171118-9171140 AAGGATAATTTGGTGGGTAGGGG - Intergenic
925993588 2:9273600-9273622 AAGGATAATTTGGTGGGTCAGGG + Intronic
926239290 2:11072639-11072661 AAAGATAATTTGGTGAGTAGGGG + Intergenic
926414137 2:12632568-12632590 TAGGATAATTTGGTGAGTAGGGG - Intergenic
926561609 2:14423822-14423844 AAGAATGATGTGGTGGGCAGGGG - Intergenic
926717848 2:15939200-15939222 TTGGAGAGTTTGGAGGGCAGGGG + Intergenic
926889568 2:17627520-17627542 AAGGATAATTTGGTGGGTAGGGG + Intronic
926905526 2:17801812-17801834 ACGGATAATTTGGTGGGTAGGGG - Intergenic
928296529 2:30088846-30088868 AAAGACAGTTTGGCAGGCAGGGG - Intergenic
928410697 2:31051917-31051939 AATGAGAGTTGGGTGGGCGGAGG - Intronic
928420302 2:31133091-31133113 AAGGATAATCTGGCGGGTAGGGG - Intronic
928609510 2:32977617-32977639 AAGCATGGTTGGGTGTGCAGGGG + Intronic
928671968 2:33611507-33611529 AAGGATAATTTGGTGGGTAGAGG - Intergenic
928672536 2:33617056-33617078 AAGGATAACTTGGTGGGTTGGGG + Intergenic
928931124 2:36625473-36625495 AAGGACAGCTTGGTGAGCAGGGG + Intronic
929111971 2:38412537-38412559 AAAGATAATTTGGTGGGTAGGGG - Intergenic
929171916 2:38940836-38940858 AAGGATAATTTGGTGGGCAGGGG + Intronic
929321097 2:40544378-40544400 AAAGATAATTTGGTGGGTAGGGG + Intronic
929572184 2:43029608-43029630 AAGGTTATTTTGGTGAGCAGTGG - Intergenic
929607852 2:43247103-43247125 AAGGGAAGTTTTCTGGGCAGTGG - Intronic
929860837 2:45675867-45675889 CAGGATAGGTGGGTGGGGAGGGG + Intronic
930065828 2:47326866-47326888 AAAGATAATTTGGCGGGTAGGGG + Intergenic
930113295 2:47697239-47697261 AAGGATAGTTTGGCAGGCCAGGG - Intronic
930164369 2:48189841-48189863 ATGGATAATTTAGTGGGCAGGGG + Intergenic
930322744 2:49876816-49876838 AAGGATAATTTGGTGGGTAGGGG + Intergenic
930510418 2:52337278-52337300 CAAGATAATTTGGTGGGTAGAGG - Intergenic
930520249 2:52456874-52456896 AAGGATACTTTGGCCTGCAGAGG - Intergenic
930682461 2:54271575-54271597 ATGGATAATTTGGTGCACAGAGG - Intronic
930707059 2:54515241-54515263 AAGGATAATTTGCTGGGTAGGGG - Intronic
930755092 2:54965568-54965590 AAGGATAATTTGGTGGGTGGGGG + Intronic
930839319 2:55827515-55827537 AAGGATAATTTGGTGGGTGGGGG + Intergenic
930983076 2:57551365-57551387 ATGGATAATTTGGTGGGCAGGGG - Intergenic
931372640 2:61677970-61677992 AAGGATAGGTTGGTGGGCAAAGG - Intergenic
931432548 2:62219813-62219835 AAGAGTAGTTTTGTGGGCAGGGG + Intronic
931440238 2:62285146-62285168 AAGAATAGTTTGGTGGGTGAGGG + Intergenic
931463068 2:62464741-62464763 AAGGATAATTTGGTGGACAGGGG + Intergenic
931608285 2:64073888-64073910 AAGGATACTTTGGAGGGCCAGGG + Intergenic
931855986 2:66302140-66302162 TAGCATGCTTTGGTGGGCAGTGG + Intergenic
931928695 2:67104576-67104598 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
932079331 2:68697443-68697465 AAGAATAATTTGGTGGGTAGGGG + Intronic
932303051 2:70681338-70681360 AAAGATAGTTTGGTGGGTAGGGG - Intronic
932863449 2:75317746-75317768 AAGGATAATTTGGTGTGTAGGGG - Intergenic
933045358 2:77528669-77528691 AAGGATAATTTTGTGGGTAAGGG + Intronic
933073252 2:77889275-77889297 AAGGATAATTTGGAGGGGAGGGG - Intergenic
933317730 2:80735988-80736010 AAGGATTGTTTGGTAGGCCAGGG - Intergenic
933338058 2:80985241-80985263 ATGGATAACCTGGTGGGCAGGGG + Intergenic
933851535 2:86370761-86370783 AAGGAAAGTTTTGTGAGTAGAGG - Intergenic
934670569 2:96209707-96209729 AAGGATAATTTGGTGGGTGGGGG - Intergenic
934670987 2:96212695-96212717 AAGGAGACTTTGGTGGGTGGGGG - Intergenic
934700634 2:96437008-96437030 AAGGATAGTTTGGTGGGTAGGGG - Intergenic
934701105 2:96440871-96440893 GAGTATAATTTGGTGGGAAGAGG - Intergenic
934706753 2:96486524-96486546 AGGGAGAGTTTGGAAGGCAGAGG - Intergenic
934871594 2:97871699-97871721 AAGGATAGTTTTGTGGGCAGGGG - Intronic
934924010 2:98368752-98368774 AAGGATAATTTGTTGGGTAGGGG + Intronic
935104257 2:100024902-100024924 AAGGATAGAGTGGTGAGGAGTGG + Intronic
935156159 2:100485416-100485438 ATGGATAATTTGGTGGGCAGGGG + Intergenic
935175474 2:100644992-100645014 TTGGATAATTTGGTGGGCAGGGG + Intergenic
935228797 2:101078113-101078135 AAGGATAGTGTGGTGGGCCAGGG - Intronic
935742121 2:106159019-106159041 AAGGGTAGTTTGGTGGGTGGGGG - Intronic
935802400 2:106711943-106711965 ATGGATTATTTGGTGGGCAGGGG + Intergenic
936350938 2:111712077-111712099 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
936447648 2:112608327-112608349 AAGAATAATTTGGTGGGTAGGGG - Intergenic
936626411 2:114153948-114153970 AAGGAAAATTTGATGGGTAGGGG - Intergenic
936740223 2:115496875-115496897 AAGGAAAGTTTGGTGGGCATGGG + Intronic
937113896 2:119389621-119389643 AAGGATAATTTGGTGGGCAGGGG + Intergenic
937211253 2:120273199-120273221 AAGGATGTTTTGGTAGGCAGGGG + Intronic
937474452 2:122202607-122202629 AAGGATAATTTGGTGGATAGGGG + Intergenic
937520413 2:122707063-122707085 AAGGACAGTTTGGTGGGCAAGGG - Intergenic
937579410 2:123465422-123465444 AAGAATAGTTTGGTGGGCCAGGG - Intergenic
937583960 2:123523802-123523824 ATGGACAATTTGGTGGGCAGGGG + Intergenic
937712804 2:124997248-124997270 ATGGATAGTTTGGTGGTCAGGGG + Intergenic
937759817 2:125587955-125587977 AAAGATAGTTTGGTGGCCAAGGG + Intergenic
937964168 2:127488586-127488608 TAGGATGGATTGGAGGGCAGTGG - Intronic
938096609 2:128467997-128468019 AAAGATAGTTTAGTGGGCAGGGG - Intergenic
938700280 2:133871904-133871926 AAGGATAATTTGATGGGTAGGGG + Intergenic
938786768 2:134636968-134636990 AAGGATAATGTGGTGGGTGGGGG - Intronic
939104675 2:137935461-137935483 AAGGATAATTTGGTGAGTGGAGG + Intergenic
939131844 2:138244453-138244475 ATGGATAATGTGGTAGGCAGGGG + Intergenic
939134282 2:138274983-138275005 AAGTATAGTTTGGTGTGCAGAGG - Intergenic
939255688 2:139742483-139742505 AAGGATAATTTGGTGGGTGGGGG - Intergenic
939265369 2:139865887-139865909 AAGGATAACTTGGTGGGCTGGGG + Intergenic
939265740 2:139870477-139870499 AAGGATAATTTGGTGGGTAGGGG - Intergenic
939356443 2:141109211-141109233 AAACATAGCTTGGTGGGCAGGGG - Intronic
939468455 2:142588256-142588278 AAGAATAATGTGGTGGGTAGGGG + Intergenic
939740860 2:145903578-145903600 AAGTGTACTTTGGTGGGGAGGGG - Intergenic
939748089 2:146003358-146003380 AAGGATAATTTGGTGGGTAGGGG + Intergenic
939755355 2:146102864-146102886 AAATATAGTTTGGTGTGTAGGGG + Intergenic
940176020 2:150878409-150878431 ATGGACAACTTGGTGGGCAGGGG + Intergenic
940486857 2:154306605-154306627 AAGGATAATTTGGTGGGGGGGGG + Intronic
940724327 2:157318670-157318692 GTGGATAGTTTGGTAGGTAGGGG + Exonic
940847702 2:158659580-158659602 ATGGTTACTTTGGTGGTCAGGGG + Intronic
941244354 2:163078719-163078741 AAGGATAGTTTGGAGGGCAGGGG - Intergenic
941245075 2:163086033-163086055 AAGGATAGTTTGGCAGACAGGGG - Intergenic
941403151 2:165056566-165056588 ATGGACAATTTGGTGGGCAGGGG - Intergenic
941404202 2:165069058-165069080 AAGGATAGTTTGGCAGGCAGAGG + Intergenic
941673671 2:168321624-168321646 AAGGATAGTTTGGTGGGTAGGGG + Intergenic
941877363 2:170447800-170447822 AAGGATACTTTGGTAGGTAGGGG + Intronic
941960180 2:171245709-171245731 ATGGATAGTTTGGCAGGCAGGGG - Intergenic
941991111 2:171558626-171558648 AATGATAGTTTGGTGGGCAGGGG + Intergenic
942026182 2:171912945-171912967 AAGGATACCTTGGTGGGTGGGGG + Intronic
942054905 2:172172947-172172969 AAGGATAGTGGGCTGGGGAGGGG + Intergenic
942078151 2:172376017-172376039 AAGGTGGGTTTGGTAGGCAGTGG + Intergenic
942093874 2:172519821-172519843 AAGGATAATTTGGTGGGAAGGGG + Intergenic
942223743 2:173796655-173796677 AAGGATAATTTGGTAGGTAGAGG - Intergenic
942314433 2:174684302-174684324 AAAGATAATTTGGCAGGCAGGGG - Intergenic
942625996 2:177901349-177901371 AAGGATAATTTGGTGGGTGGGGG - Intronic
942766263 2:179460813-179460835 AAGGATAGTTTCATGGGCAGGGG - Intronic
943119948 2:183723469-183723491 GATGACAGTTTGATGGGCAGAGG + Intergenic
943160799 2:184247156-184247178 AAGGAAATTTTAGTGGGAAGAGG + Intergenic
943443086 2:187949933-187949955 AAGGATTATTTGGTGGGAAGGGG + Intergenic
943468817 2:188266258-188266280 AAGGGTTGTTTGGTGGGTAATGG - Intergenic
943731818 2:191309987-191310009 ATGAATAGATTGGTGGGGAGTGG + Intronic
943862658 2:192888793-192888815 AAAGATAATTTGGTGGGTAAGGG + Intergenic
944023981 2:195141962-195141984 AAGGATAATTTGGTGGATAGGGG + Intergenic
944145111 2:196499032-196499054 AAGGATAGGTTGGTGGGCAGGGG - Intronic
944314120 2:198267164-198267186 ATGGACAGTTTGGTGGGCAGAGG + Intronic
944453950 2:199874287-199874309 AAGGATGGTTTGGCAGGCAGGGG - Intergenic
944478914 2:200135165-200135187 AAAGATAGTTTGGTGGGCAGGGG + Intergenic
945392375 2:209279713-209279735 AAAGACAATTTGGTGGGTAGGGG - Intergenic
945404235 2:209424968-209424990 AAGGCTTTTTTGGTGGGGAGAGG + Intronic
945555532 2:211270866-211270888 AAGGATAATTTGGCAGGTAGGGG - Intergenic
945936707 2:215909680-215909702 AAAGATAATTTGGTGAGTAGGGG - Intergenic
946663871 2:222029303-222029325 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
946765585 2:223037109-223037131 AAAGATAATTTGGAGGGTAGGGG + Intergenic
947028026 2:225760804-225760826 AAGGATAGTTTTGTAGGCAGGGG + Intergenic
947148844 2:227093611-227093633 AAAGATAGTTTGGCAGGCAGGGG - Intronic
947160409 2:227208571-227208593 AAAGATAGTTTGGCGGGTAGGGG - Intronic
947216296 2:227753229-227753251 AAAGATAATTTGGCGGGTAGGGG - Intergenic
947304674 2:228730927-228730949 AAGAATAATTTGGTGGGTAGTGG - Intergenic
947373128 2:229468594-229468616 AAAGATAATTTGGCGGGTAGGGG - Intronic
947453442 2:230230175-230230197 AAGGATAGTTAGGCAGACAGGGG + Intronic
947688596 2:232113691-232113713 AAGGATAGCTTGGAGGTTAGAGG - Intronic
947688646 2:232114121-232114143 AAGGATAATTTGGTGGGTAAGGG - Intronic
947696569 2:232195432-232195454 AAAGATAGTTTGGTGGGCAGGGG + Intronic
948004438 2:234595713-234595735 AAAAATAATTTGGTGGGTAGGGG + Intergenic
948302378 2:236917429-236917451 AAAGATAATTTGGCAGGCAGGGG + Intergenic
948309498 2:236974483-236974505 AAAGATAGTTTGGTGGGCAGGGG - Intergenic
948309802 2:236976688-236976710 AAGGTGTGTGTGGTGGGCAGGGG - Intergenic
949080755 2:242097256-242097278 AAACATAGTTTGATGGACAGAGG + Intergenic
1169324754 20:4666244-4666266 AAGGATAATTTGGTGGTGGGGGG - Intergenic
1169410483 20:5365282-5365304 AAGGATAATTTGGTGGGTAGTGG - Intergenic
1169431472 20:5540050-5540072 AAGTATAGTTTGGTGGGCAGGGG - Intergenic
1169455257 20:5746923-5746945 AAGGATAATTTGGTAGGTAGGGG - Intergenic
1169619335 20:7487471-7487493 AAGGATTGCTTGGAGGGCAGCGG - Intergenic
1169635355 20:7685127-7685149 AGTGATAATTTGGAGGGCAGAGG - Intergenic
1169653298 20:7893717-7893739 AAGGATAATTTGGTGGGGAAGGG - Intronic
1169742929 20:8914881-8914903 AAGGATAGTTTGGTGGGCAGGGG - Intronic
1169824684 20:9754324-9754346 AAGGATGATTTGGTGGGTAGGGG + Intronic
1169835504 20:9873475-9873497 AAGGATAGTTTGGTCGGCAGGGG - Intergenic
1169854549 20:10088988-10089010 AAGGATAAATTGATGGGTAGGGG - Intergenic
1170368093 20:15618914-15618936 AAGGATAATTTGGCGGGTGGAGG + Intronic
1170509094 20:17058544-17058566 AAGGATAATTTGGTGGGTAGAGG + Intergenic
1170733360 20:18992789-18992811 AAGGATAGTTTGCTGGGCAGGGG - Intergenic
1170936196 20:20811870-20811892 AAGGATAAGTTGGTGGGTGGTGG + Intergenic
1171288149 20:23960039-23960061 AAGGATAGTTCTGTTGTCAGTGG + Intergenic
1171334140 20:24368239-24368261 AAGGAAAGTTAGATGGGAAGTGG - Intergenic
1171398576 20:24857082-24857104 AAGGATGGTTTGGTGGGCGGAGG - Intergenic
1171475492 20:25405623-25405645 AAGGATAATTTAGTGGGTAGGGG + Intergenic
1172285509 20:33737638-33737660 AAAGATAGTTTGGGGGACAAGGG + Intronic
1172647387 20:36479467-36479489 AAAAATAGTGTGGTGGGCAAGGG + Intronic
1173309455 20:41884153-41884175 ATGGAAGGTTTGGGGGGCAGAGG - Intergenic
1173584647 20:44173458-44173480 AAGGATAGTTTGGCGGGCAGGGG - Intronic
1173627185 20:44481662-44481684 AAGGGAAGTTTGATGGGGAGTGG + Intronic
1173632819 20:44529469-44529491 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1173746936 20:45444734-45444756 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1173839686 20:46149285-46149307 GAGGACAGGATGGTGGGCAGTGG + Intergenic
1174552391 20:51371419-51371441 AAGGATAATTTGGTGGGCAGGGG + Intergenic
1174607760 20:51773279-51773301 AAGGAGTGTTTGGTGGTAAGTGG + Intergenic
1174905350 20:54544655-54544677 AAGGATAGTTTGATGGGCAAGGG + Intronic
1174940161 20:54918229-54918251 AAGGATAGATTGGCAGGTAGGGG + Intergenic
1175070743 20:56331794-56331816 AAGGATGATTTGGTGGGCAGGGG - Intergenic
1175071233 20:56335613-56335635 AAAGATAGTTTGGTGCTCAGGGG + Intergenic
1175648424 20:60695675-60695697 AAGGACAGCTTGGTGGGCAGGGG + Intergenic
1176293813 21:5059986-5060008 AAGGATAGTTTGGCAGGCCAGGG - Intergenic
1176902692 21:14462370-14462392 AAGGATAATTTGGTGAGTAGGGG + Intergenic
1177281138 21:18984514-18984536 ATGGACAGTTTGGTGGGCATGGG - Intergenic
1177291579 21:19120071-19120093 AAGGCTAATTTGGTGAGCAGTGG + Intergenic
1177403002 21:20630720-20630742 AAGAATAATTTGGTGGGCAGGGG + Intergenic
1177420561 21:20851716-20851738 AAGGATAATTTGGTGGGTATGGG + Intergenic
1177510551 21:22081530-22081552 AAGGGTACTTTGGTGGACACGGG + Intergenic
1177549370 21:22600179-22600201 AAACATAGGTTAGTGGGCAGAGG + Intergenic
1177700752 21:24636134-24636156 AAGGATAATTTGGTGGGTGTCGG - Intergenic
1177887305 21:26762171-26762193 ATGGACAATTTGGTGGGCAGGGG + Intergenic
1178097505 21:29231855-29231877 AAGGATAACTTGGTGGGTGGGGG + Intronic
1178100616 21:29265091-29265113 GAGGTTAGTATGGTGGGGAGGGG + Intronic
1178114965 21:29407640-29407662 AAAGATAATTTGATGGGTAGGGG + Intronic
1178241312 21:30904142-30904164 AAAGATATTTTGGCGGGTAGGGG - Intergenic
1178254645 21:31041105-31041127 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1178340674 21:31783531-31783553 AAGGATAGTTTCGGGGGTGGGGG - Intergenic
1179234803 21:39536174-39536196 AAGGATAACTTGGTGGGCGGGGG + Intergenic
1179255398 21:39711389-39711411 AAGGAAGGTATGGTGAGCAGAGG - Intergenic
1179863446 21:44203662-44203684 AAGGATAGTTTGGCAGGCCAGGG + Intergenic
1179892072 21:44340597-44340619 AAGGATAATTTGGCGGGTATGGG - Intergenic
1179892138 21:44341083-44341105 AAAGGTAGTTTGGTGAACAGGGG - Intergenic
1179901885 21:44398516-44398538 AAGGATAATTTGGTGGGTAGGGG + Intronic
1180171609 21:46061897-46061919 AACAATAGTTTGGTGAGCAGGGG - Intergenic
1180839889 22:18954391-18954413 AAGGGGACTCTGGTGGGCAGTGG - Intergenic
1181503624 22:23335517-23335539 AAGGACAGCTTGGTGGGTGGGGG + Intergenic
1181708619 22:24665751-24665773 AAGGACAGCTTGGTGGGTGGGGG + Intergenic
1182335691 22:29581878-29581900 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1182454494 22:30441215-30441237 AAGGATAATTTGGTGAGTGGGGG + Intergenic
1183120357 22:35725573-35725595 AAGGATAATTTGGTGGGTAAGGG + Intronic
1183120622 22:35727496-35727518 AAGGATAATTTGGCGGATAGGGG + Intronic
1183287461 22:36976518-36976540 AAGGGTACTTTGGTGGGCAGGGG - Intergenic
1183485461 22:38085751-38085773 AGGGCTGGTTTGGTGGGGAGAGG + Intronic
1183593472 22:38795481-38795503 AAAGATAATTTTGTGGGTAGGGG - Intergenic
1184484722 22:44769885-44769907 AAGGATATTTTGGCAGGCAGAGG + Intronic
1184576446 22:45371225-45371247 AAGGAGAGGTTGGAGTGCAGAGG + Intronic
1184800090 22:46753810-46753832 AAGGCCACTTTGGTGGGGAGGGG - Intergenic
1184862247 22:47179225-47179247 AAGGATGGTTTGGAAGTCAGCGG - Intergenic
949107984 3:223775-223797 CAGGATAGTTTGGTAGGCAGGGG + Intronic
949362328 3:3244870-3244892 AAGAAGAGTTTGGGGGGCAGAGG - Intergenic
949567717 3:5260442-5260464 AAGAGTACTTTGGTGGGCAGGGG - Intergenic
949613413 3:5727767-5727789 AAAGATAATTTGGCGGGTAGGGG + Intergenic
949659230 3:6258530-6258552 AAGGATAGTTTGGCAAGAAGGGG + Intergenic
949811561 3:8012178-8012200 AAGGATAATTTGGTGGGTAGCGG - Intergenic
949992810 3:9592923-9592945 AAGAATAATTTTGTGGGTAGGGG - Intergenic
949997572 3:9630543-9630565 AAGGACAGCTTGGTGGGTGGGGG + Intergenic
950296933 3:11840117-11840139 AAGGATAGTTTGGTGAACAGGGG - Intronic
950306397 3:11917952-11917974 CAGGGTGGTTTGGTGGGCGGGGG - Intergenic
950626477 3:14251155-14251177 AAGGATAGTTTGGTGTGGAGGGG + Intergenic
950921107 3:16695708-16695730 AAAGATAATTTGGCGGGCAGGGG - Intergenic
951113457 3:18832859-18832881 AAGAATAATTTGGTGGGTAAGGG + Intergenic
951343367 3:21516130-21516152 AAGGACAATTTGGTGGGCAGGGG - Intronic
951798567 3:26569621-26569643 GAGGATAGGTTGGTGGGGAAAGG + Intergenic
951895425 3:27605595-27605617 AAGGATAATTTGGTGGGTAGGGG - Intergenic
952108535 3:30096172-30096194 AAGGACAATTTGGTGGCTAGGGG + Intergenic
952162029 3:30703480-30703502 AAAGATAGTTTGGTGGACAGGGG - Intergenic
952287753 3:31984362-31984384 AAGGATAGTTTGGTGGGCAGAGG + Intronic
952297839 3:32076731-32076753 AAGGATAATTTGGTAGGTGGGGG + Intronic
952427929 3:33194225-33194247 AAAGATAATTTGATGGGTAGGGG - Intronic
952628537 3:35437700-35437722 AAAGATAATTTGGTGGATAGGGG - Intergenic
952843954 3:37671137-37671159 AAGAATACTTTAGGGGGCAGAGG - Intronic
952965660 3:38619604-38619626 AAGGATAGTGTTGTGTGCTGTGG - Intronic
952994056 3:38860161-38860183 AAAGATAATTTGGTGGGTAGGGG - Intronic
953175880 3:40551621-40551643 AAGGATAGTTTGGTGGACTGGGG + Intronic
953177957 3:40568820-40568842 AAGGATAGTTTGGTGGGCAGGGG + Intronic
953212079 3:40884967-40884989 AAAGATAATTTGGTGAGTAGGGG + Intergenic
953425778 3:42796636-42796658 AAGGATAATTTGGTGGGTGGGGG + Intronic
953437706 3:42892237-42892259 AAGGACAACTTGGTGGGCAGGGG + Intronic
953500069 3:43424675-43424697 AAGGATAGTTTGGTGGGTAGGGG - Intronic
953613523 3:44468773-44468795 AAGGATAACTTGGTGGGTTGGGG - Intronic
953683056 3:45053901-45053923 AAGGATAACTTGGTGGGTTGGGG + Intergenic
953745598 3:45571578-45571600 AAAGAAAGTTTGGTGGGTGGGGG - Intronic
953746477 3:45577919-45577941 AAGGATAGTTTGGTGGGCGGTGG - Intronic
953868328 3:46603968-46603990 AAGGATATTTTTGTGGGCAGGGG - Intronic
954060721 3:48064439-48064461 AAGGATAATTTTGTGGGTAGGGG - Intronic
954085146 3:48238612-48238634 AAGGATAATTTGGTGGGAAGGGG + Intergenic
954672053 3:52296460-52296482 GTGGACAGTTTGGTGGGCATAGG + Intergenic
954823732 3:53353063-53353085 ATGGATAATTTGGTGGGTAGTGG + Intergenic
955223309 3:57040832-57040854 CAGGTCAGTCTGGTGGGCAGCGG - Intronic
955379431 3:58425010-58425032 GAGGGTAGTTTGGGGGGTAGGGG - Exonic
955489779 3:59470686-59470708 AAGAATAATTTGGTGGGAAGGGG - Intergenic
955655697 3:61242694-61242716 AAGGATAATTTGGTGGGTAGCGG + Intronic
955712675 3:61796578-61796600 TAGGATAGCATGGTGGGGAGGGG + Intronic
955858212 3:63297718-63297740 ATGAATAATTTGGTGGGCAGGGG + Intronic
956126757 3:66018100-66018122 AAGGACACTTTGGTGGGGGGGGG + Intronic
956351421 3:68341217-68341239 AAGGATAATTTGGTGGTTAGGGG + Intronic
956369021 3:68537984-68538006 AAGGGTAGTTTGGTGGGCAGGGG + Intronic
956458176 3:69444137-69444159 AAGGATAGTTTGGTGGGCAGGGG - Intronic
956684107 3:71808496-71808518 AAGTATAGTTTAATGGGTAGGGG - Intergenic
956758656 3:72416561-72416583 AAGGTTACCTTGGTGGGAAGAGG - Intronic
956915091 3:73862458-73862480 AAGGACAACTTGGTGGGTAGCGG + Intergenic
956915519 3:73867153-73867175 AAGCATAATGTGGTAGGCAGGGG - Intergenic
957240837 3:77659144-77659166 AAGGATAGTTTGGCAGGCAGCGG - Intergenic
957461717 3:80530245-80530267 AAGGGTAATTTGGTGGGTAGGGG - Intergenic
957468482 3:80626846-80626868 AAGGATAATTTGGCGGGTGGAGG + Intergenic
957588057 3:82158261-82158283 AAGGAAAATTTGGAGGGCAGGGG - Intergenic
957726598 3:84073910-84073932 AAGGGTAATTTGGTGGGTAGGGG + Intergenic
957740790 3:84265693-84265715 AAAGATAATTTGGTGGGTAGGGG + Intergenic
957892870 3:86382485-86382507 AAGGATAGTTTGGTGGGCATGGG + Intergenic
957983763 3:87546247-87546269 AAGGACAGTTTTGTGGGTAGGGG - Intergenic
957983796 3:87546486-87546508 GAGGATAGTTTGGAGGGCCGGGG - Intergenic
958628429 3:96656683-96656705 AAAGACAGTTTGGCGGGCAGGGG - Intergenic
959151902 3:102617995-102618017 ATGGACAATTTGGTGGGCAGGGG + Intergenic
959152972 3:102629655-102629677 AAGAATAGTTTGGTGAGCAGGGG - Intergenic
959158631 3:102697107-102697129 AAGGATAATTTGGTGGTGAGGGG + Intergenic
959277823 3:104299649-104299671 AAGGAAAGTTTGGTTGGCAGGGG + Intergenic
959295261 3:104527549-104527571 AAGGATAACTTGGTGGGTATGGG - Intergenic
959453657 3:106533699-106533721 AAGGATAGTTTGGCTGGCAGTGG - Intergenic
960006597 3:112787509-112787531 AAGGACAATTTGGTGGGTGGGGG - Intronic
960240983 3:115341693-115341715 AAGGGAAGTTTGGGGGGCAGTGG - Intergenic
960842442 3:121973895-121973917 AAGGATAGTTTGGTGGGCCCAGG - Intergenic
960842549 3:121974941-121974963 ATGGACAATTTGGTGGGCGGGGG + Intergenic
960877219 3:122309261-122309283 AAGGATAATTTGGTGGGTAGAGG - Intergenic
960943475 3:122949897-122949919 AAGGATAATTTGGGGAGCAGTGG - Intronic
961159649 3:124712846-124712868 AAGTAAAGTTTTGTGGGAAGTGG - Intronic
962094170 3:132276567-132276589 AAAGATAATTTGGTCGGCAGGGG + Intronic
962468607 3:135684891-135684913 GAGGGTAGTTGGGTGGGGAGTGG + Intergenic
963019104 3:140855018-140855040 AAGGATAATTTGGCAGGTAGGGG + Intergenic
963022250 3:140883585-140883607 AAGGATAGTTTGGCAGGCAGGGG + Intergenic
963059356 3:141212416-141212438 AAGGATAATTTGGTGGGTACGGG - Intergenic
963103886 3:141629149-141629171 AAGGATAAGTTGGTGGGCTGTGG + Intergenic
963108060 3:141663515-141663537 AAGGGTAATTTGGTGGGTAGGGG + Intergenic
963314249 3:143742268-143742290 AAGGATAACTTGGTGGGTTGGGG - Intronic
963649588 3:147961910-147961932 AAGGCTACATTGGTGGGTAGTGG + Intergenic
963693654 3:148536898-148536920 AAGAATAGTTTGGTGGGCAGGGG + Intergenic
963710343 3:148739883-148739905 CAGGACAGCTAGGTGGGCAGTGG - Intronic
963717721 3:148822628-148822650 AAGGATAATTTGTTGGGTAGGGG + Intronic
963977915 3:151503784-151503806 AAAGATAGTTTGGCAGGTAGAGG + Intergenic
964011664 3:151899168-151899190 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
964098885 3:152964933-152964955 ATGGACAATTTGGTAGGCAGGGG + Intergenic
964111975 3:153097179-153097201 AAGGATAATTTGGTGGGAAGGGG - Intergenic
964366211 3:155953341-155953363 AAGGATTATTTGGTGGGTAGGGG + Intergenic
964453041 3:156831091-156831113 AAGGATAGTTTGGCAGGCGGTGG + Intronic
964920693 3:161891938-161891960 AAAGATAGTTTGGTGGGTAGGGG - Intergenic
964921233 3:161898149-161898171 AAGGATAACTTGGTGGGTTGGGG - Intergenic
964938345 3:162122730-162122752 AAGGATAATTTGGTAGACAGGGG + Intergenic
964986867 3:162752862-162752884 AAGGATAATTTGGTGGATAGGGG - Intergenic
965071445 3:163920378-163920400 AAGGACAGTTTGGTGGGCATGGG + Intergenic
965143391 3:164867132-164867154 AAGGTGACTTTGGTGGGCAGTGG + Intergenic
965364225 3:167778400-167778422 AAGGATAATTTGGTGGGCAGGGG + Intronic
966346586 3:178987807-178987829 AAGGATAATCTAATGGGCAGGGG - Intergenic
966381104 3:179346513-179346535 AAGGACAATTTGGTGGGTTGGGG - Intergenic
966423101 3:179753349-179753371 CAGAATAGTTTTGTGAGCAGGGG + Intronic
966757435 3:183384630-183384652 AAGGATAACTTGGTGGGTGGGGG - Intronic
966993239 3:185255037-185255059 AAAGGTGGTTTGGTGGGCAGGGG - Intronic
967592892 3:191299338-191299360 AAGGATGGTTTTGTGGGCCAGGG + Intronic
967597918 3:191349570-191349592 AAGGATGGGGTGGTGGGAAGAGG + Intronic
967760887 3:193225325-193225347 AAGGATAATATGGTGGGTAGGGG - Intergenic
967962250 3:194935126-194935148 AAGGATAATTTGGTGGGTAGGGG + Intergenic
968120730 3:196123999-196124021 AAGGATAATTTGGTGGGTAGGGG - Intergenic
968126918 3:196166813-196166835 GTGAATAGTTTGGTGGACAGGGG + Intergenic
968210472 3:196844534-196844556 AAGGATAATTTGGTGGGTGGGGG + Intergenic
968291009 3:197539808-197539830 AAGGATAATTTGGTGGGTGGGGG - Intronic
969064397 4:4466898-4466920 AAAGCCAGTTTGGTGGGCAGGGG + Intronic
969655240 4:8493426-8493448 AAGGATAACTTGGTGAGTAGAGG - Intronic
969939143 4:10712987-10713009 AAGCATAACTTGGTGGGCAATGG - Intergenic
970237537 4:13973753-13973775 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
970440053 4:16072992-16073014 AAGTATAATTTGGTGGGTAGGGG - Intronic
970528911 4:16962358-16962380 AAAGATAATTTCGTGGGTAGGGG + Intergenic
970579358 4:17460725-17460747 AAGGACAACTTGGTGGGTAGGGG + Intronic
970592660 4:17572885-17572907 AAGGATAATTTGGTGGGTAGTGG - Intergenic
970622538 4:17838839-17838861 AAGATTAATTTGGTGGTCAGTGG + Intronic
970723019 4:19009892-19009914 AAGGATAATTTGGTGGGTAGGGG + Intergenic
970729597 4:19087738-19087760 AAAGATAATTTGGGGGGTAGGGG + Intergenic
970875407 4:20863201-20863223 AAGGATAATTTGGTGAGTAGGGG + Intronic
971218430 4:24683173-24683195 AGGCATAGTTTGGTGGGCAGGGG + Intergenic
971238379 4:24864528-24864550 AAGGATAATTTGGCAGGTAGGGG - Intronic
971322678 4:25617987-25618009 AAGGATAATTTGGTGAGTAGGGG - Intergenic
971784705 4:31085119-31085141 AAGGATAACTTGATGGGTAGGGG + Intronic
971902778 4:32683173-32683195 AAGGATAGGTTGGTAGACAGAGG - Intergenic
971975510 4:33681166-33681188 AAAGACAGTTTAGAGGGCAGGGG + Intergenic
972195261 4:36646340-36646362 AAAGATAATTTGCTGGGTAGGGG + Intergenic
972301463 4:37789229-37789251 AAAGATAAATTGGTGGGTAGGGG + Intergenic
972302036 4:37793442-37793464 AAATATAGTTTGGTGGGCAAAGG + Intergenic
972568647 4:40291134-40291156 AAGGATAATTTGGTGGGTGGGGG - Intergenic
972819437 4:42682907-42682929 AGGGATAATTTGGTGGGTATGGG + Intergenic
972973865 4:44609944-44609966 AAGGCTAATTTGGTGGGTAGAGG - Intergenic
973248992 4:48041942-48041964 AAGGAAAATTTGGTGGGTGGGGG + Intergenic
973635247 4:52856338-52856360 ATGGAGAGATTGGTGGGGAGAGG - Intergenic
973779609 4:54276223-54276245 AAGGATGATTTGGTGGGTAGGGG - Intronic
974415973 4:61607106-61607128 AAGGACAGTTTGGTGGGTGGGGG + Intronic
974463468 4:62221106-62221128 AAGGATAGTCTGGAGGTTAGAGG + Intergenic
975264305 4:72343546-72343568 AAAGATATTTTGGCAGGCAGGGG - Intronic
975293529 4:72705599-72705621 AAAGATAATTTGGTGGGTAGGGG - Intergenic
975581555 4:75911486-75911508 ATGGATAATTTGGTGAGCTGGGG + Intergenic
975707206 4:77122929-77122951 AAAGATAATTTGGCAGGCAGGGG - Intergenic
975862639 4:78693757-78693779 AAGGATAGGTTAGCAGGCAGAGG + Intergenic
975981995 4:80171697-80171719 AAGGATAATTTGGCAGGCAGGGG + Intergenic
976008094 4:80454847-80454869 AAGGATAACATGGTGGGTAGGGG + Intronic
976143234 4:82015063-82015085 AAAGATAATTTAGTGGGCAAAGG + Intronic
976195604 4:82528842-82528864 AAGGATACTTTGGGAGGCCGAGG - Intronic
976278876 4:83307092-83307114 AAGGATAATTTGGCCGGTAGGGG - Intronic
976302158 4:83525507-83525529 AGGGATAGTTTGGTGCACAGTGG + Intergenic
976399214 4:84588561-84588583 AAAGATAGTTTGGTGTGCAGGGG + Intronic
976538840 4:86249418-86249440 AGGGACAATTTGGTGGGCACAGG - Intronic
976746551 4:88408884-88408906 AAAGACAGTTTGGTGGGCAGGGG + Intronic
977056988 4:92204880-92204902 AAGGATAATTTGGTGGGTAAGGG + Intergenic
977389016 4:96384018-96384040 AAGGATAATTTGGTGGGTAGGGG + Intergenic
977509973 4:97951167-97951189 AAGGACAATTTGGTGGGTAGGGG - Intronic
977714151 4:100162316-100162338 AAGGATACTTTGTCAGGCAGGGG + Intergenic
977926229 4:102703777-102703799 AAAGATAATCTGGTGGGTAGGGG - Intronic
978032166 4:103948701-103948723 AAAGATAATTTGGTAGGTAGGGG + Intergenic
978137394 4:105279278-105279300 AAGTATAGTTTGGGGGGTTGGGG + Exonic
978398542 4:108307874-108307896 AAGGATAATTTGGTGGGTGGGGG + Intergenic
978445622 4:108777470-108777492 AGGAATAGTTTGGTGGACATGGG + Intergenic
978457363 4:108908786-108908808 AAGGATAATTTGGTGGGTAGGGG + Intronic
978700162 4:111633631-111633653 AAGGAAAATTTCGGGGGCAGAGG - Intergenic
978863281 4:113476978-113477000 AAGGATAATTTGGCAGGCAGGGG - Intronic
979153724 4:117355531-117355553 AAGGATTGTTTGGCAGGCAGGGG - Intergenic
979308134 4:119172360-119172382 AAGGAAAATTTGGTGGGTAGTGG + Intronic
979350954 4:119643985-119644007 ATGGATAATTTGGCAGGCAGTGG - Intergenic
979458595 4:120953883-120953905 ATGGATAATTTGGTGGGCAAGGG - Intergenic
979480271 4:121208508-121208530 AAGGATAATTTGATGAGTAGGGG - Intronic
979484696 4:121257225-121257247 AAGGATAACTTGGTGGGTGGGGG + Intergenic
979719206 4:123879305-123879327 AAGGATAATTTGATGGGTAGGGG - Intergenic
979849638 4:125560173-125560195 CAGGATAATCTGGTGGGTAGGGG - Intergenic
980145734 4:128981649-128981671 AAGGATAATTTGGCGGGTAGGGG - Intronic
980270443 4:130577148-130577170 AAGGATAATTTGGTGGGTGGGGG - Intergenic
980339960 4:131532169-131532191 AAGGATAATTTGGCAGGGAGGGG - Intergenic
980396914 4:132226451-132226473 AAGGATGTTTTGGTGGGCATGGG - Intergenic
980466727 4:133196280-133196302 AAGGATGATTTGGTGGGTGGGGG + Intronic
980489180 4:133503931-133503953 AAAGGTAGTTTGGTGGGCAGGGG + Intergenic
980564331 4:134518890-134518912 AAGGGCACTTTGGTGGGCACGGG - Intergenic
980777423 4:137454463-137454485 AAGGATAATTTTGTTGGTAGGGG - Intergenic
980817533 4:137967548-137967570 GAGGATAATTTGGTGGGTAGGGG + Intergenic
980829168 4:138108816-138108838 AAGTATAGTTTGGTGGGCATGGG - Intergenic
980832845 4:138152578-138152600 AAAAATAATTTGGTGGGTAGAGG + Intergenic
980872682 4:138627407-138627429 AAGGATAATTTGGTAGGTAAGGG - Intergenic
980932932 4:139198739-139198761 AAGAATAATTTGGTGGGTAGGGG - Intergenic
980963555 4:139499648-139499670 AAGGGTACTTTGGTGGGAAGGGG - Intronic
981192099 4:141876127-141876149 AAGAACAGTTTGGTGGGAAAGGG - Intergenic
981258263 4:142689025-142689047 AAGGATAATTTGGTGGATAGGGG - Intronic
981305795 4:143245762-143245784 AAGGATAATTTGGTAGGTAGGGG - Intergenic
981536938 4:145809829-145809851 ATGGATAATTTGGTGGGCAGGGG - Intronic
981702820 4:147625926-147625948 AAGGATAATTTGCTGGGTAGGGG + Intronic
981893369 4:149765980-149766002 AAGGATAATTTGGCGGGCAGGGG - Intergenic
982008843 4:151087658-151087680 AAGGACAACTTGGTGGGTAGGGG - Intergenic
982012653 4:151121504-151121526 AAGATTATTTTGGTGGGCAGGGG + Exonic
982106135 4:152013628-152013650 AAAGACAGTGTGGTGTGCAGGGG - Intergenic
982237158 4:153262289-153262311 AAGGGTAGTTTGGTGGGCAGGGG + Intronic
982360495 4:154513965-154513987 AAAGATAGTTTGGTGGGCAGGGG + Intergenic
982475106 4:155841031-155841053 AAGGATAATTTGGTGGGTAGGGG - Intronic
982551147 4:156801253-156801275 AAGGATAGTTTGGCAGGCAAGGG - Intronic
982702945 4:158676167-158676189 AAGGATAATTTGATGAGTAGGGG + Intronic
982733423 4:158980003-158980025 AAGCTTGGTTTGGTGGGGAGGGG + Intronic
983153556 4:164316209-164316231 AAGGTTAGTTTGTTTGGGAGTGG - Intronic
983406266 4:167335122-167335144 CAGGATAGTTTGGGGGAAAGGGG - Intergenic
983470101 4:168144998-168145020 AAGGATAATTTAGTGGGTAGGGG + Intronic
983496716 4:168450383-168450405 AAGGACAACTTGGTGGGTAGGGG - Intronic
983760676 4:171402128-171402150 AAGGACAGTATGGTGGCCAGGGG - Intergenic
984091544 4:175381174-175381196 AAAGATAATTTGGAGGGTAGGGG - Intergenic
984247969 4:177298082-177298104 AAGGATAATTTGGTAGGCAAGGG - Intergenic
984250087 4:177321224-177321246 AACGAAACCTTGGTGGGCAGTGG - Intronic
984701945 4:182824235-182824257 AAGGATAACTTGGTGGGTGGGGG - Intergenic
984783366 4:183545964-183545986 AAGGATAGTATGTTGGGATGGGG - Intergenic
984903884 4:184609351-184609373 AGGGATAATTTGGTGGGTGGGGG - Intergenic
985062101 4:186090107-186090129 AAGGATAGTTTGGTGGGTAGGGG - Intergenic
985216736 4:187661299-187661321 AAGGGTAGTTTGGTGGGCAGAGG - Intergenic
985317204 4:188670929-188670951 AAGGATAACTTGCTGGGCGGGGG + Intergenic
985323230 4:188737982-188738004 AAGGAGAGTTTGGTAAGAAGCGG + Intergenic
985384471 4:189430978-189431000 GGAGATACTTTGGTGGGCAGGGG - Intergenic
985564685 5:609532-609554 TGGGATACTTTGGTGAGCAGAGG + Intergenic
985753078 5:1693941-1693963 AAGGCTAGTTTGGTAGGCAGGGG - Intergenic
986241549 5:5964661-5964683 AAAGATAGTTTGGTGGGCAGGGG - Intergenic
986463444 5:7996796-7996818 AAAGACAATTTGGTGGGTAGGGG + Intergenic
986509554 5:8489948-8489970 AAAGATAGTTTGGCGTGCAGCGG + Intergenic
986653607 5:9989159-9989181 ATGGATAATTTGTTGGGCAGGGG + Intergenic
986813406 5:11383533-11383555 TAGCATAATTTTGTGGGCAGTGG + Intronic
987191449 5:15482784-15482806 ATGGACAATTTGGTGGGCAGGGG + Intergenic
987486361 5:18532402-18532424 AAGGATAATTTGGTGGGTAGGGG + Intergenic
987489039 5:18553784-18553806 AAGGATAATTTGGTGGCTCGGGG + Intergenic
987491210 5:18582425-18582447 AAGGATAATTTGGTGGGCAGGGG + Intergenic
987733475 5:21807277-21807299 AAGGATAGTTTGGTGGGCAAGGG - Intronic
987853979 5:23394435-23394457 AAGGATAATTTGGTAGGCAGGGG - Intergenic
987857386 5:23438347-23438369 AAGGATAATTTGATGGGCAGAGG - Intergenic
988218017 5:28301945-28301967 ATGGATAATTTGGCAGGCAGGGG - Intergenic
988290793 5:29283012-29283034 AAAGACTGTTTGGTTGGCAGTGG - Intergenic
988419851 5:30992176-30992198 AAGGATAATTTGGTAGGCAGGGG - Intergenic
988597852 5:32611340-32611362 AAGGAGAGTTTGGTGGGGTAGGG + Intergenic
988658393 5:33237545-33237567 ATGGACAATTTGGTGGGCAGGGG + Intergenic
988680194 5:33477285-33477307 AGGGCTAATTTGGTGGGCAGCGG - Intergenic
988726103 5:33928010-33928032 AAAGATAATTTGGTGGGTAGGGG + Intergenic
988776330 5:34480950-34480972 AAGGACAACTTGGTGGGTAGGGG - Intergenic
988783170 5:34541900-34541922 AAAGATAGTTTGGTGGGCAGGGG + Intergenic
988783310 5:34543156-34543178 AAGGACAACTTGGTGGGTAGAGG + Intergenic
988783766 5:34547095-34547117 AAAGAGAGTTTGGTGAGCAAGGG - Intergenic
988828782 5:34967886-34967908 AAGTATAGTTTGGTGAGCAGTGG - Intergenic
988866939 5:35345573-35345595 AAGGATAGTTTGGTGAGCAGGGG + Intergenic
988936922 5:36093168-36093190 ATGGAGAGATGGGTGGGCAGAGG + Intergenic
988983173 5:36591876-36591898 AAGGATAATTTGGTGGGTCGGGG + Intergenic
989010734 5:36869278-36869300 AAGGATAATTTGGTGGGTGGGGG + Intergenic
989145789 5:38248847-38248869 AGGGATAATTTGGTGGGTGGAGG + Intergenic
989159221 5:38374362-38374384 AAAGATAATTTGTTGGGCAGGGG + Intronic
989387963 5:40871962-40871984 AAGCGTACTTTGGTGGGCAGGGG + Intergenic
989579268 5:43016816-43016838 AAGGATAGTTTGGTTTGCACAGG + Intergenic
989585709 5:43072672-43072694 AAGGATAGTTTGGTAAGCATGGG + Intronic
989618367 5:43359960-43359982 ATGGATAATTTGGTGGGCAGGGG - Intergenic
990260191 5:54013843-54013865 AAGGGTAGTTTGTTGGGTGGGGG - Intronic
990307288 5:54505789-54505811 AAGGATAATTTGCTGGGTAGGGG + Intergenic
990597717 5:57328128-57328150 AAAGATAGTTTGGCAGGAAGAGG + Intergenic
990744368 5:58943691-58943713 AAGAGTAATTTGGTGGGCAAAGG + Intergenic
991027431 5:62045313-62045335 AAGGACAGTTTCGTGGGCAGGGG + Intergenic
991030400 5:62076493-62076515 AAGGATAATTTGGTGGGTAGAGG - Intergenic
991410345 5:66339374-66339396 AAGGATAGTTTGGTGGGCAAGGG + Intergenic
991425979 5:66492128-66492150 AAGGACAATTTGGTGAGTAGGGG + Intergenic
991610002 5:68440190-68440212 GAGGATAGTTTGGTGGTCAAGGG + Intergenic
991611441 5:68453892-68453914 AAGGATAATTTGATGGGTAAGGG + Intergenic
991665406 5:68994754-68994776 AATGATAGCTTGGCGTGCAGGGG - Intergenic
991692855 5:69242266-69242288 AAGGATAGTTTGGTAGGCAGTGG + Intronic
991997347 5:72401014-72401036 AAGGATAATTTGGTGGGAAGGGG - Intergenic
992009489 5:72512487-72512509 AAAGATAATTTGGCGGGTAGGGG + Intergenic
992286616 5:75242125-75242147 AAAGATAATTTGGTGGGTAGGGG + Intergenic
992722855 5:79577945-79577967 AAGGATAATTTTGTGGGTAGGGG - Intergenic
992723226 5:79580983-79581005 AAGGATCATTTGGTGGGTAAGGG - Intergenic
992761388 5:79953784-79953806 AAAGATAATTTGGTGGATAGGGG - Intergenic
992781684 5:80133820-80133842 AAGGATAATTTGGTGGGCAGGGG + Intronic
992889568 5:81191497-81191519 AAAGATAATTTTGTTGGCAGGGG + Intronic
992959147 5:81941060-81941082 AAGGATAGTTTGGTGGGCAGTGG - Intergenic
993013276 5:82508162-82508184 AAGGATAGTTTGGTGGCACGGGG - Intergenic
993421941 5:87713865-87713887 AAGGATAACTTGGTGGGTGGGGG + Intergenic
993647962 5:90482820-90482842 AAAGTTAATTTGGTGGGTAGGGG - Intronic
993966462 5:94366099-94366121 AAGGATAATTTGGTAGGTAGAGG - Intronic
994648395 5:102498124-102498146 AAAGATAATTTGGCTGGCAGGGG - Intronic
994778319 5:104062785-104062807 AAGGATAACTTGGTGGGTTGTGG - Intergenic
994784191 5:104134437-104134459 AAGGATAGTTTGGCGGGCAGGGG - Intergenic
995075518 5:107978712-107978734 AAGGATAGTTTGGTGGGCAGTGG - Intronic
995200981 5:109425060-109425082 AAGGATAATTTGGTGGGTGGGGG - Intergenic
995207941 5:109503893-109503915 AAGGATAGCTTGGTTGGTAAGGG + Intergenic
995588521 5:113674215-113674237 AAGGATAGTTTGGTAAACAGGGG - Intergenic
995620175 5:114017342-114017364 AAAGATAGTTTGGCAAGCAGGGG - Intergenic
995835304 5:116394810-116394832 AAGAGTAGTTTTGTAGGCAGGGG - Intronic
996643536 5:125787743-125787765 AAAGATAGTTTGGTGGGCCAGGG - Intergenic
996787375 5:127255018-127255040 ATGGATAATTTGGTGGGCAGGGG + Intergenic
996861049 5:128066032-128066054 GAGGATAGTTTGACAGGCAGGGG - Intergenic
996955509 5:129178648-129178670 AAAGTTAATTTGGTGGGTAGGGG + Intergenic
997158692 5:131584760-131584782 AAGGATAGTTTGGTGGGCCAGGG - Intronic
997301476 5:132809231-132809253 AAGGATAATTTGGTGGGTAGGGG - Intergenic
997497667 5:134343799-134343821 AAGGACAACTTGGTGGGTAGAGG - Intronic
997828563 5:137129497-137129519 ATGGATAATTGGGTGGTCAGGGG + Intronic
997948909 5:138226326-138226348 AAGGATAGTTTGGCAGGCAGGGG - Intergenic
998030554 5:138863803-138863825 AAAGATGGTTTGGTAAGCAGGGG + Intronic
998628395 5:143871530-143871552 AAGGACAGTTTGTTGGGTAGGGG - Intergenic
998744895 5:145247248-145247270 AAAGATAATTTGGTGAGTAGGGG - Intergenic
999161460 5:149503206-149503228 AAGGATAACTTGCTGGGCTGGGG + Intronic
999414360 5:151381796-151381818 AAGGATAACATGGTGGGTAGGGG - Intergenic
999805974 5:155081687-155081709 AAGGATAATTTGGCGAGTAGGGG + Intergenic
999830417 5:155313598-155313620 ATGGACAATTTGGTGAGCAGGGG + Intergenic
999898109 5:156056623-156056645 AAGGATAATTTGGCAGGTAGGGG - Intronic
999976053 5:156913223-156913245 ATGGACAGTTTGGAGAGCAGGGG - Intergenic
1000017810 5:157293842-157293864 CAGGATAGTTTGGTGGGCATGGG + Intronic
1000082372 5:157860273-157860295 AAAGATAGTTTGGTGAGCAGAGG + Intergenic
1000091642 5:157934687-157934709 AAGGAGAATTTGGTGGGTAAGGG + Intergenic
1000189557 5:158896871-158896893 TAGGATAGGTGGGTGGGCAGGGG - Intronic
1000857932 5:166422679-166422701 AAGAATAGTGTGGTAGTCAGTGG + Intergenic
1001060402 5:168483461-168483483 AAATATAGTTTGCTGGGCAGTGG + Intergenic
1001566705 5:172704236-172704258 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1001758087 5:174186104-174186126 AAGGTTAGTTTGCTGGTAAGCGG + Intronic
1001890888 5:175337533-175337555 AAGGATAGTTTGGTGGGTAGAGG - Intergenic
1001915904 5:175559820-175559842 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1001921753 5:175606070-175606092 AAGGATGGTTTGGTGGGCAGGGG + Intergenic
1003025157 6:2548225-2548247 AAGGATAGTTTGATGGGTGAGGG - Intergenic
1003102518 6:3187819-3187841 AAGGATAATTTGGCAGGGAGGGG - Intergenic
1003267967 6:4583210-4583232 AAGGATAATTTGGTGGGTGGGGG - Intergenic
1003312359 6:4980715-4980737 AAGAATAATTTGGTAGGTAGGGG + Intergenic
1003819437 6:9879249-9879271 AAAGATAGGTTGGTGGTCAGGGG - Intronic
1004293560 6:14389862-14389884 AAAGATAGTTTGGCAGGCAGGGG + Intergenic
1004390226 6:15203710-15203732 AAGGATAACTTGGTGGGTAGGGG + Intergenic
1004445460 6:15693670-15693692 AAGGATAATTTGGTGGCTAGGGG - Intergenic
1004468088 6:15904415-15904437 AAGTATAATTTGGTGGGTAGGGG + Intergenic
1004468199 6:15905288-15905310 AAGGATAGTTCGTTGGGCCAGGG + Intergenic
1004501782 6:16216450-16216472 AAGAATAGTTTGGCAGGCAGGGG - Intergenic
1004604352 6:17179784-17179806 AAGGATAGTTTGGTAGGCAGGGG + Intergenic
1004604743 6:17183408-17183430 AAGGATAGTTTGGTGGGACAGGG - Intergenic
1004921629 6:20381445-20381467 AAGGATAATTTGGTGGGCAAGGG + Intergenic
1005103475 6:22198810-22198832 ATGGATAGTTCGGTGAGCAGTGG + Intergenic
1005292931 6:24396886-24396908 ATGGACAATTTGGTGGGCAGGGG + Intergenic
1005429297 6:25737421-25737443 AAAGATAGTTTGGCAAGCAGGGG - Intergenic
1005527809 6:26668573-26668595 AAGGATAGTTTGGTGGACAGGGG + Intergenic
1005542987 6:26833099-26833121 AAGGATAGTTTGGTGGACAGCGG - Intergenic
1005661758 6:28005329-28005351 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1005708998 6:28485536-28485558 AAAGACAGTTTGGTGGGCAGGGG + Intergenic
1005748346 6:28861100-28861122 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1006057550 6:31396522-31396544 AAGGATAATTTGGTGGATAGGGG + Intergenic
1006069979 6:31491188-31491210 AAGGATAATTTGGTGGATGGGGG + Intergenic
1006355919 6:33557745-33557767 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1006870125 6:37243774-37243796 GAGGATAGTTTGGTGAGCAGAGG + Intronic
1007012679 6:38432808-38432830 AAGGATAGTTTGGTGGGCACAGG - Intronic
1007210041 6:40186166-40186188 AAACATAGTTTGGTGGGCAGGGG + Intergenic
1007276855 6:40680387-40680409 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1007503601 6:42317126-42317148 ACGGATAATTTTGTGGACAGGGG - Intronic
1007723833 6:43902316-43902338 AAGGGTTCTTTGGTGGGCAGGGG - Intergenic
1008103350 6:47416385-47416407 ATGGATAATTTGGTGGGCAGGGG + Intergenic
1008104444 6:47427269-47427291 ATGGATAATTTAGTGAGCAGGGG - Intergenic
1008221887 6:48864235-48864257 ATGGATAACTTGGTAGGCAGGGG + Intergenic
1008440730 6:51529328-51529350 AAGGATAGTTTGCCAGGTAGGGG + Intergenic
1008504057 6:52211899-52211921 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1008650700 6:53558678-53558700 AAGGATAGTTTGGAGGTTAGCGG + Intronic
1008657506 6:53630794-53630816 AATGATAGCTTGGTGGCCACTGG - Intergenic
1008939319 6:57029409-57029431 AAGGATAATTTGGCGGGTATGGG - Intergenic
1008956702 6:57223268-57223290 ATGGTTACCTTGGTGGGCAGGGG + Intergenic
1009013803 6:57875280-57875302 AAGGATAGTTTGATGGACAGGGG - Intergenic
1009625804 6:66137973-66137995 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1009750894 6:67878386-67878408 AAAGATAATTTGGCGGGTAGGGG + Intergenic
1009995046 6:70887914-70887936 AAGAATAGTAAGGTGGGCAGGGG + Intronic
1010201103 6:73282830-73282852 AAGGATAATATGGTGGGTGGGGG - Intronic
1010201308 6:73284487-73284509 ATAGATAATTTGGTGGGCAGGGG - Intronic
1010397621 6:75409935-75409957 ATGGATAATTTGGTGGGCAAGGG - Intronic
1010409069 6:75540007-75540029 AAGAATTGTCTGGTGGTCAGGGG - Intergenic
1010440135 6:75884659-75884681 AAGGATAATTTGGTAGGTAGGGG + Intronic
1010637503 6:78279486-78279508 AAAGATAAATTGGTGGGTAGGGG - Intergenic
1010729904 6:79380161-79380183 AAAGATAATTTGGTGGGCAGGGG - Intergenic
1011022807 6:82833181-82833203 AAGGACAGTTTGGTGGGCAGGGG + Intergenic
1011049319 6:83126908-83126930 AAGGATAATTTGGTGGGTAGGGG + Intronic
1011256943 6:85432156-85432178 AAGGATAGTTTAGTGGGCCAGGG - Intergenic
1011338701 6:86288048-86288070 AAGGATAATTTAATGGGTAGGGG - Intergenic
1011438793 6:87366470-87366492 AAGGATAATTTGACAGGCAGGGG + Intronic
1011491989 6:87901672-87901694 AAGGATAATTTGGTGGGAAGGGG + Intergenic
1011494129 6:87921965-87921987 AAGGATAGTCAGGTGTGCATGGG - Intergenic
1011825523 6:91301452-91301474 AAGGATAATCTGGCAGGCAGGGG + Intergenic
1011848983 6:91602592-91602614 AAGAATAATTTGGTGGGCAGGGG - Intergenic
1012020769 6:93915998-93916020 AATGATAGTTTGGTGGGCAGGGG + Intergenic
1012060851 6:94478473-94478495 AATGATAGTTTGGGGGGAGGTGG + Intergenic
1013085373 6:106852378-106852400 ATGGACAATTTGATGGGCAGGGG - Intergenic
1013086075 6:106858933-106858955 AAGGATAATTTGCTGGGTCGTGG - Intergenic
1013246070 6:108288724-108288746 AAGGATAATTTGGTAGATAGGGG + Intergenic
1013246086 6:108288821-108288843 AAGGATAATTTGGTGGACAGGGG + Intergenic
1013478408 6:110530748-110530770 AAGGAGAGTTTGGTGGTCAGGGG + Intergenic
1013485065 6:110589004-110589026 AAGGATAGTTTGGCAGACAGAGG - Intergenic
1013487918 6:110616036-110616058 AAAGATACTTTGGTGGGCAGGGG - Intronic
1013534972 6:111055723-111055745 AAAGCGAGTTTGGTGGACAGTGG - Intergenic
1014399188 6:120965890-120965912 ACAGATAGTTTGGTCAGCAGGGG + Intergenic
1014469635 6:121798720-121798742 AAGTATAGCTTGATGGGCAGGGG - Intergenic
1014673356 6:124334461-124334483 AAAGATAATTTGGTGGGTAGGGG + Intronic
1015173262 6:130278276-130278298 AAGGATAATTTGGTAGGTGGTGG - Intronic
1015323089 6:131897926-131897948 AAGGATAGCTTAGTAGGCATGGG + Intergenic
1015367807 6:132416426-132416448 AAAGATAGTTTGGTGTGGAGGGG - Intergenic
1015511920 6:134046508-134046530 TAGAATAATTAGGTGGGCAGCGG + Intronic
1015687568 6:135882199-135882221 AATGAGAATTTGGTGGGCTGTGG - Intronic
1015756530 6:136612119-136612141 AAAGATAGTTTGGTGAGCAGGGG - Intronic
1015847046 6:137531654-137531676 AAGGATAGTTTGGTGGACAGGGG + Intergenic
1016028715 6:139315236-139315258 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1016065160 6:139674514-139674536 AAGGACAGTTTGGGGGTTAGGGG + Intergenic
1016075139 6:139787128-139787150 AAGCTTAGTTTGGTGGGAAATGG + Intergenic
1016153630 6:140776198-140776220 AAGAATAGTTTTCTGGCCAGAGG + Intergenic
1016164044 6:140917577-140917599 AAGGATAATTTGGTGGGGAGGGG - Intergenic
1016317680 6:142808402-142808424 AGGGATAGATGGGTGGACAGAGG + Intronic
1016497609 6:144682138-144682160 AAGGGTAGTTGGTGGGGCAGGGG - Intronic
1016514052 6:144873967-144873989 ATGGATAATTTGGTGGGCAGGGG - Intergenic
1016742488 6:147542506-147542528 AAGGATAACTTGGTGGGTGGGGG + Intronic
1017177777 6:151520847-151520869 AAGGATAACTTGGTGGGTGGGGG - Intronic
1017475396 6:154786165-154786187 AAAGATAATTTGGTGGGTAGGGG + Intronic
1017785535 6:157753912-157753934 AAAGATAATTTGGTGGGTGGGGG + Intronic
1017795723 6:157842581-157842603 AAAGATAATTTGGTGGGTAGGGG + Intronic
1017795919 6:157844298-157844320 AAGGACAATTTGGTGGGTGGGGG + Intronic
1018313204 6:162531456-162531478 AAGGATAACTTGGTGGGTGGGGG + Intronic
1018562705 6:165118782-165118804 ACAGATAGTTTGGCAGGCAGCGG + Intergenic
1018779639 6:167051002-167051024 AAAGATAGTTTGGTGGGCAGGGG + Exonic
1018793030 6:167163959-167163981 AAAGGTAGTTTGCTGGGAAGGGG - Intronic
1018836000 6:167484692-167484714 AAGGATAGTTTGTTGGGCAGGGG + Intergenic
1019254749 7:42205-42227 AAGGATTGTTTGGTGGGCAGAGG - Intergenic
1019507730 7:1401269-1401291 AAGGATAGTTTGACAGGCAGGGG - Intergenic
1019803861 7:3108180-3108202 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1019924480 7:4183027-4183049 CAGGATAGTTTGGTGGGCGTGGG + Intronic
1020450910 7:8319630-8319652 AAGGATAGTTTAGTAGGCAGGGG + Intergenic
1020466033 7:8480798-8480820 CAGGATTGCTTGGTGGGGAGGGG - Intronic
1020518173 7:9152031-9152053 AGGGATAATTTGGTGGGTGGGGG - Intergenic
1020762764 7:12289039-12289061 AAGGATAATTTGGTGTGTAGGGG - Intergenic
1020763994 7:12298676-12298698 AAGGATAATTTGGCGGGTAGGGG - Intergenic
1020764772 7:12305775-12305797 AAGAATAATTTGGTGGGTTGGGG - Intergenic
1020991211 7:15198641-15198663 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1021085703 7:16419793-16419815 AAAGATAATTTGGCGGGTAGAGG - Intronic
1021124576 7:16836504-16836526 AAGGATAATTTGGTGGATAGGGG + Intergenic
1021180342 7:17498550-17498572 AAAGATAATTTTGTGGGTAGGGG + Intergenic
1021387110 7:20044895-20044917 AAGTAAAGTTTGATGAGCAGAGG + Intergenic
1021507585 7:21402537-21402559 AAAGATAATTTGGTGGGTGGGGG + Intergenic
1021597987 7:22337172-22337194 AAAGACAGTTTGGTGGGCAGGGG + Intronic
1021732426 7:23608875-23608897 AAGGATAATTTGGTAGGTAGGGG + Intronic
1021738790 7:23664569-23664591 AAGGATAGTTTGGCAGTCAAGGG + Intergenic
1022527934 7:31050341-31050363 ATGCCTGGTTTGGTGGGCAGTGG + Intergenic
1022649495 7:32261408-32261430 AAAGATAATTTGGCGGGTAGGGG - Intronic
1023197960 7:37663111-37663133 AAGGATAATTTGGCAGGCAGGGG - Intergenic
1023523371 7:41071714-41071736 AAGGATAGTTTGGCTGACAGGGG - Intergenic
1023579695 7:41668521-41668543 AAAGATAGTTTGGTGGGCAGGGG + Intergenic
1023699830 7:42882186-42882208 AAGGAGAATTTGTTGGGCAAGGG - Intergenic
1023753989 7:43398810-43398832 AAGGATAGTTTGGTGAGTAGGGG + Intronic
1023800789 7:43832655-43832677 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1023817090 7:43959451-43959473 AAGAATAGTTTGGCAGGCAGGGG - Intergenic
1023932488 7:44714403-44714425 AAGGATAGTTTGGTGGGTAGGGG - Intergenic
1023998526 7:45176673-45176695 GGGGATGTTTTGGTGGGCAGAGG + Intronic
1024002569 7:45200452-45200474 AAGGGTACTTTGGCAGGCAGAGG + Intergenic
1024035490 7:45504552-45504574 AAGGATAGTTTAGTGGGCAGGGG - Intergenic
1024041540 7:45559825-45559847 ATGGATAATTTGGTGGGCAGGGG - Intergenic
1024140378 7:46457197-46457219 CAGAATAGTTTGGCGGGCAAGGG + Intergenic
1024315896 7:48016257-48016279 AAAGATAGTTTGGCAGGTAGGGG - Intronic
1024338853 7:48237033-48237055 TTGGATAATTTGGTGGGCAGGGG + Intronic
1024378534 7:48667383-48667405 AAGTATAGTTTGGTGGCCAGGGG + Intergenic
1024695787 7:51855500-51855522 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1024720720 7:52135188-52135210 GAGGATAATTTTATGGGCAGGGG + Intergenic
1025604473 7:63029447-63029469 AAGGTGGGTTTGGTGGGGAGGGG - Intergenic
1025624428 7:63207297-63207319 TAAGATAATTTGGCGGGCAGGGG + Intergenic
1025734646 7:64136236-64136258 AAGGATAATTTGGTAAGCAAGGG - Intronic
1026084975 7:67255515-67255537 AATGATAATTTGGTGGGCAGGGG + Intergenic
1026147632 7:67761098-67761120 AAAAATAGTTTGGTGGACAGGGG + Intergenic
1026160484 7:67864215-67864237 AAGGATAATTTGGTAAGCAAGGG - Intergenic
1026247630 7:68635276-68635298 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1026251401 7:68674134-68674156 AAGGATAATTAGATGGGTAGAGG - Intergenic
1026274879 7:68867830-68867852 AAGGGTAGTTTGTTGGGCCAGGG + Intergenic
1026495150 7:70895415-70895437 AAGGATAATTTGGTGAGTAGGGG + Intergenic
1026692198 7:72559405-72559427 AATGATAATTTGGTGGGCAGGGG - Intronic
1026967940 7:74452348-74452370 ATGGATAATTTGGTGGGCAAGGG + Intergenic
1027161599 7:75806631-75806653 AAGAATAGTTTGGTAGGCAGTGG - Intergenic
1027216772 7:76188814-76188836 GAGGATAGTTTGGCGGGCCAGGG + Intergenic
1027339077 7:77186492-77186514 AAGGGTAGTGGGGAGGGCAGGGG + Intronic
1027372147 7:77517807-77517829 AAGGCTGGAGTGGTGGGCAGGGG - Intergenic
1027435388 7:78159068-78159090 AAAGATAATTTGGTGGGTAGGGG - Intronic
1027448665 7:78303956-78303978 AGGAATAGCTTGGTGGGGAGTGG - Intronic
1027467683 7:78535990-78536012 AAGAATAATTTGGTGAGAAGAGG - Intronic
1027735921 7:81932844-81932866 AAGGGTAGTTTGATGGGCAGGGG + Intergenic
1027744976 7:82061742-82061764 AAAGACAGTTTGATGGGCAGGGG + Intronic
1027871197 7:83710481-83710503 AAAGATAGTTTTGTGAGCAGGGG + Intergenic
1028143430 7:87296160-87296182 AAATATAGTTTGGTGGGCAGGGG + Intergenic
1028147297 7:87331966-87331988 AAAGGTAGTTTGGTGAGCAGGGG - Intergenic
1028740428 7:94268331-94268353 AAGGATAACTTGGTGAGTAGAGG + Intergenic
1028827820 7:95294056-95294078 AGGGGCATTTTGGTGGGCAGTGG + Intronic
1029002363 7:97167642-97167664 AAGGAAAATTTGGTGGGTGGGGG + Intronic
1029030398 7:97460757-97460779 AAGGACAATTTGGTGGGTTGGGG - Intergenic
1029179968 7:98693288-98693310 ATGGGTAATTTGGTGAGCAGGGG + Intergenic
1029509525 7:100985178-100985200 AAGGATAACTTGGTGGGTTGGGG + Intronic
1029556408 7:101272837-101272859 CAAGATAGTTTGGTGGGCAGGGG - Intergenic
1029559634 7:101294054-101294076 AAGGATAATTTGATGGGTAGGGG + Intergenic
1029576995 7:101410076-101410098 AAGGTTGGTTTGGTGGGCAGGGG + Intronic
1029582539 7:101446968-101446990 AAAGACAATTTGGTGGGTAGAGG + Intronic
1029583862 7:101457068-101457090 AAGGATAGTTTAATGGGCAGGGG + Intronic
1029916979 7:104220464-104220486 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1029921070 7:104264603-104264625 CAGGATAATTTGATGGGCAGGGG - Intergenic
1029930191 7:104362763-104362785 GAAGATAGTTTGGTGGGCATGGG + Intronic
1029952985 7:104606775-104606797 ATGGGCAATTTGGTGGGCAGGGG + Intronic
1029953050 7:104607254-104607276 AAGGACAGTGTGGAGGTCAGAGG + Intronic
1030472461 7:109982288-109982310 AAGGACAGTTTGGCAGGCAGGGG - Intergenic
1030608857 7:111667440-111667462 GAGGATAGTGTGGTGGTCAAGGG - Intergenic
1030680935 7:112433260-112433282 AAGGACAATTTGGTGAGTAGTGG + Intronic
1031182141 7:118432744-118432766 AAGAATGGATTTGTGGGCAGAGG + Intergenic
1031513781 7:122678492-122678514 AAGGATAATTTGGTGGGCAAGGG + Intronic
1031702274 7:124941513-124941535 AAGGATAACTTGGTGGGTGGCGG + Intergenic
1031832552 7:126645479-126645501 ATGGACTGTTTGGTGGGCAGGGG - Intronic
1031840828 7:126737387-126737409 AAGGATAATTTGGTGGGTGGGGG - Intronic
1032215020 7:129951464-129951486 AAGGGTAGTTTAGAGGGTAGGGG - Intronic
1032247329 7:130224076-130224098 ATGGACAATTTGGTGGACAGGGG + Intergenic
1032472269 7:132187176-132187198 AAGGATAATTTGGCAGGCGGGGG - Intronic
1032667146 7:134047985-134048007 AAAGATAATTTGGTGGGCAAGGG + Intronic
1032747725 7:134804966-134804988 AAGGGTAATTTGGTGGGTAGGGG + Intronic
1033071522 7:138207730-138207752 AAGGATAATTTGGTGGGTGGGGG + Intergenic
1033121516 7:138670604-138670626 AAAGATAGTTTGGTTGACAGGGG - Intronic
1033341709 7:140497312-140497334 AAGGATAGTTTGGTGGGCAGTGG + Intergenic
1033505339 7:141994376-141994398 AAGGGTACTTTGGTGGGCATGGG + Intronic
1033587136 7:142782409-142782431 GAGGATAATTTGGTGGGCGGAGG - Intergenic
1033640898 7:143262726-143262748 AATGATAGTTTGATGGGCAAGGG + Intronic
1033668019 7:143461994-143462016 ATGAATAATCTGGTGGGCAGGGG + Intergenic
1034067644 7:148152272-148152294 AAGGACAATTTGGTGGGCAGGGG + Intronic
1034463886 7:151214239-151214261 CAGGACAGTCTGCTGGGCAGAGG - Intronic
1034482713 7:151335072-151335094 AAGGATAGTTTGGTGGGCAAGGG - Intergenic
1034544066 7:151778188-151778210 ATGGACAATTTGATGGGCAGGGG - Intronic
1034585568 7:152089119-152089141 ATGGACAGTTTGGTGGGCAGGGG + Intronic
1034686702 7:152978198-152978220 AAGGATAATTTGGTGAGCAGGGG + Intergenic
1034709962 7:153182703-153182725 AAAGATAGTTTGGTGGGCCAGGG + Intergenic
1034915521 7:155035402-155035424 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1035183446 7:157107682-157107704 AGGGACAACTTGGTGGGCAGGGG - Intergenic
1035405334 7:158593341-158593363 AAGGATAATTTGGTGAGTAGAGG + Intergenic
1035435140 7:158854007-158854029 AAGGATAATTTAGTGGGTGGGGG + Intergenic
1035716798 8:1761643-1761665 AAGGATAATTTGGTAGGTAGGGG + Intronic
1035789404 8:2289944-2289966 ATGGATAATTTGGTGGCAAGGGG - Intergenic
1035803401 8:2431761-2431783 ATGGATAATTTGGTGGCAAGGGG + Intergenic
1035811553 8:2495733-2495755 AAGGACAATTTGGTGGGTGGGGG + Intergenic
1035871634 8:3141781-3141803 AAAGATAATTTGGCGGGCAGGGG - Intronic
1036162234 8:6399881-6399903 AAGGATAACTTGCTGGGCCGGGG - Intergenic
1036763456 8:11529324-11529346 AAGAATAATTTGGTGGGTGGAGG + Intronic
1036780498 8:11643716-11643738 AAGGTGGGTTTGGTGGGGAGGGG + Intergenic
1037134318 8:15443962-15443984 AAGGACAGCTTGGTGGGGTGGGG - Intronic
1037267590 8:17083081-17083103 AAGGATAATTTGGTGGGTAGTGG + Intronic
1037528282 8:19749190-19749212 AAGGACAGCTTAGTGGGAAGAGG - Intronic
1037554488 8:20008982-20009004 AAGGACAATTTGGCAGGCAGGGG - Intergenic
1037561056 8:20074714-20074736 AAGAATAGTTTGGTGGGCGGGGG + Intergenic
1037670295 8:21009685-21009707 AAGGACAATTTGGTGGGTAGGGG - Intergenic
1038160243 8:25030428-25030450 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1038165043 8:25077710-25077732 AAGGATAATTTGATGGGTAGGGG + Intergenic
1038280107 8:26156381-26156403 ATGGATAATTTGGTGGGCAGGGG + Intergenic
1038371673 8:26999553-26999575 AAAGGTAGTTTGGTGGGCAGGGG - Intergenic
1038562350 8:28591262-28591284 AAGGAGAGAGAGGTGGGCAGGGG + Intergenic
1038630825 8:29242124-29242146 AAGGCCTGTTTGGTGGGTAGAGG + Intronic
1038732248 8:30138114-30138136 AAGGATAATTTGGTGGGTAGGGG - Exonic
1038803722 8:30771956-30771978 AAGGATAGTTTGGTGGGCAGAGG + Intergenic
1038822470 8:30965464-30965486 AAGGATAATTTGGTGGGCAGAGG + Intergenic
1038869615 8:31479969-31479991 AATAATAGTTTGGTGGGCCAGGG - Intergenic
1039013580 8:33122472-33122494 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1039136275 8:34326627-34326649 AAGGATAGCTTGGCAGTCAGAGG + Intergenic
1039184907 8:34906088-34906110 AAGGGTAGTTTGGTGGGCAGGGG + Intergenic
1039259093 8:35751092-35751114 AAGGATAATTTGGTGGGTAGGGG + Intronic
1039287930 8:36062710-36062732 AAGGACAGTTTGGTGGGCAGAGG - Intergenic
1039300645 8:36205183-36205205 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1039305324 8:36255628-36255650 ATCGATAATCTGGTGGGCAGGGG - Intergenic
1039306470 8:36268535-36268557 AAGGATAGTTTGGGGGACAGGGG + Intergenic
1039381237 8:37087423-37087445 AAGGATAATTTGGTTGACAGGGG - Intergenic
1039406731 8:37319243-37319265 AAAAATAGTTTGGCAGGCAGGGG + Intergenic
1039727367 8:40233244-40233266 AAGAATAGTTTGGTAGGCAGAGG - Intergenic
1039892410 8:41694428-41694450 AAGGAGAGTTAAGTGGGAAGGGG - Intronic
1039909224 8:41810847-41810869 AAGGGTACTTTGGCAGGCAGAGG + Intronic
1040538641 8:48331787-48331809 CTGGATACTTTGGAGGGCAGTGG - Intergenic
1040998081 8:53421859-53421881 AAGGACAACTTGGTGGGCAGGGG - Intergenic
1041006709 8:53502974-53502996 AAGGACAGATTGGGAGGCAGAGG - Intergenic
1041123593 8:54611920-54611942 AAAGAAAGGTTGGGGGGCAGGGG - Intergenic
1041177660 8:55213250-55213272 AAGCATAATTTGGTGGGTAGGGG + Intronic
1041212449 8:55566245-55566267 AAGGTTACTTTGGCAGGCAGGGG - Intergenic
1041322219 8:56625043-56625065 AAAGATAGTTTGGGGTGCAAAGG + Intergenic
1041351748 8:56953730-56953752 AAGAATAGCTTGATGGGCAAGGG - Intergenic
1041425568 8:57716654-57716676 ATAGACAGTTTGGTGGGCAGGGG + Intergenic
1041478826 8:58295626-58295648 AAGTCTAATTTGGTGGGTAGGGG - Intergenic
1041555245 8:59146763-59146785 GAGGCTGGTTAGGTGGGCAGGGG + Intergenic
1041720705 8:60972770-60972792 AAGGATTGCTTGATGGGCATGGG - Intergenic
1041737346 8:61125306-61125328 ATGGATGGTTTGGGGGTCAGGGG + Intronic
1041758014 8:61334962-61334984 AAGGATAATTTGGTAGGTAGGGG + Intronic
1041906161 8:63036211-63036233 TATGATAGTGTGGTGGGGAGAGG - Intronic
1041917964 8:63154823-63154845 AAGGATAATTTGGTGGGTTGGGG + Intergenic
1041952095 8:63515165-63515187 AAGGATAATTTGATGAGCAGGGG + Intergenic
1042004321 8:64165005-64165027 AAGGATAGTTTGGTGAGCTGGGG + Intergenic
1042198377 8:66254208-66254230 GAGGATAATTTGGTGGGTGGGGG - Intergenic
1042397539 8:68309563-68309585 AAAGATAGTCTGGTGGGCAGGGG - Intronic
1042603685 8:70525169-70525191 CAAGATAGTTAGGTGGGCTGGGG + Intergenic
1042639227 8:70915000-70915022 AAGGATAGTTTGGTGAGCAGGGG + Intergenic
1042824372 8:72965261-72965283 AAGGATGGTTCGGTGGGGAGGGG + Intergenic
1042828873 8:73005736-73005758 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1042933602 8:74036631-74036653 ATGGACAATTTGGTGGGCTGGGG - Intergenic
1042979457 8:74509077-74509099 CATGATAGTTTTGTGGGGAGGGG + Intergenic
1043250725 8:78069836-78069858 AAGGATAATCTGGTGGGTGGGGG - Intergenic
1043379903 8:79691505-79691527 TAGGACAATTTGGTGGGCAAGGG + Intergenic
1043706043 8:83352165-83352187 AAGGAAAACTTGGTGGGTAGGGG + Intergenic
1043853531 8:85240515-85240537 AAGAATAGTTTGGCAGGCAGGGG - Intronic
1043853970 8:85244369-85244391 AAGGACAATTTGGTGGGTGGAGG - Intronic
1043944869 8:86238386-86238408 AAAGATAGTTTGGCAGGCAAGGG - Intronic
1043946978 8:86264560-86264582 ATAAATAATTTGGTGGGCAGGGG + Intronic
1044014800 8:87038404-87038426 AAGGATACTTTGGTGAGCAAAGG + Intronic
1044198060 8:89402212-89402234 AAAGATAGATTGGGGAGCAGGGG - Intergenic
1044233164 8:89801994-89802016 ATGGATAATTTGGTGGGCAGGGG - Intergenic
1044243395 8:89912815-89912837 AAGGATAGTTGGGTGAACAGGGG + Intronic
1044304160 8:90618249-90618271 AAAGGTAGTTTGGCAGGCAGGGG - Intergenic
1044396819 8:91722347-91722369 AAAGATGGTTTGGAAGGCAGGGG - Intergenic
1044919124 8:97149264-97149286 ATGGACAGTTTTGTGGGCAGGGG - Intronic
1045647936 8:104317551-104317573 ATGGACAATTTGGTGGGCAGAGG + Intergenic
1045690835 8:104758285-104758307 AAGGATAACTTGGTGGGTGGTGG + Intronic
1045692136 8:104770776-104770798 AAGGATAATTTGGTGGGCAGGGG + Intronic
1045734243 8:105276593-105276615 AAAGATAGTTTGGTGGGCAGGGG - Intronic
1046040213 8:108894383-108894405 AAGGACAGTTTGGTGAGCAGGGG - Intergenic
1046059681 8:109122923-109122945 GATGAGAGTTTGGTGGGGAGAGG - Intergenic
1046905431 8:119567256-119567278 AAGGATGGATGGGTGGACAGGGG + Intronic
1047042094 8:121007604-121007626 AATGATAATTTGGCGGGAAGGGG + Intergenic
1047048601 8:121083227-121083249 AGGGATAGTTTGGTGGGCAGGGG - Intergenic
1047169731 8:122480314-122480336 AAGGAGAGTTTTGGGGACAGTGG - Intergenic
1047182499 8:122603067-122603089 AAGGATAATTTGGTAGTAAGGGG + Intergenic
1047691463 8:127358939-127358961 ATGGATAATTTGGTGGGCAGGGG - Intergenic
1047711301 8:127555271-127555293 AGAGGTAGTTTGGGGGGCAGTGG - Intergenic
1047847128 8:128818756-128818778 AAGGATATGATGGTGAGCAGAGG + Intergenic
1048012877 8:130472521-130472543 AAGTGTAGTTTGGTGGGGAATGG + Intergenic
1048016652 8:130503218-130503240 AAGGACAGTTCAGTGAGCAGGGG + Intergenic
1048043821 8:130754895-130754917 AAGGATAATTTGGTGGGCAAGGG - Intergenic
1049453184 8:142673637-142673659 AAGGAGAGTCTGGTGGGCCAGGG + Intronic
1049522864 8:143103282-143103304 CAGGATAGTTTGGTGGGCAGGGG + Intergenic
1049748820 8:144274059-144274081 AAGGGGAGGTAGGTGGGCAGGGG + Intronic
1049942894 9:565548-565570 AAGGATAGTTCGGTGGACAGGGG + Intronic
1049949946 9:634216-634238 AAGGATAGTTTGGTGAGCGGAGG + Intronic
1050103156 9:2139309-2139331 AAGGATTGTCTGGTGGGCAGGGG + Intronic
1050163273 9:2739796-2739818 AAGGATAGTTTGGCAGGCAAGGG + Intronic
1050165738 9:2763112-2763134 AAGGACAGTTTGGTGGGCAGGGG + Intronic
1050166493 9:2769991-2770013 AAAGATAGTTTTGTGGGCTAGGG + Intronic
1050441702 9:5670842-5670864 AAGGATAGTTTGGTGGGGCAGGG + Intronic
1050493716 9:6217024-6217046 AAGGTTAGTTTGATGGGCAAAGG + Intronic
1050569207 9:6920127-6920149 ATGGACAATTTGGTGGGCAGGGG + Intronic
1050619385 9:7436852-7436874 AAGGATAGCCTGGTGGGCAGGGG + Intergenic
1050926761 9:11273474-11273496 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1050983153 9:12046435-12046457 ATGGATAATTTGGTGGTCAAGGG - Intergenic
1051048987 9:12909251-12909273 AAGGATAATTTGGTGGGTAGAGG + Intergenic
1051067474 9:13121976-13121998 AAGGAGAGTTAGGTGGGGAAGGG + Intronic
1051269814 9:15344582-15344604 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
1051366164 9:16323006-16323028 AAGGACAGTTAGCTGTGCAGGGG - Intergenic
1051371836 9:16365422-16365444 AAGGACAATTTGGTGGGTGGGGG + Intergenic
1051507816 9:17844875-17844897 ATGGACAACTTGGTGGGCAGGGG + Intergenic
1051599011 9:18853364-18853386 AAGGATAGTTTGGTGGGTTAGGG + Intronic
1051631094 9:19141629-19141651 AAGCACAATTTGGTGGGTAGGGG - Intronic
1051974668 9:22935088-22935110 AAGGACAATTTGGTGGGTAGGGG - Intergenic
1052190635 9:25657209-25657231 AAAGATTATTTGGTGGGTAGGGG - Intergenic
1052295798 9:26895040-26895062 AAGGGAATTTTGGTGGGTAGGGG - Intergenic
1052447137 9:28577481-28577503 AAAGATAGTGTTGTGGACAGTGG - Intronic
1052744033 9:32422112-32422134 AGGGATAGTGTGCTGGGTAGAGG + Intronic
1053074688 9:35122825-35122847 AAGGACAACTTGATGGGCAGGGG + Intergenic
1053203434 9:36167595-36167617 AAAGATAACTTGGTGGGTAGGGG + Intergenic
1053285941 9:36849681-36849703 CAGGATGGTGTGGTGGGCAATGG - Intronic
1053356667 9:37451731-37451753 AAGGATAATTTGGTGGGTAGGGG + Intronic
1053450127 9:38186767-38186789 AAGGATAACTTGGTGGGTAGGGG + Intergenic
1053451108 9:38194865-38194887 AAGGACAATTTGGTGGGTTGGGG - Intergenic
1054725148 9:68642515-68642537 AAGGACAACTTGGTGGGTAGGGG + Intergenic
1054763210 9:69021672-69021694 AAGGATAATTTGGTGGGCACAGG + Intergenic
1054775295 9:69120010-69120032 AAAGATAATTTGGCGGGTAGGGG - Intergenic
1054855005 9:69889565-69889587 AAGAATAATTTGGTGGGCTAGGG - Intronic
1054861460 9:69958101-69958123 AAGGATAGTTTAGTGAACAGAGG - Intergenic
1055037651 9:71835598-71835620 ATGGGTGATTTGGTGGGCAGGGG - Intergenic
1055103666 9:72490867-72490889 AAGGGTACTTTGGTAAGCAGGGG + Intergenic
1055118732 9:72634071-72634093 AAGGATAATTTGGCAGACAGGGG + Intronic
1055121221 9:72663111-72663133 AAGGATAGTTTGAAGGGCCAGGG + Intronic
1055141010 9:72877052-72877074 AAGGATAGTTTGATGGACAGGGG + Intergenic
1055216744 9:73872771-73872793 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1055231701 9:74074270-74074292 AAGGATAACTTGGTGGACAGGGG + Intergenic
1055332577 9:75199178-75199200 AACCATAGTTTGGTGGGCAGGGG + Intergenic
1055348864 9:75364253-75364275 AAGGATAGTTTGGTGGGCACAGG - Intergenic
1055352966 9:75408228-75408250 AAGGATAGTTTGGTGGGCAAGGG - Intergenic
1055468041 9:76584815-76584837 AAGGATAGTTTTGTGGGCAGAGG + Intergenic
1055484662 9:76745608-76745630 AAGGATAGTTTGGGGGAAGGGGG - Intronic
1055496461 9:76860017-76860039 CAGGGTACTTTAGTGGGCAGGGG + Intronic
1055507570 9:76964049-76964071 AAGGACAGTGTGTTGGGGAGTGG + Intergenic
1055520830 9:77079664-77079686 AAGGATAGTTTGGTGTGCAGGGG + Intergenic
1055649700 9:78395349-78395371 GAGGATAGTTTAGTGGGCAGGGG - Intergenic
1055813819 9:80181887-80181909 AAGGATCATTTGGTGGGCAGGGG - Intergenic
1055833043 9:80405654-80405676 AAAAATAGTTTGGAGGGCAGGGG + Intergenic
1055878894 9:80974925-80974947 GAGGATAATTTGGTGGGTAGGGG - Intergenic
1055963358 9:81841800-81841822 AAAGATGGGTTGGTGGGGAGGGG + Intergenic
1056217834 9:84421796-84421818 AGGGATGATTTGGTGGGCATGGG + Intergenic
1056373086 9:85978787-85978809 AAGAATAGTTTGGCGGGCAGTGG + Intronic
1056415255 9:86369147-86369169 AAGGAGATTTTGGAGGGCAAGGG + Intergenic
1056518151 9:87374321-87374343 AAGGATAACTTGGTGGGTGGGGG + Intergenic
1056638990 9:88354224-88354246 AAAGACAATTTGGTGGGTAGGGG - Intergenic
1056656272 9:88511953-88511975 AAGGATAGTTTGGTGGATAGGGG + Intergenic
1056735522 9:89206351-89206373 AAGGATAGTTTGGCAGGCTGCGG + Intergenic
1056897435 9:90564049-90564071 AAAGATAGTTTGGAGGGCAGGGG + Intergenic
1057400751 9:94720917-94720939 AAGGATAATTTGGTGGGCAAGGG + Intergenic
1057629849 9:96710777-96710799 AATGTTACTTTGGTGGGCAGGGG - Intergenic
1057920011 9:99089625-99089647 ATGGATAATTTTGTGGGCAGGGG + Intergenic
1058048576 9:100383617-100383639 AAGAATAGTTTGGTGGGCCAGGG - Intergenic
1058370161 9:104257078-104257100 AAGAATTGTTTGGTGGGCAGAGG - Intergenic
1058449300 9:105081162-105081184 AAGGATAGTTTGGCAGGCCAGGG - Intergenic
1058982213 9:110180674-110180696 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1058992826 9:110270922-110270944 AAGGATAGATTGGTGGGTAGAGG - Intergenic
1058995481 9:110294644-110294666 AAGGACATATTGGTGGGTAGGGG + Intergenic
1059246201 9:112851744-112851766 AAAGATAATTTGGTGGGTAGGGG + Intronic
1059253320 9:112906654-112906676 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1059690893 9:116685306-116685328 AAGGATAACTTGGTGGGTTGGGG - Intronic
1059714390 9:116900027-116900049 AAAGATAGTTTGACGAGCAGGGG - Intronic
1060698513 9:125730658-125730680 AAGGCTGGTGTGATGGGCAGAGG + Intergenic
1060999138 9:127892901-127892923 AAGGATAGTTTGGCAGGCAGGGG - Intronic
1061006388 9:127930671-127930693 AGGGAAGGGTTGGTGGGCAGGGG - Intronic
1061555480 9:131365741-131365763 AAGGATAGTTTGGCAGGCAGGGG + Intergenic
1062222355 9:135423829-135423851 AAGGAGAATTTGGTGGGCCAGGG - Intergenic
1203733540 Un_GL000216v2:113725-113747 AAGGATTGTGAGATGGGCAGAGG + Intergenic
1185550962 X:982063-982085 AAGGATGATTTGGTGGGTGGGGG - Intergenic
1185775999 X:2803529-2803551 AAAGATAATTTGGCGGGTAGGGG + Intronic
1185946174 X:4379106-4379128 AGGGATAATTTGGTGGGTAGGGG + Intergenic
1185946938 X:4387055-4387077 AAGGATAATTTGGTGGGCAAAGG - Intergenic
1185974907 X:4709667-4709689 AAGGATAATTTGGCAGGTAGGGG - Intergenic
1186027210 X:5326396-5326418 AAGGATAATTTGGTGGGTGGAGG + Intergenic
1186036674 X:5430338-5430360 AAGGATAACTTGGTGGGTAGGGG - Intergenic
1186048012 X:5557130-5557152 ATAGATAATTTGGTAGGCAGGGG - Intergenic
1186062607 X:5726351-5726373 AAGAATAATTTGGTGGGTGGGGG + Intergenic
1186071545 X:5826426-5826448 AAGGATAATTTGGGGGCCAGGGG + Intergenic
1186132810 X:6487098-6487120 AAAGATAATTTGGTGGGTAAGGG + Intergenic
1186147930 X:6644279-6644301 ATAGACAATTTGGTGGGCAGGGG - Intergenic
1186166400 X:6831010-6831032 ATGGGTAATTTGGTGGGTAGGGG + Intergenic
1186169274 X:6859828-6859850 ATGGACAATTTGGTGGGCAGGGG - Intergenic
1186182075 X:6983261-6983283 AAGGATAATTTGGTGGGTAGGGG + Intergenic
1186264194 X:7813956-7813978 AAGGGAATTTTGGTGGGTAGGGG + Intergenic
1186450626 X:9670379-9670401 AAAGATAGTTTGGTGAGCAGTGG - Intronic
1186569114 X:10695543-10695565 AAAAATACTTTGGTGGGCAGGGG - Intronic
1186807433 X:13154082-13154104 AAGGATATTTTGGCAGGCAGGGG - Intergenic
1186817172 X:13249485-13249507 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1186833212 X:13411802-13411824 GAGGATAATTTGGTGGGTAGGGG - Intergenic
1186841601 X:13489740-13489762 ATGAATAATTTGGTGGGCAGAGG - Intergenic
1186843256 X:13506228-13506250 ACAGACAATTTGGTGGGCAGGGG - Intergenic
1187074239 X:15918016-15918038 AAGGATAGTTTGGTGGGCAGGGG + Intergenic
1187087015 X:16051264-16051286 ATGGACAATTTGGTGAGCAGGGG + Intergenic
1187091261 X:16099271-16099293 AAGTGTATTTTGGTGGGCAGCGG - Intergenic
1187112820 X:16318886-16318908 AAGAATAGTTTGGTGGGCAGGGG - Intergenic
1187136275 X:16550622-16550644 AAGGGCACTTTGGTGGGCAGGGG + Intergenic
1187161441 X:16768867-16768889 AAGGATAATTTGGTGGGTATGGG - Intergenic
1187208706 X:17207935-17207957 TCAGATAGTTTGGTGGGCAGGGG - Intergenic
1188138623 X:26521034-26521056 AAGGATAACTTGGTGGGTTGGGG + Intergenic
1188179789 X:27040473-27040495 AAGCATAATTTGGCGGGTAGGGG - Intergenic
1188286294 X:28328904-28328926 AAGGATAATTTGGAGGGTATGGG + Intergenic
1188686568 X:33076916-33076938 AAGGATAACTTGGTGGGTGGGGG + Intronic
1188687352 X:33084456-33084478 AAGGATAACTTGGTGGGTCGGGG + Intronic
1188747310 X:33862145-33862167 TAGGATAATTTGGTGGGTAGGGG + Intergenic
1188750901 X:33904878-33904900 ATGAATAATTTGGTGAGCAGGGG + Intergenic
1188881227 X:35494230-35494252 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1188902675 X:35753224-35753246 AAAGATAATTTGGCGGGTAGGGG + Intergenic
1188910362 X:35839817-35839839 AAGGGTACTTGGGTGGGCAAGGG + Intergenic
1189012444 X:37060022-37060044 AATGATAATTTGGTGGGTGGGGG - Intergenic
1189036266 X:37496231-37496253 AATGATAATTTGGTGGGTGGGGG + Intronic
1189416819 X:40822640-40822662 AAGGACAATTTGGTAGGTAGGGG - Intergenic
1189419375 X:40842989-40843011 AAAGACAGTTTGGCAGGCAGGGG - Intergenic
1189515867 X:41712958-41712980 AAGGATAATTTGGTGGGTAGTGG - Intronic
1189527979 X:41846427-41846449 AAGGGTAGTTGGGGGGGCGGGGG + Intronic
1189550667 X:42089171-42089193 AAGGATAATTTGGTGGATAGGGG - Intergenic
1189683548 X:43541045-43541067 AAGGATAGTTTGGCGAGCAAGGG + Intergenic
1189736115 X:44071634-44071656 AAGGGTAGTTCAGTGGGGAGGGG + Intergenic
1189761322 X:44324322-44324344 AAAGATAGTTTGGCAGGCAGGGG - Intronic
1189784818 X:44549989-44550011 AAGGATAACTTGGTGGGTAGGGG - Intergenic
1189953642 X:46257212-46257234 GAAGGTAGTTTGGTGGGCAGGGG + Intergenic
1189958418 X:46301274-46301296 AAGGGTACTTTGGCAGGCAGGGG + Intergenic
1189960940 X:46324236-46324258 AAAGATAGTTTGGTGGGCAAGGG + Intergenic
1189962725 X:46339963-46339985 AAGGATAGTTTGAGGGACAGGGG + Intergenic
1189983502 X:46533277-46533299 AAGGATAGTTTGGTAGGCCATGG - Intronic
1189985901 X:46553074-46553096 AAGGATAGTTTGTCAGACAGGGG - Intergenic
1190083743 X:47377234-47377256 AAGGATAATTTGGTGGGGTGGGG - Intronic
1190083855 X:47378132-47378154 AACGATAATTTGGTGGGTAGGGG + Intronic
1190220988 X:48512205-48512227 AAGGATGGATAGGTGGGCATGGG - Intronic
1190408352 X:50110154-50110176 AAAGGCAGTTTGGAGGGCAGGGG + Intergenic
1190726238 X:53192684-53192706 ATGGATGGGCTGGTGGGCAGGGG - Exonic
1191004418 X:55695919-55695941 AAAGATAATTTGGTGAGTAGGGG + Intergenic
1191006440 X:55715782-55715804 AACAATAATTTGGTGGGTAGGGG + Intergenic
1191127641 X:56974733-56974755 AAGGATAATTTGGTGGGGAGAGG - Intergenic
1191792354 X:64984405-64984427 AAGAACAGTTTGATGGGCAGAGG + Intronic
1191798557 X:65051784-65051806 AAGGACACTTTGGCAGGCAGGGG + Intergenic
1191840471 X:65510214-65510236 AAGGATTGGTGGGTGGGGAGTGG - Intergenic
1191845214 X:65542102-65542124 AAGGAGAGTTTGATAGGCAGAGG - Intergenic
1192039289 X:67600546-67600568 AAGGATAGTTGGTGGGGCAGGGG + Intronic
1192063516 X:67855995-67856017 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1192161576 X:68792418-68792440 AAGGATAATTTGGTGGATATGGG - Intergenic
1192449309 X:71233589-71233611 AAGGGCAGTTTTGTGGGGAGAGG + Intergenic
1192783914 X:74319764-74319786 AGGGATAGTTTGGTGGACAGGGG + Intergenic
1192794683 X:74417198-74417220 CAGGATTGTTTGGGGGCCAGGGG + Intergenic
1192804701 X:74498499-74498521 AAGGATAGTTTGGTGGACAGGGG - Intronic
1192812328 X:74558424-74558446 AAGGATAATTTGGTGGGTAGGGG - Intergenic
1192812420 X:74559166-74559188 AAAAATAGTTTGGCAGGCAGGGG - Intergenic
1193125581 X:77867022-77867044 AAGGATAGCTTCGTGGGTGGGGG - Intronic
1193523580 X:82560589-82560611 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1193530096 X:82645779-82645801 AAGGATAATTTGGTGGGTAGAGG - Intergenic
1193767106 X:85543191-85543213 AAGGATAACTTGGCGGGTAGGGG - Intergenic
1193910490 X:87300419-87300441 ATAAATAATTTGGTGGGCAGGGG + Intergenic
1194073731 X:89361623-89361645 AAGGATAATTTGGTGGGTAGTGG + Intergenic
1194111205 X:89836819-89836841 AAGGACAATTTGATGGGTAGGGG + Intergenic
1194328699 X:92554886-92554908 ATGGAAAGTTTGGTGGGAAGTGG - Intronic
1194359955 X:92937835-92937857 ATTCAAAGTTTGGTGGGCAGGGG - Intergenic
1194411524 X:93564269-93564291 AATGATAATTTGGTGGGTGGGGG - Intergenic
1194411598 X:93564940-93564962 AAATATAGTTTGGTGGGCCAGGG - Intergenic
1194473176 X:94322920-94322942 ATGGACAGTTTGGTGAACAGGGG - Intergenic
1194577143 X:95627144-95627166 AAGGATAATTTGGTGGGTTGGGG - Intergenic
1194614420 X:96083772-96083794 AAGGATAGTTTGGTGGGCAGGGG - Intergenic
1194620048 X:96160193-96160215 ATGGACAATTTGGTGGACAGGGG + Intergenic
1194641566 X:96409131-96409153 AAATATAATTTGGTGGGTAGGGG - Intergenic
1194758475 X:97765792-97765814 AAGGATAACTTGGTGGGTGGGGG + Intergenic
1194960064 X:100224699-100224721 AAGGATAACTTGGTGGGTTGGGG - Intergenic
1195087013 X:101422332-101422354 AAAGATAACTTGGTGGGTAGGGG + Intronic
1195140955 X:101959295-101959317 AAGGATAGTTTGGTGAGGAGGGG + Intergenic
1196082225 X:111645272-111645294 AAGGACAACTTGGTGGGTAGGGG + Intergenic
1196251862 X:113470225-113470247 AAAGATAATTTGGTGGGTAGGGG + Intergenic
1196762880 X:119215604-119215626 AAAGATAATTTCGTGGGCAGGGG + Intergenic
1196862733 X:120042969-120042991 AAGGATAACTTGGTGGGTGGGGG - Intergenic
1196880369 X:120193375-120193397 AAGGATAACTTGGTGGGTGGGGG + Intergenic
1196963524 X:121030126-121030148 AAGGATAATTTGGTGGGTGGGGG + Intergenic
1197067003 X:122245530-122245552 AAGGACAATTTGGTGGGTAAGGG + Intergenic
1197652565 X:129081825-129081847 AAGGATACTTTGGTAGATAGGGG + Intergenic
1197663090 X:129194760-129194782 AAGGAGAGTTTGATGGGCAGGGG + Intergenic
1197678739 X:129359573-129359595 AGGGATAATTTGGTAGGTAGGGG - Intergenic
1197832548 X:130660153-130660175 AAGGATTGTCTAGTGGGTAGGGG - Intronic
1198232098 X:134699997-134700019 AAGGAGAGTGTTCTGGGCAGAGG - Intronic
1198382235 X:136094637-136094659 GAGGATAGTTTGGCAGGCTGAGG - Intergenic
1198488888 X:137118047-137118069 GAGAATAATTTGGTGGGCATGGG + Intergenic
1198608245 X:138368334-138368356 AAGGATAGTGGGGTGGGGAGGGG + Intergenic
1198698464 X:139369586-139369608 AAAGATAGTTTGGCAGGGAGAGG + Intergenic
1199186147 X:144917990-144918012 AAGGATAATTTGGTGAGTAGGGG - Intergenic
1199546552 X:149012358-149012380 AACCTTAGTTTGCTGGGCAGGGG - Intergenic
1199555998 X:149109366-149109388 AAGGATAGTTTGGTAGGCAAGGG - Intergenic
1199814930 X:151388778-151388800 CAGCAGAGTTTAGTGGGCAGAGG + Intergenic
1199993501 X:153003961-153003983 AAAGATAATTTGGTGGGTAGGGG - Intergenic
1200099582 X:153683712-153683734 AAAGATAGTTTGGCGGACAGGGG + Intronic
1200463869 Y:3491562-3491584 AAGGACAATTTGATGGGTAGGGG + Intergenic
1200637406 Y:5674083-5674105 ATGGAAAGTTTGGTGGGAAGTGG - Intronic
1200668153 Y:6053656-6053678 ATTCAAAGTTTGGTGGGCAGGGG - Intergenic
1200729112 Y:6713181-6713203 AAGGATAATTTGGTGGGTAGTGG + Intergenic
1201293998 Y:12448172-12448194 AAAGATAATTTGGCGGGTAGGGG - Intergenic
1201296535 Y:12468024-12468046 AAGGATAATTTGGTGGGTACGGG - Intergenic
1201547790 Y:15184870-15184892 AAGAATAATTTGGTGGGTAGGGG + Intergenic
1201630676 Y:16068867-16068889 AAAGATAATTTGGTGAGTAGGGG - Intergenic
1201642121 Y:16191208-16191230 AAAGATAGTTTGGTGGGCAGGGG - Intergenic
1201660694 Y:16394113-16394135 AAAGATAGTTTGGTGGGCAGGGG + Intergenic
1201701613 Y:16888333-16888355 AAGGATAATTTGGCAGGCAGAGG + Intergenic
1201705625 Y:16933489-16933511 AAGGATAGTTTGGTGGGCATGGG + Intergenic
1201782950 Y:17743369-17743391 CACGATATTTTGATGGGCAGAGG + Intergenic
1201818603 Y:18162618-18162640 CACGATATTTTGATGGGCAGAGG - Intergenic
1202627470 Y:56874696-56874718 AAGGATTGTGAGATGGGCAGAGG - Intergenic