ID: 1038808006

View in Genome Browser
Species Human (GRCh38)
Location 8:30812495-30812517
Sequence GGGGAGCGGCGCCCGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 694}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038808006_1038808021 11 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808021 8:30812529-30812551 CGCCGTCGCCAGGTCCCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1038808006_1038808025 16 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808025 8:30812534-30812556 TCGCCAGGTCCCACAGGGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 157
1038808006_1038808020 10 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808020 8:30812528-30812550 CCGCCGTCGCCAGGTCCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1038808006_1038808024 13 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808024 8:30812531-30812553 CCGTCGCCAGGTCCCACAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 111
1038808006_1038808015 1 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808015 8:30812519-30812541 CTCCCTCCGCCGCCGTCGCCAGG 0: 1
1: 0
2: 2
3: 40
4: 383
1038808006_1038808022 12 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808022 8:30812530-30812552 GCCGTCGCCAGGTCCCACAGGGG 0: 1
1: 0
2: 0
3: 2
4: 74
1038808006_1038808029 26 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808029 8:30812544-30812566 CCACAGGGGGAGGACTGAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 304
1038808006_1038808030 27 Left 1038808006 8:30812495-30812517 CCCCGGCCCGGGCGCCGCTCCCC 0: 1
1: 0
2: 5
3: 97
4: 694
Right 1038808030 8:30812545-30812567 CACAGGGGGAGGACTGAGCCGGG 0: 1
1: 0
2: 3
3: 34
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038808006 Original CRISPR GGGGAGCGGCGCCCGGGCCG GGG (reversed) Exonic
900113946 1:1020702-1020724 GGGGAGCGGGGGCTGGGCCTGGG + Intronic
900135715 1:1116145-1116167 GGGGCCTGGCGCCGGGGCCGGGG - Intronic
900158881 1:1214096-1214118 GGGGCTCGGCGGCTGGGCCGCGG - Exonic
900191778 1:1355168-1355190 GGTCAGCGGCGCGCGGGCCGGGG + Intronic
900207984 1:1439734-1439756 GGGGCGCGGGGCACGGGGCGTGG - Exonic
900214683 1:1475179-1475201 GTGGAGCGGGGCCCGGGGCAGGG + Intronic
900221892 1:1513528-1513550 GTGGAGCGGGGCCCGGGGCAGGG + Intronic
900227464 1:1539966-1539988 GGGGAGGGGAGCGCAGGCCGGGG + Intronic
900227523 1:1540109-1540131 GGGGAGCGGAGGCCGGGGTGGGG + Intronic
900227537 1:1540143-1540165 GGGGAGGGGAGCGCAGGCCGGGG + Intronic
900227545 1:1540162-1540184 GGGGAGGGGAGCGCAGGCCGGGG + Intronic
900307712 1:2019240-2019262 GGGGAGCGGCGGGCGGGGCCGGG + Intergenic
900322981 1:2094164-2094186 GGGGGGCTGCTCCCGGGACGGGG - Intronic
900513030 1:3069346-3069368 GGGCCGGGGCGCCCGGGCCAGGG + Intronic
900671302 1:3856818-3856840 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
900671305 1:3856825-3856847 GGGGAGCGGGGCGCGGGGCGCGG - Intronic
901019753 1:6249687-6249709 GCGGAGCGGGGGCCGGGCCCGGG + Exonic
901022145 1:6260939-6260961 GCGGAGCGGCCCGCGGGCCGGGG + Exonic
901082286 1:6590309-6590331 TGGGAGCCGGGCCCGGGCAGAGG + Intergenic
901109551 1:6784685-6784707 GGCGGGCGGCGCCGGGGCCGTGG + Intergenic
901332813 1:8423879-8423901 CGGGGGCGGGGCCGGGGCCGGGG - Intronic
901361306 1:8703227-8703249 CGGGACCTGCGCCCGCGCCGCGG - Intronic
901443335 1:9292731-9292753 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
901506223 1:9687614-9687636 AGAGGGCGGAGCCCGGGCCGGGG - Intronic
901577302 1:10210945-10210967 GGGGAGGAGCGGCCGGGCCGGGG + Intronic
901628848 1:10638626-10638648 GGGGAGGGGCGCCGGGGCAGCGG + Exonic
901629723 1:10642195-10642217 GGGGAGGGGCGGCCGGAGCGTGG + Intronic
902323647 1:15684496-15684518 GGGAAGCGGCGGCGGGGCGGCGG + Exonic
902470770 1:16646547-16646569 GGGCAGGGGAGCCTGGGCCGTGG + Intergenic
902488031 1:16760901-16760923 GGGCAGGGGAGCCTGGGCCGTGG - Intronic
902896874 1:19485392-19485414 CCGGAGGGGCCCCCGGGCCGGGG + Intronic
903034480 1:20485443-20485465 GGTCAGCGGCGCTGGGGCCGGGG + Exonic
903164131 1:21509281-21509303 GGGGCGCGGGGCTCGGGCCGGGG + Intergenic
903190252 1:21652107-21652129 GGGGGGCGGCGGCCGGGAAGGGG - Intronic
903413793 1:23168164-23168186 CGGGCGCGGGGCGCGGGCCGCGG - Intronic
903435115 1:23343853-23343875 GGGGAGAAGCGGCAGGGCCGCGG + Intronic
903466418 1:23555058-23555080 GCGCTGCGGCGCCCGGGCTGGGG - Intergenic
903628035 1:24745326-24745348 TGGGAGGGGCGCCGGGGGCGGGG - Intergenic
903628226 1:24745978-24746000 GGGCCCCGGCGCCCGGGCGGGGG - Intronic
903777064 1:25800150-25800172 GGGGCGGGGCGGCCGGGGCGGGG - Intergenic
903811115 1:26035563-26035585 GGAGAGCGGCGCTCCGGTCGCGG - Exonic
903883696 1:26529583-26529605 GCGGAGCCGAGCGCGGGCCGGGG + Intergenic
904009630 1:27382430-27382452 GGGGAGAGGGGCCAGGGCCTTGG + Intronic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904528809 1:31155026-31155048 GAGGGGCGGAGCCCGGGCCGGGG + Intergenic
904822690 1:33256047-33256069 GGGCACCGGCGCCCGGCCCTAGG - Intergenic
905075768 1:35269116-35269138 GGGGGGCGGGGCGCGGCCCGGGG + Intronic
905137091 1:35808248-35808270 CGGCGGCGGCGCCCGGCCCGGGG - Exonic
905625831 1:39490416-39490438 GTGGAGCTGCGCTCGGGCAGGGG - Intergenic
905731938 1:40303880-40303902 GGGGAGCGGCGGCTGGCCCCGGG - Intronic
905847089 1:41242166-41242188 GGAGAGCGGCGGGCGGGCGGCGG + Intergenic
906118012 1:43368160-43368182 GGGGTGGGAAGCCCGGGCCGCGG - Intergenic
906197193 1:43936435-43936457 GGGCAGCCGCGCTCGGGCAGCGG + Exonic
906365555 1:45206499-45206521 GGGGAACCGCGGCCGGGCCCGGG + Exonic
906506271 1:46382210-46382232 GGGGAGGGGCTCCCGGGTGGAGG - Intergenic
906919419 1:50048192-50048214 GGGGTGCGGGGCCTGCGCCGAGG - Intronic
907136267 1:52142203-52142225 CCGCATCGGCGCCCGGGCCGCGG - Exonic
907689119 1:56645182-56645204 GGCGAGCGGCGGGCGGGGCGGGG - Intronic
908605467 1:65792992-65793014 GGGAAGGGGCGCGCGGGCCGGGG - Intronic
909623153 1:77687710-77687732 GGGGCGGGGCGGCCGGGCAGAGG - Intergenic
909925437 1:81432664-81432686 GGGGAGCGGCGCCGAGGAGGGGG - Intronic
910981249 1:92961556-92961578 GGGGAGCGCGGCGCGCGCCGCGG - Intergenic
912381436 1:109249974-109249996 GGGGACTGGCGCCCTGGCCCGGG + Intergenic
912505056 1:110150634-110150656 GGGGAGCGGCGCGGGGACCCAGG - Exonic
912568890 1:110607470-110607492 GGGGGCCGGGGCCGGGGCCGGGG + Intronic
912652112 1:111448997-111449019 GGGGAGGGGCGCCCTGGGCCGGG + Exonic
912966666 1:114242535-114242557 ACGGGGCGGCGGCCGGGCCGAGG - Intergenic
913521345 1:119648113-119648135 GCGGTGCGGGGCTCGGGCCGGGG - Intergenic
914817135 1:151071226-151071248 GCGGCGCGGAGCCGGGGCCGAGG + Intronic
914937452 1:151993542-151993564 GGGCGGCCGCGCCCGGGCCGGGG + Intronic
915931518 1:160063269-160063291 GGGGAGGGGCTCCTGGGCCTTGG + Intronic
916144621 1:161727407-161727429 GGCGAGCGGCGCCCCGACTGCGG + Exonic
917846578 1:179025693-179025715 GGAGACCGGCGCCGGCGCCGAGG + Intergenic
920333339 1:205228007-205228029 GGAGCGGGGCGCGCGGGCCGGGG + Intergenic
920382741 1:205545048-205545070 GGTGGGCGGCGGCCGGGCAGAGG + Intergenic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
922440535 1:225652664-225652686 GGTGAGGGGCGCGCGGGGCGGGG - Exonic
922612409 1:226940233-226940255 TGGGAGCGGCCCGCGGGGCGGGG + Intronic
922950972 1:229558427-229558449 GAGGAGCGGCTGCCGGGGCGGGG - Exonic
923007886 1:230066981-230067003 GGGGGCCGGGGCGCGGGCCGCGG - Intronic
923369421 1:233295562-233295584 GGGGCGCGGCCCGCGGGCCCGGG - Exonic
923684134 1:236142385-236142407 GGGCCGGGGCGCGCGGGCCGGGG + Intergenic
923684145 1:236142405-236142427 GGGCGGGGGCGCGCGGGCCGGGG + Intergenic
924795931 1:247292087-247292109 AGGGAGAGGCGCCCAGGCCGGGG + Intergenic
924807633 1:247373856-247373878 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
924853959 1:247857506-247857528 TGGGCGCGGGGCCCGGGGCGCGG + Exonic
1063407871 10:5813673-5813695 GGGAGGCGGCGCGCGGGCCGGGG + Intronic
1063429655 10:5977528-5977550 GGCGAGCGCTGCCCAGGCCGGGG + Exonic
1065092832 10:22252470-22252492 AGGGGGCCGCGCCCGGGCCTGGG - Intergenic
1065367882 10:24952750-24952772 GGGGCGCAGCGCCGGGGCCATGG - Intergenic
1065712505 10:28532274-28532296 GGGGAGCGCCGCTCGGGGCAGGG - Intergenic
1065844712 10:29735525-29735547 GGGGCGCTGCGCTCGGCCCGCGG - Intronic
1067060938 10:43077562-43077584 GCGGAGCGCGGGCCGGGCCGCGG + Intronic
1067145413 10:43690210-43690232 GGGGAGCGGCGCTCTGGGCTGGG + Intergenic
1069386127 10:67884801-67884823 GCGGAGCGGCTCCCCGGCGGGGG - Exonic
1069438553 10:68407341-68407363 GGGGAGCGGCGCCCCGGGCGGGG + Intergenic
1069849747 10:71397138-71397160 GGCGAGCGGCGAGCGGCCCGCGG + Intronic
1070290684 10:75111592-75111614 CGGGGGCGGAGCCCGGGGCGGGG - Intronic
1070570698 10:77637900-77637922 GGCGAGCGGGGCGCGGGCCGGGG - Intronic
1070570786 10:77638178-77638200 GCGCAGGGGCGCCCGGGCGGAGG - Intronic
1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG + Intergenic
1072745249 10:97934970-97934992 GGGGAGCGGCGGGCGCGGCGGGG + Intronic
1073138039 10:101230318-101230340 CGGCAGCGGGGCCCCGGCCGGGG - Intergenic
1074372138 10:112908691-112908713 GGGAAGCGGGGCCCAGGCGGAGG + Intergenic
1074400013 10:113134219-113134241 GGGGAGAGGGGCACGGGCCAGGG + Intronic
1074522619 10:114239457-114239479 CAGGAGGGGCGCCCGGGGCGCGG - Exonic
1075119057 10:119651294-119651316 GGGGAGGGGCGAGCGGGCCGAGG + Intergenic
1075335903 10:121608840-121608862 GGCGAGCGCCGCCCGGGGCGTGG + Intergenic
1075501723 10:122980705-122980727 GAGGGGCGGGGCCTGGGCCGCGG + Intronic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076373785 10:129970658-129970680 GGGTGCCGGCGGCCGGGCCGGGG + Intergenic
1076674841 10:132142485-132142507 GGGGAGAGGGGCCGGGGCCGGGG - Intronic
1076749996 10:132537756-132537778 GCGGAGCCGAGCCCGGGGCGGGG - Intergenic
1076864365 10:133159956-133159978 GGGGGGCGGGGCCCGGGGTGGGG - Intergenic
1076878763 10:133230131-133230153 GGGGCGGGGCGCGCGGGGCGGGG + Intergenic
1076880520 10:133237305-133237327 GGGGAGCGGCGCGCGGGGGCGGG - Intergenic
1077048465 11:556164-556186 GGGGCCGGGCTCCCGGGCCGGGG + Intronic
1077059015 11:609686-609708 GGAGAGCAGCGCCCCCGCCGAGG + Exonic
1077205234 11:1338836-1338858 GGGGTGGGGGGCCCGGGCCACGG + Intergenic
1077214538 11:1389974-1389996 GGGGCGCGGGGCGCGGGGCGCGG + Intronic
1077214540 11:1389981-1390003 GGGGCGCGGGGCGCGGGCCTCGG + Intronic
1077287258 11:1773104-1773126 GGGGAGGGGCGCCCAGGCACAGG + Intergenic
1077341907 11:2029995-2030017 GGGGAGCGGGGCCCAGGTCTGGG + Intergenic
1077395050 11:2316519-2316541 GGGGAGGGGCGCCCGCACCCTGG + Intronic
1077495491 11:2884860-2884882 GGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495767 11:2885917-2885939 GGTGCGCGGGGGCCGGGCCGCGG - Intergenic
1077839665 11:5961016-5961038 GGGGGGCGGCTGCCGGGCGGAGG - Intergenic
1078422061 11:11220732-11220754 GGGCAGCGGGACCAGGGCCGGGG - Intergenic
1080551506 11:33376708-33376730 GGGGCGCGGGGGCCGGCCCGTGG + Intergenic
1080836337 11:35944177-35944199 GGGGCGCGGGGCGCGGGGCGCGG + Intronic
1081636802 11:44727091-44727113 CGGGACCGGGGCCGGGGCCGGGG - Intronic
1081668059 11:44928026-44928048 GGGGAGGGGCTACCGGGACGGGG - Intronic
1081832090 11:46122119-46122141 GGGGAGTTGGGCTCGGGCCGCGG - Intergenic
1082870942 11:57943718-57943740 GCGGAGTGGCGGCCGGGCAGAGG + Intergenic
1083168388 11:60906274-60906296 CCGCTGCGGCGCCCGGGCCGGGG - Intronic
1083169498 11:60914524-60914546 GTGGAGCGGCTCCCGGGCGTGGG + Intronic
1083227758 11:61295310-61295332 GAGGCGCGGAGCCCGGGGCGGGG + Exonic
1083289133 11:61680258-61680280 GGGGAGCGGCGTCGAGGCCAGGG - Intergenic
1083579087 11:63813535-63813557 GGCGAGCGGCGGGCGGGCGGCGG + Exonic
1083766461 11:64843754-64843776 GGGCTGTGGCGCCGGGGCCGGGG - Intronic
1083880872 11:65547668-65547690 GGTGAGCGCCGCCAGGGCGGAGG - Exonic
1083901770 11:65646788-65646810 TGCGCGCGGCGCCCGGGGCGCGG + Exonic
1083995080 11:66267683-66267705 GGTGGGCGGTGCCCGGGGCGGGG - Exonic
1084112522 11:67023302-67023324 GAGGAGCGCGGCGCGGGCCGGGG - Intronic
1084146168 11:67266481-67266503 CGGGAGCGGAGCGCGAGCCGGGG + Exonic
1084165567 11:67373395-67373417 AGGGAGCTGGGCTCGGGCCGGGG - Intronic
1084372038 11:68751007-68751029 GGGGAGGGGCGGCCGGGGAGGGG + Intronic
1084372251 11:68751544-68751566 GGGAAGAGGCGCCCGGGCAGTGG + Exonic
1084500853 11:69534322-69534344 GGGGAGTGCCGCCCTGGCCCCGG + Intergenic
1084516813 11:69642030-69642052 GGGGAGCGGCCGCCGGGCGCTGG + Intronic
1084546571 11:69817910-69817932 GGTGAGCGCAGCCCGGGCCGCGG + Intronic
1085284652 11:75351782-75351804 GCAGCGCAGCGCCCGGGCCGCGG + Intergenic
1085423056 11:76380575-76380597 GGGGAGCCGGCCCCGAGCCGTGG - Intronic
1088613857 11:111603184-111603206 GGGGAGGGGCGCCGGGGTCACGG - Intronic
1088823471 11:113475270-113475292 GGGGAGCAGTGGACGGGCCGCGG + Exonic
1089556245 11:119317223-119317245 GGGCTGCGGCGCGCGGGGCGGGG - Intronic
1091273054 11:134331749-134331771 GCGGGGCGGGGCCCCGGCCGGGG - Intergenic
1202824893 11_KI270721v1_random:85184-85206 GGGGAGCGGGGCCCAGGTCTGGG + Intergenic
1091393375 12:139112-139134 GGGGAGAGGGGCCGAGGCCGAGG + Exonic
1091616380 12:2053684-2053706 AGGGACCGGCCCCGGGGCCGCGG - Intronic
1091730524 12:2877082-2877104 GGGGAGGGGGTCCCGGGCCGGGG + Intronic
1091807350 12:3365996-3366018 GGGGTGGGGCGCCGGGGGCGGGG - Intergenic
1094293829 12:28881410-28881432 GGGGGGCAGCGCAGGGGCCGGGG - Intergenic
1094565020 12:31591152-31591174 GCTGAGCGGCGCTCGGGCTGTGG + Intergenic
1096156973 12:49346367-49346389 GGGGAGGGGCGACGGGGTCGGGG - Intergenic
1096255167 12:50058079-50058101 GGGGGGCTGCGTCCGGGGCGGGG + Intronic
1096260224 12:50085560-50085582 GAGGAGGGGCGCGCGGGCCGGGG + Intronic
1096389479 12:51217720-51217742 GGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096396411 12:51269926-51269948 GGGGCGCGGGGCGCGGGCTGGGG - Intronic
1096468944 12:51864358-51864380 CGGGACCGGGCCCCGGGCCGGGG - Intergenic
1096647761 12:53047687-53047709 TGGCAGCGGCGCTCGGGCCCCGG + Intronic
1096796745 12:54082575-54082597 GGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1097155127 12:57006607-57006629 GGGGCGCTGCGGCCGGGCGGCGG - Intergenic
1097891408 12:64780945-64780967 GGGGAGCGGCGGAGCGGCCGCGG + Intergenic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1101371842 12:104137926-104137948 GGGGAGCGGGCGCGGGGCCGCGG - Intronic
1101772097 12:107761052-107761074 GGGCAGCGGCCCCCGGGGTGAGG - Exonic
1102035478 12:109768559-109768581 GGGGTGCGGCGCCCGGGGCCTGG - Exonic
1102589818 12:113948807-113948829 GGGGTGTGGCCTCCGGGCCGTGG - Intronic
1102913765 12:116737915-116737937 GGGGCGCGGCGGCCGGGGCGCGG + Exonic
1102962007 12:117099190-117099212 GGGGGGCGGCGCGGGGACCGGGG - Intronic
1103595573 12:122022662-122022684 GGGCGGCGGGGCGCGGGCCGGGG - Intronic
1103623699 12:122203892-122203914 GGGGACCGGGGAGCGGGCCGCGG - Intronic
1103649709 12:122422841-122422863 GCGGAGCGGCGGGCGCGCCGGGG - Intergenic
1103764054 12:123269584-123269606 GGGGAGCCGCGCCTGGCCCCAGG - Intronic
1103781567 12:123402274-123402296 CCGGAGCGGGGCCGGGGCCGTGG + Intronic
1103800480 12:123534112-123534134 GGGGAGGGGCGGCCGGGGCACGG - Intergenic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104376177 12:128267087-128267109 CGGGGGCGGGGCCCGGGCGGGGG + Intergenic
1104568236 12:129903772-129903794 GGGCTGCGGAGCCCGGGACGCGG + Intergenic
1104602377 12:130162389-130162411 GGGGCGGGGCGCGCGGCCCGGGG + Intergenic
1104640042 12:130461424-130461446 GGTGGGCTGCACCCGGGCCGAGG - Intronic
1104854299 12:131894889-131894911 GGGGCGCGGGGCCGGGGGCGCGG - Exonic
1104937697 12:132375327-132375349 AGGGAGCAGTGCCAGGGCCGCGG - Intergenic
1104983313 12:132583376-132583398 GGGCGGCGGAGCCCGGGGCGGGG - Exonic
1105004167 12:132710821-132710843 GCGGAGCGCCGTCGGGGCCGTGG + Exonic
1105071307 12:133235785-133235807 GGTGAGGGGCGCGCGGGCAGGGG - Exonic
1105890776 13:24680901-24680923 GAGAAGCGGTGCCCAGGCCGGGG - Intronic
1105900330 13:24747054-24747076 CGGGAGCGGCGCCGCGGGCGCGG - Intergenic
1106422511 13:29595527-29595549 GGGGCGCGGCGCGCGGGGAGAGG + Exonic
1106956333 13:34942682-34942704 GGGGAGCGGGCCCGGCGCCGCGG + Exonic
1107863413 13:44682342-44682364 GGGCAGAGGCGCCCGGGCAGAGG + Intergenic
1108229552 13:48321373-48321395 GGGAGGCGGGGCCCGGGCGGAGG - Intronic
1110572977 13:77026710-77026732 GGGGGGGGGCGCGGGGGCCGGGG - Intronic
1112216348 13:97434377-97434399 GGGGCGGGCCGCCGGGGCCGGGG + Exonic
1112291036 13:98143798-98143820 GGGGAAGGGCGCCGGGGTCGGGG - Intronic
1112344288 13:98577153-98577175 CGGGCGCGGGGGCCGGGCCGGGG - Intronic
1112402199 13:99086713-99086735 GGGGCGGGGCGCCCGGACGGCGG + Intergenic
1112461471 13:99606825-99606847 GGGAGGCCGCGCCCGGCCCGCGG - Intronic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113201067 13:107867600-107867622 GGCGGGCGGCGGCGGGGCCGCGG + Intergenic
1113656923 13:112073120-112073142 GGGGAGCCGCGCGCGGGCCTCGG - Intergenic
1113820560 13:113209584-113209606 GGGCGGCGGCGCTCGGGGCGGGG + Exonic
1113820615 13:113209777-113209799 TGGGTGCGGCGGCCGGGTCGAGG + Intronic
1113962278 13:114132659-114132681 TGGGAGCAGGGGCCGGGCCGCGG - Intergenic
1114270715 14:21098438-21098460 AGGGGGCGGGGGCCGGGCCGGGG - Exonic
1115850734 14:37588144-37588166 GGGGCGCGGCGCCCCAGCCCGGG + Intergenic
1117156863 14:52950766-52950788 GGCGGGCGGCGCCGGGACCGAGG - Intronic
1117315114 14:54566002-54566024 GGGGAGAGGAACCCGGGCGGCGG - Intergenic
1117805378 14:59484727-59484749 GGAGTGCGGAGCCCGGCCCGAGG - Exonic
1117828454 14:59727162-59727184 GGAGACTGGCGTCCGGGCCGAGG - Exonic
1119003909 14:70907534-70907556 GGGTGGCGGGGGCCGGGCCGCGG + Exonic
1119756685 14:77124842-77124864 GATGCGCGGGGCCCGGGCCGTGG + Intronic
1120143554 14:80955333-80955355 TGGGAGGGGCGCCCGGGGTGGGG + Intronic
1120765362 14:88323332-88323354 GGGGGGCGTCGCCGGGGGCGAGG - Intronic
1121645758 14:95516436-95516458 GGGGAGGCGCGCCCGGCGCGGGG - Intronic
1122231050 14:100306472-100306494 GGGGCGGGGCGCGCGGCCCGAGG - Exonic
1122268975 14:100559900-100559922 GGAGGGAGGCGCCGGGGCCGAGG + Intronic
1122270838 14:100567884-100567906 GTGGAGCGTCTCCCGTGCCGCGG - Intronic
1122444954 14:101761593-101761615 GGCGAGCGGCGGGCGGGGCGGGG + Intergenic
1122445028 14:101761807-101761829 GGGGCGCGACGGCCGGGGCGGGG + Exonic
1122445083 14:101761990-101762012 GGGGTCCTGCGCCCGGGCCCCGG + Intronic
1122917457 14:104865590-104865612 GGGGCGCGGGGTCCCGGCCGAGG + Intronic
1122960977 14:105093522-105093544 GGGGCCCGGGGCGCGGGCCGGGG - Intergenic
1123004395 14:105314464-105314486 GGGGCGGGGCGCCCCGGGCGGGG + Exonic
1123024832 14:105419726-105419748 GGGAAGGGGCGCGCGGGCCGCGG + Intronic
1124118202 15:26867156-26867178 GGCGGGCGGCGCGCGGCCCGGGG + Intronic
1124149553 15:27165315-27165337 GGGGATCAGCGCCTGGGCGGAGG - Intronic
1126823671 15:52528931-52528953 GGGGAGGGCCGCGCGGGGCGGGG + Exonic
1128078331 15:64841858-64841880 GGGGGGCGGGGCCGGGGGCGGGG - Intergenic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128743131 15:70096869-70096891 GGGGAGCCGAGCCCGAGCGGGGG + Exonic
1128992567 15:72272805-72272827 GGGGGGTGGCGCCTGCGCCGTGG + Intronic
1129116778 15:73368990-73369012 GGGCAGCGGCGCACGGGCCGGGG + Exonic
1129387098 15:75202176-75202198 AGGGAGCCGCGCCTGGGCCGAGG + Intronic
1129752803 15:78077625-78077647 GGGGGCCGGAGCCCGGGCGGAGG - Exonic
1129919898 15:79311202-79311224 GGGGCGCAGCGCCCGAGCCGCGG + Exonic
1130040805 15:80404254-80404276 GGCGGGGGGCGCCCGGCCCGCGG - Intergenic
1131517602 15:93089305-93089327 CGGGCCGGGCGCCCGGGCCGCGG + Intergenic
1132055512 15:98648371-98648393 GCGGAGCGGAGCCCGGGCGTGGG - Intergenic
1132500985 16:284616-284638 GGGGGGCGGTGGCCAGGCCGAGG + Intronic
1132527625 16:425593-425615 GGGGGGCGGGGCCTGGGCGGCGG + Intergenic
1132552790 16:560278-560300 GGGGCGCGGGGTTCGGGCCGGGG + Intergenic
1132553949 16:564605-564627 GGGGAGAGGGGCAGGGGCCGGGG + Intronic
1132594111 16:740524-740546 GGGCGGCGGGGCCCGGGCCGGGG - Intronic
1132607804 16:800790-800812 TGGGGGCGGCGCCAGGGCCCAGG - Intergenic
1132683503 16:1153167-1153189 GGGGCGCGGGGCGCGGGCCGGGG - Intergenic
1132683507 16:1153174-1153196 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
1132683510 16:1153181-1153203 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
1132683577 16:1153342-1153364 GGGGGCCGGGGCCGGGGCCGGGG + Exonic
1132687218 16:1167354-1167376 GCGGGGTGGCGCCCGGGCCGCGG + Intronic
1132687772 16:1169453-1169475 GGGGAACGTCGCGGGGGCCGCGG - Intronic
1132729059 16:1351772-1351794 GGAGGGCAGCGCGCGGGCCGGGG - Exonic
1132736597 16:1389056-1389078 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132767636 16:1542458-1542480 GGGGAGCAGCCCCTGGGCAGAGG + Intronic
1132789693 16:1678599-1678621 GGGGAGGGGCGCCCGGGCTCTGG + Intronic
1132805079 16:1771567-1771589 GGGCGGTGGCGCCCGGGGCGGGG + Exonic
1132843418 16:1989596-1989618 GGGGACCGGCTCCCTGGCCCTGG - Intergenic
1132947137 16:2537959-2537981 GCGGGGCGGCGCCGGGGGCGGGG + Exonic
1132947266 16:2538338-2538360 GGCGGGCGGCGGCCTGGCCGGGG + Intronic
1133156750 16:3881035-3881057 CGGGAGCGGCGGCCTGGCCGCGG + Intergenic
1133220246 16:4316519-4316541 GCCGAGCAGCGCCCGGGCCCGGG + Intronic
1133271038 16:4610895-4610917 GGGGAAAGGCGCCCGGCCCCAGG + Intronic
1133286743 16:4694245-4694267 GGGGGGCGGGGCCCGGGCGGCGG - Intronic
1134172066 16:11976694-11976716 GGGGCGGGGCGGCCGGGGCGGGG + Intergenic
1135281693 16:21158601-21158623 GAGGGGCGGTGCCCGGGCCAGGG + Exonic
1135577387 16:23596228-23596250 GGGCAGCGGCGCAAAGGCCGCGG + Exonic
1136399804 16:30011087-30011109 GGGGAGGGGCGCTGGGGCTGGGG + Intronic
1137561215 16:49503475-49503497 GGGGAGGGGCTTCCGGGCTGCGG - Intronic
1137665345 16:50246222-50246244 GGAGCGCGGCGGGCGGGCCGGGG + Intronic
1137675540 16:50302082-50302104 GAGGGGCGGGGCCAGGGCCGGGG - Intronic
1137926611 16:52547007-52547029 GGGGCGCGGCGCTGGGGCCCGGG + Exonic
1139480633 16:67228657-67228679 GGTGAGCGGCCCCAGGGCTGGGG + Intronic
1139511605 16:67431202-67431224 GCGGGGCGGGGGCCGGGCCGGGG - Exonic
1139528097 16:67528779-67528801 GGGGAGGGGCGGCGGGGCGGCGG + Intronic
1140091934 16:71846010-71846032 GTGGGGCGGCTCCGGGGCCGGGG + Exonic
1140223088 16:73058152-73058174 GGGTGGAGGCGCCCGGGGCGAGG - Intronic
1140440637 16:74985020-74985042 GGGCCGCGGCGGCCGGGCGGGGG - Exonic
1141054632 16:80804066-80804088 GGGCGGCGGGGACCGGGCCGGGG - Intronic
1142156183 16:88533812-88533834 GGGGCGCGCGGGCCGGGCCGGGG - Exonic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142395215 16:89828237-89828259 GGGGCGCGGGGCCGAGGCCGGGG - Intronic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142474621 17:181525-181547 GCTGAGCCGCCCCCGGGCCGGGG - Exonic
1142586869 17:979472-979494 GGGACGCGGCGGCCGGGCCGGGG - Exonic
1142683222 17:1562309-1562331 GTGGAGGGGCGGCCGGGGCGTGG - Intronic
1142752795 17:1998505-1998527 GGGCAGCGGTGGCCGGCCCGGGG - Intronic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143106612 17:4533461-4533483 GGGGAGCTGGGCCTGGGCCGCGG + Intronic
1143202751 17:5123357-5123379 GCTGAGCCGCCCCCGGGCCGGGG - Intronic
1143401916 17:6651713-6651735 AGGGGGCGGGGCCCGGGCCGTGG + Exonic
1143501438 17:7341842-7341864 GGGGAGCGCCGCCCTGGGCAAGG + Intronic
1144862553 17:18314786-18314808 GGGGAGCGGCTCCGGGCGCGAGG - Exonic
1144953033 17:19004220-19004242 GGGGAGGGGCGGCGGGGGCGGGG + Intronic
1145077357 17:19867306-19867328 GGTGAGCGCCGGCCGGGGCGAGG - Exonic
1145214764 17:21043086-21043108 GGGGCGGGGCGCCGCGGCCGCGG + Intronic
1145884426 17:28372275-28372297 GGCGGGCGGCGCGCGGGCCGTGG + Exonic
1146155945 17:30523632-30523654 GGGCAGGGGCGGCCGGGCAGAGG - Exonic
1146370987 17:32265718-32265740 GGGTGGCGGCGCCCGGGGTGGGG + Intergenic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1146901376 17:36591790-36591812 GGGGCGGGGCGGCCGGGCCGCGG + Exonic
1147163054 17:38578900-38578922 GTGGAGAGGCGCCCGGGGAGAGG + Intronic
1147168552 17:38605568-38605590 CGGGGGCGGCGGCCGGGCCGGGG - Intronic
1147315378 17:39617859-39617881 GGGGCGCGGGGCACGTGCCGAGG - Intergenic
1147325398 17:39667466-39667488 GGGGAGCGCAGTCCGGGCCTTGG - Intergenic
1147407029 17:40219565-40219587 GGGGAGGGGGGCTCGGGGCGGGG + Intronic
1148126902 17:45241900-45241922 GGGGAGGGGAGGCCGGGCAGTGG - Exonic
1148156940 17:45430004-45430026 GGCGAGCGGCTCAGGGGCCGCGG + Intronic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323615 17:46771441-46771463 CGGCAGCGGCGCCCGGGCCCCGG + Intronic
1148323707 17:46771707-46771729 GCGGCCCGGCGCCGGGGCCGGGG - Intronic
1148782439 17:50129607-50129629 GGGGACCGTCACCCCGGCCGCGG + Exonic
1149300944 17:55304288-55304310 GGGGAGAGGCTCCCGGCCCAGGG + Intronic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149994629 17:61400131-61400153 GGGGGCCGGGGCCGGGGCCGGGG - Exonic
1150133328 17:62680757-62680779 TGGGAGCGGCGGCCAGGCAGAGG - Intronic
1150239982 17:63623023-63623045 GGGAAGCGGCGGCGGGACCGAGG + Intronic
1150294697 17:64001554-64001576 GGGCAGCGGGGCCCAGGCCTGGG + Intronic
1150790820 17:68199212-68199234 GGTGAGCGGCTCGGGGGCCGAGG - Intergenic
1150794913 17:68229310-68229332 GGGGACAGGCACCCGGGCTGAGG - Intergenic
1150830078 17:68511734-68511756 GGCCAGCGCCGCCCGGGCCCCGG - Intergenic
1150983440 17:70169307-70169329 GGGGAGTCGGGCCCGGGCCGGGG - Intronic
1151812443 17:76452667-76452689 GGGGGTCGGCGGCCGGGCCGAGG - Intronic
1151828701 17:76537589-76537611 GGGGCGCGGGGCGCGGGGCGCGG + Exonic
1151875992 17:76868597-76868619 GGGGACCGGGGCGCGGGCCCGGG + Intronic
1152174926 17:78781611-78781633 GGGGAGCGGCGCCGCCGGCGAGG - Intronic
1152353914 17:79797731-79797753 GGGGAGGGGGGCGGGGGCCGGGG - Intronic
1152356499 17:79810123-79810145 GGGCTGCGGCGCGCGGGCCCCGG - Intergenic
1152391436 17:80006141-80006163 GGGGAGGGGTGTCAGGGCCGAGG - Intronic
1152531460 17:80921826-80921848 GGGGAGGGGCGCACTGGCAGGGG - Intronic
1152637410 17:81435780-81435802 GGGCTGCTGCGGCCGGGCCGGGG - Intronic
1152690556 17:81715967-81715989 CGGGAGGGGCGGGCGGGCCGAGG - Intronic
1152703110 17:81829222-81829244 GGGGAGTGGCGGCCTGACCGAGG + Intronic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152777750 17:82213109-82213131 GGGGACCCTCGGCCGGGCCGGGG - Intergenic
1152867905 17:82735331-82735353 TGTGACCAGCGCCCGGGCCGAGG + Intergenic
1152873886 17:82774653-82774675 ACGGAGCGGCGGCCGGGCGGGGG + Intronic
1153219377 18:2847955-2847977 GGCGGGGCGCGCCCGGGCCGGGG + Intronic
1153480536 18:5543213-5543235 GGGCAGCGGCCCCCGGCCGGTGG - Intronic
1153855138 18:9137338-9137360 GGTGAGGGGCGCCCGCGACGAGG - Intronic
1156099631 18:33578373-33578395 GGCGCGCGGCGGGCGGGCCGGGG - Intergenic
1156099677 18:33578498-33578520 GGGGGGAGGCGCGCGGGCGGTGG - Intergenic
1156495854 18:37524808-37524830 CGGGAGCCGCGGCCGGGGCGCGG - Intronic
1157496715 18:48161839-48161861 GGGGAGGGGCGCCCGGGAGGAGG - Intronic
1157580925 18:48773736-48773758 GGTGAGGGGCACCAGGGCCGGGG - Intronic
1157799702 18:50609323-50609345 GCGGGGCGGCGGCCGGGCGGAGG + Intronic
1160163996 18:76494978-76495000 GGGGAGGGGCCCCCCGGGCGCGG - Intronic
1160458946 18:79022831-79022853 GGGCAGCGGGTCCTGGGCCGTGG + Intergenic
1160499614 18:79395554-79395576 GGGGAGGGGCGCACGGGGAGGGG - Intergenic
1160499903 18:79396393-79396415 GGGGGGCGCGGCCCGGGCCGTGG - Intronic
1160563440 18:79772738-79772760 GGGGAGGGGAGCTCGGGCCTGGG - Intergenic
1160663438 19:312077-312099 GGTCAGCGGCGCCCAGGGCGGGG + Intronic
1160668388 19:344391-344413 GCGCCGCGGGGCCCGGGCCGGGG + Intronic
1160724846 19:613554-613576 GGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160745329 19:708774-708796 GGGGCGGGGCGCGCGGGGCGGGG + Intergenic
1160747901 19:720295-720317 GGGCGGCGGCGCCCGGGTCTGGG + Intronic
1160748005 19:720534-720556 CGAGAGGGGCGCCCGGGCCTGGG + Intronic
1160784422 19:892885-892907 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784425 19:892892-892914 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784428 19:892899-892921 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784431 19:892906-892928 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784434 19:892913-892935 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784437 19:892920-892942 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160788595 19:912736-912758 GGGGAGTGGGGCGCGGACCGGGG + Intronic
1160798479 19:956457-956479 AGGGGGCGGCAGCCGGGCCGGGG + Intronic
1160826363 19:1082273-1082295 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1160909867 19:1469465-1469487 GGGGGGCCGCTGCCGGGCCGGGG - Exonic
1160972397 19:1775475-1775497 GGGGCACAGCGCCCAGGCCGTGG - Exonic
1160991770 19:1863137-1863159 AGGGCGCGGCGCCGGGGGCGCGG + Exonic
1160998338 19:1895580-1895602 AGGGAGCAGGGCCAGGGCCGGGG + Intergenic
1161006839 19:1941323-1941345 GGGGCGCGGGGCCCGGAGCGGGG + Exonic
1161189414 19:2944803-2944825 CGGGAGCCGAGCCCGGGCCCAGG - Intronic
1161303992 19:3557037-3557059 GGGAGGAGGCGCCCGGGTCGCGG + Intronic
1161394451 19:4037822-4037844 GGGCAGCGGCGCTTGGGCCGGGG - Exonic
1161505089 19:4639524-4639546 TGGGAGCAGCGCCGGAGCCGGGG - Intronic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161699169 19:5785559-5785581 GGTGGGCGGCGCGTGGGCCGCGG - Intronic
1162018099 19:7856507-7856529 GGGGAGCAGAGTCCGGGCTGTGG - Intronic
1162128234 19:8510864-8510886 GGGGCGCGGCGGCCCGGCCGCGG + Exonic
1162374499 19:10296633-10296655 GGGGGGCGTCCCCCGGCCCGCGG - Exonic
1162550532 19:11355727-11355749 GGGGAGGGGACCCCGGGCCGAGG + Intronic
1162675329 19:12294447-12294469 AGAGAGGGGCGCCGGGGCCGGGG + Intronic
1162951367 19:14073630-14073652 GGGGAGCGGCTCCTCGGCGGGGG + Exonic
1163186101 19:15640796-15640818 TGGGAGCGGCACCCAGGCTGTGG + Intronic
1163398089 19:17075763-17075785 GGGGAGCGGCGGGCGCGGCGGGG + Exonic
1163437320 19:17303250-17303272 GGGCCGCGGGGCCCGGGTCGGGG + Exonic
1163547234 19:17947807-17947829 TGGGGGCGGGGCCGGGGCCGGGG - Intergenic
1163598237 19:18232893-18232915 GGGGAGGGGCGCGCGGGGCCTGG - Intronic
1163657840 19:18557992-18558014 CGGGCGCGGCCCCCGGGCTGCGG + Intronic
1164595104 19:29527034-29527056 GGGAAGCGGCTGCAGGGCCGAGG - Intronic
1164639029 19:29811708-29811730 GGGGCGCGGGGCGCGGGACGCGG - Intergenic
1165040594 19:33065081-33065103 GGAGAGCTGCGCCCTGGGCGCGG + Intergenic
1165080295 19:33302772-33302794 CGGGGGCGACGGCCGGGCCGGGG - Intergenic
1165129231 19:33621874-33621896 GCGGGGCGGGGCACGGGCCGGGG + Intergenic
1165157135 19:33795750-33795772 GGGGAGGGGCGTCCGGGGCGCGG + Intergenic
1165431445 19:35775724-35775746 GGGGCGGGGCGCGCGGGGCGGGG - Intronic
1165922529 19:39307852-39307874 GGGGAGCCGCGGCCCGGCCGAGG - Exonic
1166064352 19:40348398-40348420 GGGGCGGGCAGCCCGGGCCGGGG - Intronic
1166294666 19:41883143-41883165 GGGGAGGGGCGGCGGGGCGGGGG + Intronic
1166410651 19:42553864-42553886 GGGTAGCGGGGCCTGGGCAGGGG + Intronic
1166547044 19:43639890-43639912 GGGGCGGGGCGCCGAGGCCGGGG + Intergenic
1166792220 19:45405053-45405075 GGGGAGCGGAGAACGGGGCGGGG + Intronic
1166853636 19:45771746-45771768 CGGGATCGGGGCCGGGGCCGGGG - Intronic
1166990448 19:46689708-46689730 GGGGAGCGGGGTCAGGGCCCAGG + Intronic
1166995985 19:46719925-46719947 GGGGAGGGGCAGCCAGGCCGGGG + Exonic
1167072760 19:47230507-47230529 GGGGGGCGGCTCGCGGGCCGTGG - Intronic
1167268070 19:48493315-48493337 GGGGGGCGGAGCCCAGGGCGGGG - Intronic
1167268251 19:48493883-48493905 CGGGCGCGGCGGCGGGGCCGCGG - Exonic
1167410136 19:49339529-49339551 GTGGAGCGGCGGGAGGGCCGGGG - Intronic
1167622762 19:50568350-50568372 GGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1167741356 19:51326604-51326626 GGGGAGGGGCTGCAGGGCCGGGG - Intronic
1168239297 19:55081325-55081347 GTAGAGCGGGGCGCGGGCCGCGG + Exonic
1168339830 19:55616571-55616593 GGGCAGCGGAGCTCGGGCCGCGG - Exonic
1168354370 19:55692408-55692430 GGGGAGGGGTGGCCGAGCCGTGG + Intronic
1168641462 19:58034288-58034310 GGGGAGGCGGGCCCGGGCCCGGG + Intronic
1168694499 19:58396865-58396887 GGGGCGCGGCGTCCAGGCGGGGG - Exonic
1202703168 1_KI270713v1_random:3339-3361 GGGCAGGGGAGCCTGGGCCGTGG + Intergenic
925029244 2:636641-636663 GGGGAGCCGCGCCGGGGAAGAGG + Intergenic
925161110 2:1685134-1685156 GGGGAGCTGGCCCCGGGACGGGG - Intronic
925927631 2:8681773-8681795 GGGGAGCGGCGGGCGGGGGGCGG - Intronic
926035104 2:9630455-9630477 CGGGCGCGGGGCCGGGGCCGGGG + Exonic
926198167 2:10775966-10775988 GGGGAGGAGCGCCGTGGCCGCGG + Intronic
927684629 2:25161796-25161818 CGGGCGCGGCAGCCGGGCCGGGG - Intronic
927713863 2:25341040-25341062 CGGGAGGGGCGGCGGGGCCGGGG - Intronic
927938035 2:27086331-27086353 GGTGGGCGGCGCCCGCGCGGGGG - Exonic
927945879 2:27134801-27134823 GGGGCGCGGGGCGCGGGCGGAGG + Intergenic
927956623 2:27211839-27211861 GGGGAGCGGCGTCTGAGCCGGGG - Intronic
927990201 2:27442289-27442311 GGGGAGCGGGCCCGGGGCGGAGG + Intergenic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
928549434 2:32357005-32357027 GGGAGGCGGGGCCCGGGGCGCGG - Intergenic
929033792 2:37672144-37672166 GGGGAGCTGCGGCCTGGCCGGGG - Exonic
929133751 2:38603062-38603084 AGGGAGCAGAACCCGGGCCGGGG - Intronic
929188605 2:39120455-39120477 GGGCGGCGGCGGCCGGGCCAGGG + Exonic
930071474 2:47369628-47369650 GGGCAGCGGCCCCCGGCCCTCGG + Intronic
930787207 2:55282367-55282389 TGGGAGCGGCGCTCGAGCAGCGG + Intergenic
931355821 2:61537432-61537454 GGGAGGCGGCGGGCGGGCCGGGG - Intronic
932812021 2:74833934-74833956 GGGGAGGCGCGCCGGGGGCGGGG - Intergenic
933776147 2:85772391-85772413 GGGCCGCGGCGGCCGGGCGGGGG - Intronic
934045563 2:88170421-88170443 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
934045566 2:88170428-88170450 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
934754440 2:96815969-96815991 CGGGCGCCGCGCACGGGCCGAGG + Intergenic
934966910 2:98731236-98731258 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
935046681 2:99489670-99489692 GGGGTGCGTCGCCCCGGCCCCGG - Intronic
935237496 2:101151086-101151108 CGGGCGCGGCGGCCGGGCCCGGG - Intronic
936433263 2:112482229-112482251 GGGCGGCGGGGGCCGGGCCGCGG + Exonic
936556915 2:113503925-113503947 GGGGCGCGGGGGCCGGGACGCGG + Intergenic
936985773 2:118310485-118310507 GGGGAGGGGAGCCCGGGAGGGGG - Intergenic
937103999 2:119293691-119293713 GGTGAGAGGCGCCTGGGCCCTGG + Intergenic
937135015 2:119544674-119544696 GGGGAGCGGTGCGCGGGCCTGGG + Intronic
937206266 2:120238962-120238984 GGGGAGCGGGGAGCGGGCAGGGG - Intergenic
939629830 2:144517487-144517509 GGGGAGCCGGGCCAGGGCCCCGG + Intronic
943811777 2:192195882-192195904 GGGCAGCGGCGTCCGGGAAGGGG + Intergenic
944615208 2:201452145-201452167 GCTCAGCGGGGCCCGGGCCGCGG + Intronic
945251625 2:207769702-207769724 GGCGAGCGGCGGGCGGGACGCGG - Intergenic
945699426 2:213151757-213151779 GGGCAGCGGAGCCCCGGGCGCGG + Intronic
946306529 2:218859755-218859777 GGGGAGCGGGGCCGAGGCGGGGG - Intergenic
946340224 2:219061390-219061412 AGGGCGCGTCGCCCGGGCCAGGG - Intergenic
946402740 2:219477062-219477084 GGAGGGCGGAGCCCGGGCAGAGG + Intronic
946431177 2:219628011-219628033 GGGGAGGCGCCCCCGGGCGGCGG - Exonic
947612045 2:231530516-231530538 AGGGGGCGCCGCCCGGGCTGCGG - Intergenic
947774553 2:232697439-232697461 GGGACGCGGCGGCGGGGCCGGGG - Intronic
948216548 2:236237350-236237372 GGGGCGCGGGGCGGGGGCCGGGG + Intronic
948216563 2:236237375-236237397 GGGGCGCGGGGCGGGGGCCGGGG + Intronic
948216578 2:236237400-236237422 GGGGCGCGGGGCGGGGGCCGGGG + Intronic
948477815 2:238231705-238231727 GGGGCGTGGCCTCCGGGCCGCGG + Intergenic
948494754 2:238340135-238340157 GGGGAGCAGGGCCAGGGTCGGGG - Intronic
948851718 2:240711528-240711550 GGGGAGCTGAGCCCCGGCCTTGG - Intergenic
948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG + Exonic
948958856 2:241316114-241316136 GGGGAGGGGCGGCCGAGCCCAGG + Intronic
949014355 2:241701471-241701493 GGGGAAGGGCGCCAGGGCCCAGG + Intergenic
949014492 2:241701884-241701906 GGGCTGCGGGGCCCGGGCGGAGG - Intergenic
1168769756 20:407955-407977 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1169065490 20:2692636-2692658 GGGGAGGAGCGGCCGGGCCCGGG - Intergenic
1169673816 20:8132568-8132590 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1169867704 20:10218726-10218748 CGGGGGCGGGGCCCGGGCTGCGG - Intergenic
1170578308 20:17681083-17681105 CGGGAGAGCCGGCCGGGCCGGGG + Intronic
1170578600 20:17681897-17681919 GGCGGGCGGCGGGCGGGCCGGGG + Intronic
1170889874 20:20368080-20368102 AGGGAGCGGCTGCCGGGCCCGGG + Intergenic
1170890063 20:20368807-20368829 GGGGGCCGGGGCCCGGGCCGCGG - Exonic
1171750893 20:29047362-29047384 GGAGAGCGGCCTCCGGGCCAGGG + Intergenic
1172015432 20:31870262-31870284 GGGCCGCGGCGGCCGGGGCGGGG + Intronic
1172028903 20:31968135-31968157 GGGGAGCGACTTCCGGGCGGCGG - Exonic
1172284743 20:33732410-33732432 GGCGCGCGGGGCCCGGGACGGGG + Intronic
1172528586 20:35616116-35616138 GGTCAGCGGAGCCCGGGCCTGGG + Exonic
1172721351 20:37001176-37001198 GGGCAGGGGCGGCCGGGCAGAGG - Intronic
1172883727 20:38217831-38217853 GGGGAGCGGGGGCGGGGGCGGGG - Intronic
1173165968 20:40687726-40687748 GAGGAAGGGCGCGCGGGCCGCGG - Exonic
1173576622 20:44116221-44116243 GGGGAGCCACCCTCGGGCCGAGG + Exonic
1174204240 20:48827740-48827762 GGGCGGCCGCGCACGGGCCGGGG + Exonic
1174579585 20:51562382-51562404 GCGGAGGGGCGCCCGCGCCCCGG - Intronic
1175340910 20:58228521-58228543 CAGGAGCGGTGCGCGGGCCGGGG - Exonic
1175424640 20:58855662-58855684 GGGGAGGGGCCCCGGGGCCCCGG + Intronic
1175466115 20:59192142-59192164 GGGGAGGGCGGCCCGGGCCCGGG + Exonic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1175815043 20:61878873-61878895 GGCGAGGGGCGCCCTGGCCTCGG - Intronic
1175847402 20:62065902-62065924 GGGGGGCGGCGCGCGGCCGGCGG + Intergenic
1176022345 20:62968210-62968232 GGAGAGCGGCGCCAGGGTCCCGG - Exonic
1176143283 20:63554294-63554316 GGGGAGGTGGGCCCGGGCCAGGG + Exonic
1176547778 21:8208953-8208975 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1176549511 21:8215023-8215045 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1176555674 21:8253158-8253180 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1176568436 21:8398057-8398079 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1176574604 21:8436187-8436209 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1176576348 21:8442287-8442309 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1176611217 21:8987479-8987501 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1178992186 21:37366164-37366186 CGAGCGCGGCGCCCGGACCGCGG + Intronic
1179375491 21:40846877-40846899 GGGGCGCGGCGCCCGGGAGCAGG - Exonic
1179457252 21:41508084-41508106 GGGGAGCGCCGCCTGGAGCGCGG - Intronic
1179783816 21:43718831-43718853 GGGGCGCGGGGCGCGGGGCGCGG + Intergenic
1180056138 21:45360095-45360117 GGGGAAGGGCGGCAGGGCCGGGG - Intergenic
1180085240 21:45505289-45505311 GGGGAGTGGGCCCCGGGCAGAGG + Intronic
1180110355 21:45644364-45644386 GGAGAGCCGCGCGCGGGCGGTGG + Intronic
1180559139 22:16601729-16601751 GGGCCGCGGGGCCCGGGCGGCGG - Intergenic
1180832399 22:18912815-18912837 GGGGAGCAGTGGCCGGGCTGGGG - Exonic
1180949467 22:19714675-19714697 GGTGAGAGGCGCGCGGGCGGCGG - Intronic
1181006441 22:20016031-20016053 GGGGAGGGGGACCCAGGCCGGGG + Intronic
1181017711 22:20080575-20080597 GGGGGGCGGGCCCCGGGCCCAGG + Intronic
1181067446 22:20313527-20313549 GGGGAGCAGTGGCCGGGCTGGGG + Intergenic
1181478040 22:23180631-23180653 GGCGAGGAGCGCGCGGGCCGTGG + Exonic
1181637592 22:24181567-24181589 TGGGTCCGGGGCCCGGGCCGAGG - Exonic
1182237070 22:28884075-28884097 GCGGCGCGGGGCCCGGGCGGCGG - Intronic
1182903911 22:33920610-33920632 GGGGCGCGGGGCCGGGGGCGCGG + Intronic
1183453015 22:37906732-37906754 GGGGAGGGGCGCCCTGGGCCGGG - Intronic
1183744850 22:39686296-39686318 GGGCAGCGGTGCCCGGCCGGGGG - Exonic
1184152986 22:42649265-42649287 GGGAGGGGGCGCCGGGGCCGCGG - Intronic
1184276370 22:43411673-43411695 GAGGAGCGGGGCCCGCGCTGCGG - Intronic
1184895160 22:47402538-47402560 CGGGAGCGGCCGCCGGGCTGAGG + Intergenic
1184979661 22:48086843-48086865 GGGGGTCGGGGCCCGGGTCGGGG + Intergenic
1184979675 22:48086867-48086889 GGGGGTCGGGGCCCGGGTCGGGG + Intergenic
1184979689 22:48086891-48086913 GGGGGTCGGGGCCCGGGTCGGGG + Intergenic
1184979716 22:48086938-48086960 GGGGGTCGGGGCCCGGGTCGGGG + Intergenic
1184979730 22:48086962-48086984 GGGGGTCGGGGCCCGGGTCGGGG + Intergenic
1185010377 22:48309485-48309507 GGCGACCGACGCCCAGGCCGAGG + Intergenic
1185045199 22:48525250-48525272 GGGGAGCATCCCCTGGGCCGAGG - Intronic
1185058176 22:48591998-48592020 GGGGAGGTGCCCCGGGGCCGTGG - Intronic
1185314007 22:50170972-50170994 GGGGCGCGGGGCGCGGGCAGAGG + Intronic
1185317629 22:50185872-50185894 GGGGCGGGGCGGACGGGCCGAGG - Intergenic
1185397683 22:50601026-50601048 GGGGTGGGGCGCCCGAGCCGAGG - Intronic
1203252652 22_KI270733v1_random:125238-125260 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1203254398 22_KI270733v1_random:131345-131367 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1203260708 22_KI270733v1_random:170324-170346 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1203262454 22_KI270733v1_random:176424-176446 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1203282485 22_KI270734v1_random:138120-138142 GGGGAGCAGTGGCCGGGCTGGGG - Intergenic
950040258 3:9915510-9915532 GGGGCGCGGCGCGGGGGTCGGGG - Exonic
950153844 3:10708046-10708068 GGCGGGCGGCGGCGGGGCCGCGG - Intergenic
952867229 3:37862121-37862143 GGGGCGCGGCGCGGGGGGCGCGG - Intronic
953246711 3:41199823-41199845 GGTGGGCCGCGCCCGGGGCGCGG + Intronic
953246722 3:41199844-41199866 GGAGGGCGGCGGCCGGGCCCGGG + Intronic
953399609 3:42601079-42601101 GGGGAGCGCTGCTGGGGCCGAGG + Intronic
953485027 3:43286767-43286789 CGGGCTGGGCGCCCGGGCCGGGG + Intronic
953909180 3:46883193-46883215 GGGGGGCGGGGGGCGGGCCGGGG + Intronic
954004153 3:47578659-47578681 GGGGGCGGGGGCCCGGGCCGGGG - Exonic
954277958 3:49554668-49554690 CGGGGCCGGGGCCCGGGCCGGGG - Exonic
954278001 3:49554788-49554810 CGGGACCGGGGCCGGGGCCGGGG - Exonic
954367780 3:50155409-50155431 CGGGATCGGCGCCGCGGCCGCGG - Exonic
954376111 3:50195023-50195045 GGGGTGAGGCTCCAGGGCCGTGG - Intronic
954382575 3:50227468-50227490 GGGGTGCGGCGCGGGAGCCGAGG - Intronic
954683791 3:52359763-52359785 GGGGAGCAGGGACCGGGCAGGGG - Intronic
955281235 3:57596951-57596973 GGGGAGGGGCGCCGGGTCGGGGG - Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
956605003 3:71065067-71065089 CGGGCGCGGGGCGCGGGCCGCGG - Intronic
956675077 3:71725449-71725471 GGGGCGGGGCGCGCGGGGCGGGG - Intronic
956678285 3:71754736-71754758 GGCCGGTGGCGCCCGGGCCGTGG - Exonic
958814482 3:98901234-98901256 GGGGAGCGCGGCCCAGGCGGGGG + Exonic
960120904 3:113947978-113948000 CGGGCGCGCCGCCCGGGCCGCGG + Exonic
961625055 3:128255843-128255865 GGGGAGCGGGGCCGGGGCTGGGG + Intronic
961666828 3:128497922-128497944 GGGGAGGGGCGGCCGGGGAGTGG - Intergenic
961715253 3:128853389-128853411 GGGGAGTGGCACCGGGGCGGGGG + Intergenic
962222469 3:133574515-133574537 GGGTGGCGCCGCCCGGGCCTTGG - Intronic
963091393 3:141486919-141486941 GGGGGGCGGGGGCGGGGCCGCGG + Intergenic
965074905 3:163963885-163963907 GGGCAGCGGGGCCCTGGCCCTGG - Intergenic
966181902 3:177196555-177196577 GGGTCGCCGCGCCCGGGCCGGGG + Intronic
966372167 3:179261436-179261458 GGGGAGCGGCTCGCGGGACTGGG + Intronic
966592272 3:181696064-181696086 GCGCAGCGGCGCCAGGTCCGAGG - Intergenic
966886449 3:184380183-184380205 GGGGGCCGGGGCCGGGGCCGGGG - Exonic
968470917 4:781969-781991 AGGGAGCGGGGACCGGGCCGTGG - Intergenic
968479038 4:825858-825880 GGGGAGCGGAGGCCGGGGGGAGG + Intronic
968512997 4:1003496-1003518 GGGAAGGGGAGTCCGGGCCGCGG - Intronic
968601748 4:1513003-1513025 GGGGTGCGGGGGCCGGGCTGGGG - Intergenic
968653126 4:1767751-1767773 GGGGCGCGGGGCGCGGGGCGGGG - Intergenic
968653131 4:1767758-1767780 CGGGAGCGGGGCGCGGGGCGCGG - Intergenic
968671826 4:1856152-1856174 GGGGCGGGGCGGCCAGGCCGCGG + Exonic
968698088 4:2042358-2042380 GGGGACCGGCACGCGGGCGGGGG - Exonic
968879818 4:3293103-3293125 GGTGTGCGGGGCCGGGGCCGGGG + Intronic
969115028 4:4866015-4866037 GCGGAGGCGCGCGCGGGCCGGGG - Intergenic
969621522 4:8281181-8281203 TGGGGGCAGGGCCCGGGCCGCGG - Intronic
970332651 4:15002348-15002370 GGGGAGGGGCGACGGGGACGCGG + Intergenic
973635944 4:52862208-52862230 GCGGAGCGGCGCCGGGGGCGGGG + Intergenic
974047244 4:56908251-56908273 GGGGAGGGCCGCCCGGGCGGCGG + Intronic
974977374 4:68906945-68906967 GGGGAGGGGCACCGGGGACGCGG + Intergenic
976177948 4:82373534-82373556 GGGAAGCGGAGCCGGGACCGGGG - Exonic
979278103 4:118835857-118835879 GGGTTGCGGCGCCCGGCCCGGGG - Intronic
982468658 4:155760041-155760063 GGGGAGGGGCGGCTGGGGCGGGG + Intronic
984888716 4:184473422-184473444 GGGGTCAGCCGCCCGGGCCGCGG - Intronic
984973268 4:185209461-185209483 CGGGGGCGGGGTCCGGGCCGGGG - Intronic
985550143 5:528671-528693 GGGGAGCGGGGCGCGGGGCGGGG - Intergenic
985630014 5:1009242-1009264 GGGGGGCGGCGACCCGGCCCGGG + Intronic
985727555 5:1523997-1524019 CGGGAGCGCCGGCCGGGGCGGGG + Intergenic
985783320 5:1881961-1881983 GTAGACCGGCGCCTGGGCCGAGG + Exonic
986330816 5:6714633-6714655 GGGCCGCGGCGCCTGGGCCCCGG - Exonic
987108736 5:14664989-14665011 GGGGCGCGGGGCGCGGGCCGTGG + Intronic
987132573 5:14872288-14872310 GGGGAGCGGGGCGCGGGGCTGGG + Intergenic
988564834 5:32312706-32312728 GGGCAGGGGCGGCCGGGGCGAGG - Intronic
988734656 5:34008113-34008135 GGGGCGCGGCGCCGCGGCTGGGG - Intronic
988796443 5:34656785-34656807 GGGGCGCGGGGCAGGGGCCGCGG + Intronic
990003727 5:50922542-50922564 GGGGTGGGGGGCCCGGGCCGAGG - Intergenic
990955263 5:61333205-61333227 GGGTAGGGGAGCGCGGGCCGGGG - Intronic
993904107 5:93604271-93604293 GGGGAGGGGCGGCCAGCCCGGGG + Intergenic
995574392 5:113513976-113513998 TGGGGGCGGCGGCCGGGCCAAGG + Exonic
996329380 5:122312116-122312138 GGGGAGCGGCGCCCGCGGCCGGG + Exonic
997206062 5:132050872-132050894 GGGGAGCTGCGGCAGGGCCGTGG + Intergenic
997521079 5:134525187-134525209 GGGGGGCGCCGCCCGGGTCTGGG + Intronic
997704112 5:135930634-135930656 GGGCGGCCGGGCCCGGGCCGCGG - Intronic
998166656 5:139848230-139848252 CGCGAGCGGCGCCAGCGCCGGGG + Exonic
998337670 5:141387887-141387909 GGGGAGCGGCGCCGGGGAGCTGG + Exonic
998338780 5:141398130-141398152 GGGGAGCGGCGCCGGGGAGCTGG + Exonic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
999244161 5:150144561-150144583 GGAGAGCGGGGCTCGGGCTGGGG - Intronic
999375065 5:151081002-151081024 GGGGCAGGGCACCCGGGCCGAGG + Intronic
1001401823 5:171450713-171450735 GGGGGTCGGGGCCGGGGCCGGGG + Intronic
1001506392 5:172283788-172283810 GGGGGGCGGAGGCTGGGCCGCGG - Exonic
1002368454 5:178730666-178730688 GGTGAGCGGCGCCGGGCCTGAGG - Exonic
1002448727 5:179307188-179307210 GGGCAGGGGCGCGTGGGCCGGGG - Intronic
1002452424 5:179326474-179326496 GGGGGGCGGGGCCGGGGGCGGGG - Intronic
1002530398 5:179841101-179841123 GGGGAGTGGGGCCTGGGCGGTGG - Intronic
1002721031 5:181261554-181261576 CGGAAGCCCCGCCCGGGCCGGGG + Intergenic
1003112173 6:3259370-3259392 CGGGAGCTGCGCGCGGGCCCCGG + Intronic
1003139152 6:3456742-3456764 GGGCCGCAGCGCCCGGGGCGCGG - Intronic
1003139182 6:3456831-3456853 GGCAGCCGGCGCCCGGGCCGCGG - Intronic
1003139397 6:3457528-3457550 TGGGAGCGGGGCGCGGGCAGCGG - Intergenic
1003868681 6:10384871-10384893 GCGGAGCGGCTCCCGCGCCCCGG - Intergenic
1004241324 6:13924986-13925008 CCGGAGCGGCTCCCGGGCCCTGG + Exonic
1004395688 6:15245238-15245260 GGGGAGGGGGGCCGGGGCCCGGG + Intergenic
1004529373 6:16439355-16439377 GGGGGGCGGGGCCGGGGGCGGGG + Intronic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1004627920 6:17393925-17393947 GGGGCGCGGCGACCCGGGCGCGG + Intronic
1005826181 6:29632896-29632918 GGGGAGGAGCGGCCGGGCCTGGG - Exonic
1005987661 6:30884508-30884530 GGGGAGAGGAGCCAGGGCTGGGG - Intronic
1006058178 6:31400887-31400909 GGGGAGGGGCGCCCAGGCCTGGG + Intronic
1006369186 6:33633753-33633775 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1006396224 6:33789113-33789135 GGGGGGCGGCGTCCTGGCCATGG - Exonic
1006599034 6:35213765-35213787 GGGGAGCGGCCACCGCGCCGAGG + Intergenic
1006725502 6:36196795-36196817 CGGCGGCGGCGGCCGGGCCGGGG + Exonic
1007092233 6:39191413-39191435 GGGGAGACGGGCCCGGGCCCAGG - Exonic
1007644340 6:43369097-43369119 GGGGAGCCGCGACGGGCCCGAGG + Exonic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1013273154 6:108560774-108560796 GGGGAGGGGCGCCCGGGGGAGGG - Intronic
1016992843 6:149941868-149941890 GGGGAGGGACGCCCGGGAAGGGG + Intergenic
1017000220 6:149991217-149991239 GGTGAGCGGCGCCTGCGCAGGGG + Intergenic
1017324564 6:153130909-153130931 CGGGAGCGGGGGCCGCGCCGCGG - Intronic
1017671981 6:156777754-156777776 GGCGGGCGCCCCCCGGGCCGCGG + Intergenic
1017755654 6:157526912-157526934 GGGGAGAGGGGCCGGGGCAGTGG + Intronic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1018020912 6:159761871-159761893 GGGGCGCGGGGCGCGGGGCGCGG - Exonic
1018046279 6:159969172-159969194 TGGGGGCCGCGCCCGGGACGGGG - Exonic
1019305693 7:333241-333263 TGGGCGGGGCGGCCGGGCCGTGG - Intergenic
1019323272 7:425153-425175 GGGGAGCGGGGACCGGGCCGGGG - Intergenic
1019343615 7:519608-519630 GGAGCGCGGCGCCGGAGCCGAGG - Intronic
1019385328 7:752375-752397 GGGAAGCGTGGCCCGGCCCGCGG - Intronic
1019385353 7:752515-752537 GGGAAGCGTGGCCCGGCCCGCGG - Intronic
1019536163 7:1530912-1530934 GGGCAGCGGGGCCCGGGCCGCGG + Intronic
1019711382 7:2519663-2519685 GTGGAGCGGCGACCGGCGCGAGG + Intronic
1019765063 7:2844065-2844087 GGGCAGCGGCGCGCGCGACGCGG - Exonic
1020204744 7:6105459-6105481 GGGGGGCGGCGGGCGGGCCGGGG - Intronic
1020274310 7:6615532-6615554 GGGGCGCGGCGGGCGGGCAGGGG + Intergenic
1021969225 7:25950930-25950952 GGGCTGCGTCCCCCGGGCCGGGG + Intergenic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1023287033 7:38631153-38631175 GCGGAGCGGGGCCGGGGCCAGGG - Intronic
1023851390 7:44152249-44152271 GGTGAGCAGCGCAGGGGCCGGGG - Exonic
1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG + Intronic
1025007562 7:55366123-55366145 GGCGAGCAGCGCCCCGGCGGCGG - Exonic
1026765016 7:73154957-73154979 GGCGCGCGGCGCCCGGCGCGGGG - Intergenic
1026829207 7:73600892-73600914 GGCGGGCGGCGCCCAGGCCCGGG - Intronic
1027041488 7:74964712-74964734 GGCGCGCGGCGCCCGGCGCGGGG - Intergenic
1027082154 7:75237657-75237679 GGCGCGCGGCGCCCGGCGCGGGG + Intergenic
1027826758 7:83125277-83125299 AGGGGGCGGCGGCCGGGCGGAGG - Intronic
1029372384 7:100158106-100158128 AGGTAGCAGGGCCCGGGCCGTGG + Exonic
1029422228 7:100477621-100477643 GGGTGGGGGCGCCCAGGCCGAGG + Exonic
1029640447 7:101816498-101816520 GGGGAGCGGGGAGCGGGCGGCGG + Intronic
1030033299 7:105388452-105388474 GGGGAGGGGCGCGCGGGCCGCGG - Intronic
1030216004 7:107044617-107044639 GGGGCGGGGCGCCCGGGCGGGGG + Intergenic
1032074534 7:128830241-128830263 GGGGAGGGGCGGCGGGGGCGGGG + Intergenic
1032083171 7:128870001-128870023 TGGGAGCCGCCGCCGGGCCGGGG + Intronic
1032119265 7:129144826-129144848 GGCGGGAGGCGCCCGAGCCGGGG - Intergenic
1032130718 7:129225245-129225267 GCGGAGCGGCCCCCGGTCCCCGG + Exonic
1032194197 7:129780253-129780275 GGCGGGCGGGGCCCGGGGCGGGG - Intergenic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033306732 7:140230801-140230823 GGGGCGCGCGGGCCGGGCCGTGG + Intergenic
1033662063 7:143408893-143408915 GGGGGGCGGGGCCAGCGCCGGGG + Intergenic
1034223086 7:149460451-149460473 GAGGGGCGGCGCGCGGGCCGGGG - Intronic
1034343420 7:150371881-150371903 GCGGGGCGGCCCCTGGGCCGGGG - Exonic
1034435041 7:151059518-151059540 CGGGAGCGGGGGCCGGGGCGGGG - Intronic
1034441355 7:151087426-151087448 GCGGAGCAGGGCCCGGGCAGCGG - Intronic
1034483609 7:151341980-151342002 GTGGAGCTGGGCCGGGGCCGGGG + Intronic
1034522633 7:151632350-151632372 GCGGAGGGGCACGCGGGCCGCGG - Intronic
1034618160 7:152436238-152436260 GGGGAGGGGCGGCCGGCCGGGGG - Intergenic
1035023016 7:155809835-155809857 GGGGGGAGGCCCCCGGGCTGGGG + Intronic
1035167390 7:156999933-156999955 GGGGAGGGGCGCCAGGTGCGCGG + Intronic
1035167413 7:156999982-157000004 GGGGGGCGGGCCCGGGGCCGGGG + Intronic
1035431987 7:158829397-158829419 GATGAGCGGCGCCCGGGGCGAGG - Exonic
1035717178 8:1763604-1763626 GGGGCGCGGCGCGGGGGGCGGGG - Intronic
1036910491 8:12754450-12754472 GGGGAGGGGCGCTCGGCGCGGGG - Intronic
1037811479 8:22089411-22089433 GGGCAGGGACCCCCGGGCCGCGG + Intronic
1037855372 8:22367506-22367528 CGGGAGCGGCGCCCGGTCCTCGG - Intronic
1037886810 8:22599794-22599816 GGGAAGCGGCTCCGGGGCAGGGG - Intronic
1038008753 8:23457454-23457476 GCGGCGCGGCGAGCGGGCCGCGG - Intronic
1038807979 8:30812451-30812473 GGAGGGCGGCGGCCGGGCTGGGG - Exonic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1039903068 8:41766990-41767012 GGGGGGCCGGGCCCTGGCCGAGG - Intronic
1039903156 8:41767274-41767296 GGGGATCGGGGCCGGGGCCGGGG - Intronic
1039936597 8:42051641-42051663 GGGCGGCGGCGCGCGGGCCGCGG + Intronic
1041304648 8:56446783-56446805 GGGGAGCGGCGCGCGGGTGCTGG - Intergenic
1041690358 8:60680314-60680336 GGGGCGCGGGGCTCGGGCGGGGG + Intronic
1042695143 8:71547600-71547622 GGCGATCGGCGCCCGGGAAGCGG - Exonic
1042903105 8:73747233-73747255 GGGGAGTCGCGCCGGGGACGAGG - Intronic
1043472867 8:80578845-80578867 GGGGCGAGGCGCCCGAGCCTTGG - Intergenic
1045305429 8:100952761-100952783 GGGGAGCGGCGGGCGGGGCGGGG - Intronic
1045432052 8:102123816-102123838 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1047277380 8:123416508-123416530 GGTGGGCGGAGCCCGGGACGAGG - Intergenic
1047998621 8:130358731-130358753 GCGGGGCGGGGGCCGGGCCGGGG - Intronic
1048822404 8:138392214-138392236 TGGGAGGGGCTCCCGGGCCTGGG - Intronic
1049166369 8:141128541-141128563 GAGGGGCGGGGCCCGAGCCGAGG - Intronic
1049417129 8:142500326-142500348 GAGGAGCGGCGCGGGGGGCGGGG - Intronic
1049419537 8:142510741-142510763 CGGCATGGGCGCCCGGGCCGCGG + Intronic
1049457338 8:142700402-142700424 GGGGAGCCCCGCCCGCCCCGGGG - Exonic
1049463025 8:142738898-142738920 GGGGAGCGGCGGCCTGGGCCTGG - Intergenic
1049537455 8:143188938-143188960 GGGGAGGGGCACCCTGGCCGAGG + Intergenic
1049573206 8:143379078-143379100 GGTGAGGGCGGCCCGGGCCGCGG + Exonic
1049620933 8:143597995-143598017 GGGGGGCGGCGGCCGTGCAGCGG - Exonic
1049717694 8:144100687-144100709 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1049726296 8:144148037-144148059 GGAAGGCGGCGCCCCGGCCGAGG + Intronic
1049896085 9:113376-113398 GGGGCGCGGGGGCCGGGACGCGG - Intergenic
1050472576 9:6008130-6008152 GGGGTGGGGCGCCGAGGCCGCGG - Intergenic
1050537790 9:6645456-6645478 TGGGGGCTGCGCCTGGGCCGCGG - Exonic
1053129227 9:35605677-35605699 GGGGAGGGGCCCCCGGGGCCGGG + Exonic
1053312415 9:37027885-37027907 GGGGGGCGGGGCCCAGGCGGCGG + Intronic
1053350561 9:37411016-37411038 AGGGAGCGGCGCCCTGGAGGTGG - Intergenic
1053435199 9:38069383-38069405 GGGGGGCGGGGCTTGGGCCGCGG - Intergenic
1054731416 9:68705588-68705610 GGCGGGCGGGGCCGGGGCCGGGG - Intronic
1056078164 9:83062617-83062639 GGGGGGCGGCGCCGGGACTGGGG - Exonic
1056773923 9:89498002-89498024 GGCGGGAGGCGGCCGGGCCGGGG + Intronic
1057618879 9:96618600-96618622 GGGGAGCGGACCCCGGGAGGCGG + Intronic
1057758085 9:97853117-97853139 GGGGAGGTGCGCCCGGGCCCCGG + Intergenic
1057922092 9:99105482-99105504 GGGGAGCGGAGGCGGGGCAGGGG + Intronic
1058058463 9:100472974-100472996 GGGCAGGGGCGCGGGGGCCGGGG - Intronic
1058618778 9:106862452-106862474 GGAGCGCGGCCGCCGGGCCGAGG - Intergenic
1058663104 9:107283719-107283741 GGGCAGCCGCGTGCGGGCCGCGG + Intronic
1059305348 9:113349590-113349612 AGGGCGCGGAGCCGGGGCCGGGG + Exonic
1059769799 9:117414671-117414693 CTGGAGCGGCGCCCGCGCCGGGG - Exonic
1059942260 9:119369537-119369559 GGGGAGCGGCGGCCGGGGGGCGG + Intergenic
1060478056 9:124000010-124000032 GGGGAGGGGCGCCGGGGCCCGGG - Intergenic
1061003791 9:127917037-127917059 AGGGGGCGGGGCCGGGGCCGGGG + Intronic
1061129864 9:128702799-128702821 GGGAAGCGGCGCCGGAGACGCGG - Exonic
1061129911 9:128702950-128702972 TGGGAGGGGCGCGCGGGCCCGGG + Intronic
1061239729 9:129362580-129362602 GGGGAGTGGGGCTCGGGCCCAGG + Intergenic
1061293705 9:129666151-129666173 GGGTGGCGGGGCCGGGGCCGGGG + Intronic
1061610039 9:131740024-131740046 GGGGAGCGGCGGCGGGCGCGCGG - Intronic
1061716335 9:132520787-132520809 GGGGAGGGGCTCCTGGGCCAGGG - Intronic
1061837037 9:133336283-133336305 CGGAAGCGGCGCGCGGGGCGGGG + Exonic
1061987140 9:134136315-134136337 CGGGAGCAGCGCCCGGGGCTGGG - Intronic
1062265160 9:135683566-135683588 GGGGAGCCGAGCAAGGGCCGAGG + Intergenic
1062308195 9:135921387-135921409 GGGGAGCAGGGCCAGAGCCGGGG - Intergenic
1062389290 9:136327648-136327670 CGGGAGCGCCCCCCGCGCCGTGG - Exonic
1062472383 9:136712298-136712320 GGGAGGCGGAGCCGGGGCCGGGG - Intergenic
1062476018 9:136727965-136727987 CGGGATGGGGGCCCGGGCCGCGG - Intergenic
1062587446 9:137255612-137255634 GTGGGGCGGCCCCCGGGGCGGGG + Intronic
1062609805 9:137368835-137368857 GGGGCGCAGGGCCCGGGGCGGGG + Intronic
1062609866 9:137368976-137368998 GGGGTGCAGTGCCCGGGGCGGGG + Intronic
1062609912 9:137369084-137369106 GGGGAGGGGCGCAGGGCCCGGGG + Intronic
1062609913 9:137369089-137369111 GGGGCGCAGGGCCCGGGGCGTGG + Intronic
1062659094 9:137619068-137619090 GGGGGGCGGCGCGGGGGCGGCGG + Intronic
1203469055 Un_GL000220v1:108389-108411 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1203470799 Un_GL000220v1:114489-114511 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1203476876 Un_GL000220v1:152361-152383 GGGGGGTGGGGCCCGGGCCGGGG + Intergenic
1203478620 Un_GL000220v1:158461-158483 GGGGTGCCGCGCGCGGGTCGGGG + Intergenic
1185504034 X:619176-619198 GGGGAGGGGGCCCCGGGGCGAGG - Intergenic
1186466246 X:9786366-9786388 AGGGGGCGGGGCCGGGGCCGGGG - Intergenic
1187281457 X:17860972-17860994 GGGGCCCGGCGCCCGGGGAGGGG - Intronic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1190058183 X:47194156-47194178 GGGGAGCGGATCCTGGGGCGGGG + Intronic
1190300338 X:49053660-49053682 GGGGAGCGCCGGCCCGGCCGCGG - Intronic
1190878162 X:54474495-54474517 GGGGAGGGGCGCTCGGCCTGGGG - Intronic
1195923219 X:110002789-110002811 GGGGCGCGGCGGCCGGTCCCCGG + Intronic
1200057605 X:153469912-153469934 GGGGAGGAGCGAGCGGGCCGAGG + Intronic
1200091424 X:153637864-153637886 GCGGAGGGGCGCCCTGGCCATGG + Intergenic
1202584706 Y:26410092-26410114 GTGGAGCGGAGCCCGGGGAGTGG + Intergenic