ID: 1038812424

View in Genome Browser
Species Human (GRCh38)
Location 8:30863016-30863038
Sequence GTGTAACTATTTTGGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038812417_1038812424 16 Left 1038812417 8:30862977-30862999 CCCCACCTAGACAATAACTGCAC 0: 1
1: 3
2: 16
3: 48
4: 177
Right 1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG No data
1038812421_1038812424 11 Left 1038812421 8:30862982-30863004 CCTAGACAATAACTGCACTGGCA 0: 3
1: 6
2: 26
3: 50
4: 188
Right 1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG No data
1038812416_1038812424 30 Left 1038812416 8:30862963-30862985 CCAGACATCTGTCTCCCCACCTA 0: 1
1: 3
2: 24
3: 70
4: 362
Right 1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG No data
1038812418_1038812424 15 Left 1038812418 8:30862978-30863000 CCCACCTAGACAATAACTGCACT 0: 1
1: 2
2: 27
3: 46
4: 179
Right 1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG No data
1038812419_1038812424 14 Left 1038812419 8:30862979-30863001 CCACCTAGACAATAACTGCACTG 0: 3
1: 2
2: 21
3: 40
4: 190
Right 1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038812424 Original CRISPR GTGTAACTATTTTGGATCTC TGG Intronic
No off target data available for this crispr