ID: 1038811018

View in Genome Browser
Species Human (GRCh38)
Location 8:30843710-30843732
Sequence GCAATTCAACTAATTGATCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038811017_1038811018 -6 Left 1038811017 8:30843693-30843715 CCTTTTTGTTTCTTCAAGCAATT 0: 1
1: 0
2: 4
3: 44
4: 648
Right 1038811018 8:30843710-30843732 GCAATTCAACTAATTGATCATGG 0: 1
1: 0
2: 1
3: 8
4: 128
1038811016_1038811018 -5 Left 1038811016 8:30843692-30843714 CCCTTTTTGTTTCTTCAAGCAAT 0: 1
1: 0
2: 9
3: 82
4: 768
Right 1038811018 8:30843710-30843732 GCAATTCAACTAATTGATCATGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038811018 Original CRISPR GCAATTCAACTAATTGATCA TGG Exonic
908558123 1:65278294-65278316 GCAATTCTAGTAAATGATCAGGG + Intronic
909315471 1:74212311-74212333 GCCATTCACCAAATTGCTCAAGG + Intronic
910076478 1:83285728-83285750 GTAATTCCTCTAATAGATCAGGG + Intergenic
911446753 1:98003828-98003850 GCAATTGATCTAATCTATCATGG - Intergenic
912926019 1:113913553-113913575 ACAATTTAAGTAATTGCTCAGGG - Exonic
913346955 1:117818885-117818907 GCCTTACAAGTAATTGATCAGGG - Intergenic
913677699 1:121157286-121157308 GCAATTGAACTAATTCACTAGGG - Intergenic
914029533 1:143944915-143944937 GCAATTGAACTAATTCACTAGGG - Intronic
914159916 1:145123035-145123057 GCAATTGAACTAATTCACTAGGG + Intergenic
915666672 1:157451380-157451402 GAAATTCAACTCATTAATTAGGG - Intergenic
918744253 1:188179986-188180008 TCAAGTGAACTAATTCATCAAGG - Intergenic
918791397 1:188834893-188834915 GTAATTTAAATAGTTGATCAAGG - Intergenic
919581259 1:199376667-199376689 GCAATTCATATATTTGATAATGG + Intergenic
920465004 1:206175796-206175818 GCAATTGAACTAATTCACTAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922343843 1:224679831-224679853 GCAATTCTACCAAATGTTCAGGG + Intronic
923100454 1:230810133-230810155 GCAAATGAAATAATAGATCATGG - Intergenic
924039219 1:239967072-239967094 GCCATTAAAATAATTCATCAGGG + Intergenic
1063074007 10:2696146-2696168 GCAATTGATCTCATGGATCAAGG - Intergenic
1072265907 10:93727689-93727711 GAAGTTCATCTTATTGATCAGGG + Intergenic
1073694387 10:105848953-105848975 CCAATTCAACTCATTCTTCAAGG - Intergenic
1074802737 10:117017789-117017811 GCAGTTTAACTAAGTGATCAAGG + Intronic
1075487189 10:122832597-122832619 TAAATTCAACTATTTGATAATGG - Intronic
1078162281 11:8851925-8851947 GAAATTCAACTAACTAATTAGGG + Intronic
1078702195 11:13697157-13697179 TGAATTAAAATAATTGATCATGG + Intronic
1078975762 11:16474359-16474381 GTAATTCTGCTAATTGATCTGGG - Intronic
1084643951 11:70443506-70443528 GCAAGTCAACGAACTGTTCATGG + Intergenic
1087256329 11:95958485-95958507 GCAATTATACTAGTTTATCAAGG - Intergenic
1088439594 11:109854862-109854884 GCAATTCATCTCATGGATCTGGG - Intergenic
1089161483 11:116440977-116440999 GCCTTTCAACTAATTGAACCAGG + Intergenic
1090536752 11:127650905-127650927 TCAATGCAATTGATTGATCAGGG - Intergenic
1093201641 12:16194207-16194229 GCAATTCAACAGATTATTCAGGG - Intronic
1094778984 12:33767864-33767886 GCAATTCATGTATTTGATAAAGG + Intergenic
1095797068 12:46231528-46231550 GAAATTCAATTACCTGATCATGG + Intronic
1101536498 12:105622749-105622771 GCAATGCAATTATTTCATCAAGG + Intergenic
1101597417 12:106179241-106179263 GCAACTCAACTAGCTGAGCATGG - Intergenic
1103105908 12:118224791-118224813 GCAATTCAACTTCTAGATTAGGG + Intronic
1106215409 13:27693430-27693452 GCAAAACAACTATTTGATAAAGG - Intergenic
1107066619 13:36220313-36220335 GTTATTTAACTAATTGATTAAGG - Intronic
1107349805 13:39501987-39502009 GCAGTACAACTAATTGTTCATGG + Intronic
1108147082 13:47489314-47489336 GCAATGCACCTATTTGTTCAGGG + Intergenic
1108273700 13:48787453-48787475 GAAATTCATCTATTTGATGAAGG - Intergenic
1108376325 13:49817528-49817550 GCATTTCAGCTAATAGATGAAGG - Intergenic
1109760692 13:66824797-66824819 TCAACTCAACAAAATGATCAAGG + Intronic
1110137972 13:72091596-72091618 TCAATTCTTCTAATTGTTCATGG + Intergenic
1110523360 13:76506540-76506562 GCAATTCAATCTCTTGATCAGGG + Intergenic
1112914112 13:104524417-104524439 GCAATTCAACTCATTAGACACGG + Intergenic
1114846230 14:26325920-26325942 GCATGTGAATTAATTGATCAGGG + Intergenic
1115383386 14:32766462-32766484 GCAATCCCACTAATGGATGAGGG + Intronic
1116439568 14:44936865-44936887 TCAATTCTACTAACTGATTATGG + Intronic
1124183970 15:27505296-27505318 GCACTTTAACCAAGTGATCAAGG - Intronic
1138130350 16:54474070-54474092 GGAATTCAACAAAATGGTCAAGG + Intergenic
1147491425 17:40870885-40870907 GAAATTAAACAAATGGATCATGG - Intergenic
1150696155 17:67407408-67407430 GCAAATCAAATATTTGATGAGGG - Intronic
1154044084 18:10887907-10887929 CCAATTCGACTAGGTGATCACGG - Intronic
1158569472 18:58584947-58584969 GGAATTCAATTAATTGTTCAGGG - Intronic
928151487 2:28833941-28833963 GCAAGTCATCTATTTGATAAGGG + Intronic
928568838 2:32582341-32582363 GCAACTCAACTAATATATCAGGG - Intronic
929413006 2:41718101-41718123 TCAATTCAACTGAGTAATCAAGG + Intergenic
930542702 2:52727342-52727364 GCTATTCAGCTAGTTAATCATGG + Intergenic
930575088 2:53136769-53136791 TCAGGTCAACTAATGGATCATGG + Intergenic
935467763 2:103419266-103419288 GCAAATCATCTATTTGATAAGGG - Intergenic
936166369 2:110123407-110123429 GCAAATCATCTAACTGATAAAGG - Exonic
937551872 2:123104112-123104134 GCAATTCAATGAATTGCTAAAGG + Intergenic
945526946 2:210899729-210899751 GCATTTCATCTAAGTCATCAAGG + Intergenic
1169612241 20:7394931-7394953 CCACTTCAACCAAATGATCAAGG - Intergenic
1176697244 21:9993486-9993508 GCAATTCAGATAATAGATCCTGG - Intergenic
1177645723 21:23898140-23898162 GCAATTCCCCTAATTTCTCAGGG + Intergenic
950978282 3:17273880-17273902 GAAATGCAACAAATTGTTCATGG + Intronic
951512928 3:23524582-23524604 ACAATACAACTCATGGATCATGG + Intronic
953807087 3:46079823-46079845 GCATGTGAACTAATTGATAAAGG - Intergenic
953889409 3:46740879-46740901 GCAGTTCTTCTAATTGATTAAGG - Intronic
956801190 3:72760169-72760191 GCAAGTCAACCAAAAGATCAAGG - Intronic
957898596 3:86456542-86456564 GCAATTTAAGAAATTCATCAAGG - Intergenic
960719752 3:120614177-120614199 AAAATTAAACTAATTGATAATGG + Intergenic
961961397 3:130858903-130858925 GCAATTCTACCCATTGGTCATGG - Intronic
962300849 3:134241616-134241638 TCAATTCAACAAATTGCTCAGGG + Intronic
963132422 3:141870868-141870890 GCTATTCAACTAATAGTTCCTGG - Intergenic
963465054 3:145668965-145668987 GCCATTCTACTAATCAATCAAGG - Intergenic
965378555 3:167958502-167958524 CCAACTGAACTAATTGATCCAGG + Intergenic
967856365 3:194120577-194120599 CCACTTCAACAAAGTGATCACGG + Intergenic
971006888 4:22384711-22384733 GGAATTAAACTAAATCATCAAGG - Intronic
971373211 4:26034783-26034805 GCAATTCAAGGAATGGATCTGGG + Intergenic
971512196 4:27440628-27440650 GCAATTAAATAAATTGCTCAAGG + Intergenic
974717737 4:65692320-65692342 GAAATTTAACTAATTTTTCATGG + Intergenic
974722010 4:65752471-65752493 GCCTTTCAACTAATTGATTCAGG - Intergenic
974722940 4:65765580-65765602 ATACTTCAACTACTTGATCATGG + Intergenic
975965235 4:79965013-79965035 GAACTTCAATTACTTGATCAAGG + Intronic
976747320 4:88416402-88416424 GCAATTCATATTATTGATAAAGG - Intronic
977807250 4:101315733-101315755 GCAATTCCACAAAGTCATCAAGG + Intronic
979625616 4:122841813-122841835 GCAACTCAACTAATTTTTCTTGG + Intronic
980369848 4:131853678-131853700 GCAATTCAGATAATAGATCCTGG - Intergenic
980540866 4:134193059-134193081 GCAAATCAACATATTGATGAGGG - Intergenic
982834485 4:160107096-160107118 GCATAGCAACTAATTGTTCACGG + Intergenic
983713532 4:170749523-170749545 GGAATTCGACTAAATGAGCAAGG - Intergenic
983901027 4:173134433-173134455 GCAATTAAACTAATTCATCAGGG + Intergenic
984027998 4:174568610-174568632 GGAATTCAACTAACTGGTAAAGG + Intergenic
993421255 5:87703522-87703544 GGAATTAAAGTAATGGATCAAGG + Intergenic
994956973 5:106545101-106545123 GGAATTCAACTAATTGCCCAAGG - Intergenic
996133057 5:119805595-119805617 GCAATTCAAAGAATTGTTAATGG - Intergenic
1004129874 6:12909482-12909504 GTAATTACACTAATTGAACATGG + Intronic
1010997734 6:82552209-82552231 CCAACTGAACTAAGTGATCATGG + Intergenic
1011986162 6:93449041-93449063 ACAATTCTCCTAATTCATCATGG + Intergenic
1014207748 6:118674571-118674593 GCAAATCAAATAACTGATAAGGG + Intronic
1014337393 6:120154388-120154410 GCAATTCAGCTAAATTCTCAGGG + Intergenic
1020383585 7:7572169-7572191 GCAATTAAGATAATTGATCATGG + Intronic
1021165555 7:17336156-17336178 GCAATACAAATATTTGATAAAGG - Intronic
1022306456 7:29151090-29151112 GCACTTCAATAAGTTGATCAGGG - Intronic
1022531458 7:31069563-31069585 ATAATTCAACTAACAGATCAGGG - Intronic
1023877834 7:44298623-44298645 GCAATTCACCTATCTGATGACGG + Intronic
1027294256 7:76751024-76751046 GTAATTCCTCTAATAGATCAGGG + Intergenic
1028845925 7:95479989-95480011 GCAATTCAAGTTTTTGTTCAAGG + Intronic
1030619210 7:111771080-111771102 TCAATGCAAATAAATGATCATGG + Intronic
1032065208 7:128763560-128763582 GAAATTCAAATAGTTTATCATGG + Intronic
1036069248 8:5421824-5421846 GCAATTAAACTACTTTCTCAGGG - Intergenic
1037591643 8:20317219-20317241 TCAATTCAAATATTTGTTCAAGG + Intergenic
1038811018 8:30843710-30843732 GCAATTCAACTAATTGATCATGG + Exonic
1040662548 8:49592798-49592820 GCAATTCAAGTATATGATAAAGG - Intergenic
1043232298 8:77818341-77818363 GGCATTCAACTAATTGGACAAGG + Intergenic
1044651767 8:94503307-94503329 GCACTTCAGCCAAGTGATCAAGG + Intronic
1045424765 8:102054483-102054505 GGAGTTCAACTAATTGGACAAGG - Intronic
1046159311 8:110339362-110339384 GCAATGCAACTAATTTCTCTAGG - Intergenic
1046451569 8:114398482-114398504 GGAATAAAGCTAATTGATCATGG + Intergenic
1050803359 9:9643126-9643148 GCAATTTAACTACTTCCTCAGGG + Intronic
1051735581 9:20195583-20195605 GCAATACATATAATTGATAAAGG - Intergenic
1052265262 9:26564592-26564614 GCAGTTCCACAAAGTGATCAGGG + Intergenic
1053634235 9:39979333-39979355 GCAATTCAGATAATAGATCCTGG - Intergenic
1053771514 9:41484163-41484185 GCAATTCAGATAATAGATCCTGG + Intergenic
1054209652 9:62271364-62271386 GCAATTCAGATAATAGATCCTGG + Intergenic
1060099145 9:120822877-120822899 GCAGTGCAACTGAGTGATCAAGG + Intronic
1186853556 X:13604121-13604143 CCAAATCAACTACTTGCTCAGGG - Intronic
1190150182 X:47939638-47939660 CCAATTCAACTACTTTTTCATGG - Intronic
1192029919 X:67499106-67499128 TCAATTCAACCGAGTGATCAAGG - Intergenic
1195784033 X:108497586-108497608 ACATTTCAACTAATTGCTAAAGG - Intronic
1197373612 X:125655417-125655439 GTAATGCAAATAATTAATCATGG + Intergenic
1199949504 X:152696600-152696622 CCAATTCTACCAAATGATCAGGG + Intergenic
1199954324 X:152731459-152731481 CCAATTCTACCAAATGATCAGGG + Intronic
1199960172 X:152771849-152771871 CCAATTCTACCAAATGATCAGGG - Intergenic