ID: 1038803724

View in Genome Browser
Species Human (GRCh38)
Location 8:30771962-30771984
Sequence AGTTTGGTGGGCAGAGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038803716_1038803724 13 Left 1038803716 8:30771926-30771948 CCGACCACGCAGAAGAGGGAGTT No data
Right 1038803724 8:30771962-30771984 AGTTTGGTGGGCAGAGGGCTAGG No data
1038803717_1038803724 9 Left 1038803717 8:30771930-30771952 CCACGCAGAAGAGGGAGTTAATA No data
Right 1038803724 8:30771962-30771984 AGTTTGGTGGGCAGAGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038803724 Original CRISPR AGTTTGGTGGGCAGAGGGCT AGG Intergenic
No off target data available for this crispr