ID: 1038828469

View in Genome Browser
Species Human (GRCh38)
Location 8:31032905-31032927
Sequence CTCCCCCGGCGCCGCAGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 222}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038828460_1038828469 -5 Left 1038828460 8:31032887-31032909 CCCCCACGCCGGGCCCGGCTCCC 0: 1
1: 0
2: 17
3: 90
4: 928
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828463_1038828469 -8 Left 1038828463 8:31032890-31032912 CCACGCCGGGCCCGGCTCCCCCG 0: 1
1: 0
2: 5
3: 76
4: 654
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828455_1038828469 5 Left 1038828455 8:31032877-31032899 CCGCCCGCGACCCCCACGCCGGG 0: 1
1: 1
2: 4
3: 32
4: 342
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828461_1038828469 -6 Left 1038828461 8:31032888-31032910 CCCCACGCCGGGCCCGGCTCCCC 0: 1
1: 0
2: 2
3: 57
4: 543
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828450_1038828469 13 Left 1038828450 8:31032869-31032891 CCCCGCCGCCGCCCGCGACCCCC 0: 1
1: 0
2: 13
3: 159
4: 1290
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828445_1038828469 29 Left 1038828445 8:31032853-31032875 CCCCTCGGCCTGACCGCCCCGCC 0: 1
1: 0
2: 1
3: 33
4: 405
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828462_1038828469 -7 Left 1038828462 8:31032889-31032911 CCCACGCCGGGCCCGGCTCCCCC 0: 1
1: 0
2: 4
3: 47
4: 783
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828451_1038828469 12 Left 1038828451 8:31032870-31032892 CCCGCCGCCGCCCGCGACCCCCA 0: 1
1: 0
2: 5
3: 62
4: 626
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828448_1038828469 21 Left 1038828448 8:31032861-31032883 CCTGACCGCCCCGCCGCCGCCCG 0: 1
1: 0
2: 6
3: 93
4: 791
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828452_1038828469 11 Left 1038828452 8:31032871-31032893 CCGCCGCCGCCCGCGACCCCCAC 0: 1
1: 0
2: 14
3: 135
4: 968
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828449_1038828469 16 Left 1038828449 8:31032866-31032888 CCGCCCCGCCGCCGCCCGCGACC 0: 1
1: 0
2: 20
3: 192
4: 1205
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828453_1038828469 8 Left 1038828453 8:31032874-31032896 CCGCCGCCCGCGACCCCCACGCC 0: 1
1: 0
2: 8
3: 98
4: 951
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828457_1038828469 2 Left 1038828457 8:31032880-31032902 CCCGCGACCCCCACGCCGGGCCC 0: 1
1: 0
2: 9
3: 38
4: 458
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828446_1038828469 28 Left 1038828446 8:31032854-31032876 CCCTCGGCCTGACCGCCCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828458_1038828469 1 Left 1038828458 8:31032881-31032903 CCGCGACCCCCACGCCGGGCCCG 0: 2
1: 0
2: 1
3: 47
4: 469
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1038828447_1038828469 27 Left 1038828447 8:31032855-31032877 CCTCGGCCTGACCGCCCCGCCGC 0: 1
1: 0
2: 6
3: 38
4: 415
Right 1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG 0: 1
1: 0
2: 0
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038828469 Original CRISPR CTCCCCCGGCGCCGCAGCGC GGG Exonic
900531859 1:3157834-3157856 CTCCCCCAGCACCGCCGGGCTGG + Intronic
900786892 1:4655129-4655151 CTCCGCCGGCGGCACAGCGAAGG - Exonic
901279848 1:8025914-8025936 CCTCCCCGGCGGCGCAGCCCGGG - Intronic
902169601 1:14599158-14599180 GTCCCCCGCCGCCGAGGCGCTGG - Exonic
902823551 1:18957276-18957298 CACCCCCGGGTCCGCAGCGTGGG - Intergenic
903187179 1:21635284-21635306 CTCCCCAGCCTCCGCAGCCCAGG + Intronic
903233870 1:21937346-21937368 CCGCCCCGCCCCCGCAGCGCCGG + Intergenic
903628207 1:24745932-24745954 CTGCCCCGGGGCCCCAGCGCCGG + Intronic
903639407 1:24848330-24848352 CTCCCCCGGCGGGGCAGGGCAGG + Intergenic
904304905 1:29582256-29582278 CTCCCCCTGCGCTGCACCACTGG + Intergenic
907513712 1:54980538-54980560 CTCCTCGGGCCCCGCCGCGCTGG + Intergenic
909782232 1:79561561-79561583 CGCCCCCTGCTCTGCAGCGCTGG - Intergenic
911468449 1:98284921-98284943 CTCCCCCAGCCCCCCAGCCCCGG + Intergenic
913163917 1:116168274-116168296 CTCCCCAGGTGCCCCAGCGAGGG - Intergenic
914069778 1:144276705-144276727 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
914109377 1:144689649-144689671 CGCCCCCCGCGCCTCCGCGCTGG - Intergenic
918001660 1:180502670-180502692 CTTCCCCGCCGGCGCAGAGCAGG - Exonic
918283013 1:183023741-183023763 CGCCCCCGGGGCCGCAGGGCCGG - Exonic
919419723 1:197355427-197355449 CACCCCCTGCTCCGCGGCGCCGG - Intronic
919820421 1:201468836-201468858 CCCTCTCGGCCCCGCAGCGCAGG + Exonic
921325341 1:213982820-213982842 CTCCCGGCGCGCCGCAGAGCCGG - Intergenic
921355496 1:214281202-214281224 CTCGCCGGGAGCCGCAGCTCGGG + Intronic
922196486 1:223364218-223364240 CTCCCCAGGCGCCCCCGAGCGGG + Intergenic
922526705 1:226309413-226309435 CTCCCCCCGCGCTCCGGCGCCGG - Exonic
922705176 1:227786894-227786916 CTCCCCCAGCGCCAGAGGGCCGG - Intergenic
924527237 1:244863612-244863634 CTCACCCGCCGCCGGAGCCCCGG + Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1065101594 10:22336535-22336557 CTGCCGCGGCGCGGCCGCGCCGG - Intergenic
1068554909 10:58448297-58448319 CGCCCCCTGCTCCGCAGCGCCGG - Intergenic
1068989129 10:63133288-63133310 CTCCTCCGGCGCCGCGCCGCGGG - Exonic
1069934243 10:71904495-71904517 CTCCCCAGGCTCCCCAGCCCTGG + Intergenic
1070326940 10:75395736-75395758 ACCCCCGGGCGCCCCAGCGCCGG + Intergenic
1070948018 10:80408908-80408930 CTAGCCCGCCGCAGCAGCGCCGG - Intronic
1071695295 10:87863517-87863539 CGCCCCCTCCGCCGCCGCGCCGG - Exonic
1072680045 10:97499422-97499444 CTCCCCCGGCCGCCCGGCGCTGG - Intronic
1073136724 10:101224496-101224518 CCCCGCGGGCGCCGCAGCTCGGG + Intergenic
1076142629 10:128091810-128091832 CTACCCCGGCCCCCCAGCCCAGG - Intergenic
1076667317 10:132100583-132100605 CACCCCCAGGGCCGGAGCGCAGG + Intergenic
1076741176 10:132486463-132486485 CTCCCCCGGCGGCGGATCGCTGG - Intergenic
1078180271 11:9004661-9004683 CTCCCCCGGCTCGGAAACGCGGG - Intergenic
1078246221 11:9574540-9574562 CCCCTCCGGCGCCGCGGCCCCGG - Intronic
1081938139 11:46918596-46918618 CGCCCCCCGCGCCGCAGCCCCGG + Exonic
1082004093 11:47410197-47410219 GTCCCCCGGCTCCGGAGGGCCGG - Exonic
1083329825 11:61892110-61892132 CGCCCTCGGCGCTGCAGGGCTGG + Intergenic
1083607151 11:63985963-63985985 CTCCGCGGGCGCCCCGGCGCTGG + Intronic
1083807528 11:65083999-65084021 CTCCTCCAGCGCCGCCGCCCCGG + Exonic
1083997120 11:66278162-66278184 CGCCCCCGGCTCCGCCCCGCCGG + Intergenic
1084331634 11:68433780-68433802 CTGCCTCGCCGTCGCAGCGCAGG - Exonic
1085096040 11:73761218-73761240 CTGCCCCGTCGCCGCCGTGCGGG - Intergenic
1090788526 11:130070175-130070197 GACCCCCGGCGCCGCACCGCCGG - Intronic
1091973725 12:4809403-4809425 CTGCCCCGGCGCCCGAGCGCGGG - Exonic
1092861588 12:12724323-12724345 CTCCCCAGGCGCCGGCGAGCCGG - Intergenic
1094025688 12:25958485-25958507 CTCTCCCGGCGCCGGCGAGCGGG + Intergenic
1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG + Intronic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1096558814 12:52421601-52421623 CTCCCCTGGAGCCCCAGGGCAGG + Intergenic
1096870296 12:54588511-54588533 CTTCCCTCCCGCCGCAGCGCGGG - Exonic
1102101587 12:110282034-110282056 CTCCCGCGGGGCCGGCGCGCTGG - Intronic
1102519044 12:113467765-113467787 CCCTCCCTGCGCCGAAGCGCGGG - Intronic
1103698654 12:122835955-122835977 GTCCCCCGCCGCCTCAGCTCCGG - Intronic
1103901161 12:124304230-124304252 CTCCCGCGGAGCTGCAGGGCTGG - Intronic
1106242830 13:27924262-27924284 CTCCTCCGGCTCCGCAGCGTAGG - Exonic
1106956334 13:34942688-34942710 CGGGCCCGGCGCCGCGGCGCTGG + Exonic
1106956337 13:34942693-34942715 ATCCACCAGCGCCGCGGCGCCGG - Exonic
1107604032 13:42040814-42040836 CCCCGCCGCCGCCGCTGCGCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1110705940 13:78602179-78602201 CTCCCCCGGGGCCGCCGCCCGGG + Exonic
1112502870 13:99955961-99955983 TTCCCCACACGCCGCAGCGCCGG - Intergenic
1113494062 13:110714029-110714051 CTCTCCCGGCGCCCCCCCGCCGG - Intronic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1114612492 14:24051978-24052000 CTCCCCCCGCCTCGGAGCGCCGG - Exonic
1119821020 14:77616415-77616437 CCACCCCGGCCCCGCCGCGCGGG + Intronic
1122081808 14:99272045-99272067 CTCCCCTGGCGCCGCGGGCCCGG + Intergenic
1123041091 14:105490509-105490531 CTGCCCGGGCGCCGCTGAGCCGG - Intronic
1123500803 15:20878790-20878812 CTCCTGCGGCGCCGCAGCCTGGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124629233 15:31327530-31327552 CTCCCCCGGCGCCGAAGGCGCGG + Exonic
1126163510 15:45634916-45634938 CCCGCCCGGCGCCGCAGCCCAGG - Exonic
1126706067 15:51406297-51406319 CCTTCCCGGGGCCGCAGCGCTGG - Exonic
1127763624 15:62164582-62164604 CTCCGCCGCCGCCGCAGCTGTGG + Exonic
1128068139 15:64776576-64776598 CTCCCCCCGCACCCCCGCGCAGG + Intergenic
1128547667 15:68578950-68578972 CTCCCCCCGCCCCCCAGCCCGGG + Exonic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1132480837 16:165410-165432 CTCCACCCGGGCCGCAGCTCCGG - Intronic
1132717561 16:1299514-1299536 CTCCCCCAGCTCCGCACAGCAGG + Intergenic
1132828936 16:1918284-1918306 CGCCCCCGGCCCCGCCGCCCAGG + Exonic
1134645008 16:15858505-15858527 CTCCCCCGACGCCGGGGAGCAGG - Intergenic
1138560505 16:57798182-57798204 CTCCACAGGCCCCGCAGCGAGGG + Exonic
1138591242 16:58000695-58000717 CTCCCCCGGCCCCGCCTCCCTGG - Intronic
1139465224 16:67150705-67150727 CTCCCCCGCGGCCTCAGCTCCGG + Intronic
1141553206 16:84819859-84819881 CGCCCCCGGCCCCGCCCCGCAGG - Intergenic
1142188596 16:88706577-88706599 CGCCCCCGGCGCCGCGGCCCAGG + Exonic
1143586500 17:7853285-7853307 TGTGCCCGGCGCCGCAGCGCAGG + Exonic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144760334 17:17703531-17703553 CTCCCCCTGAGCCCCAGAGCCGG - Intronic
1147161817 17:38572933-38572955 CTCCCTCGGCGCGGCCCCGCCGG + Intronic
1147168701 17:38606045-38606067 CTCCCCCGCCCCCGCCGCCCCGG - Intergenic
1147987531 17:44315094-44315116 CTCCCCCCGCGCGTCTGCGCTGG - Intronic
1151131033 17:71896105-71896127 ATCCCCCGGGGCCGCACAGCAGG + Intergenic
1151559157 17:74861535-74861557 CTCCGCGGGCGCCGGAGCCCGGG + Intergenic
1151939745 17:77285151-77285173 CTCCCCCAGCCCCTCAGCACTGG + Intronic
1152596333 17:81239467-81239489 CTCCTCCTGCCCCGCAGCACTGG - Intronic
1152625694 17:81387030-81387052 CTCCCTCCGCGCCCCAGCTCCGG - Intergenic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1157498129 18:48170920-48170942 CTCCCCCTGCCCCACAGGGCAGG + Intronic
1159040792 18:63320851-63320873 TTCCCCCGGCGGCCGAGCGCCGG - Intergenic
1160540478 18:79617675-79617697 CTCGCCCGGGGCCGCAGCATGGG + Intergenic
1160732517 19:647742-647764 CTCCCCCAGCGCTGAAGCACGGG - Exonic
1160865520 19:1254303-1254325 GTCCCCCCGCGCAGCAGCGGCGG - Exonic
1160910345 19:1471076-1471098 CTCGCCCGCCGCGGCTGCGCCGG - Exonic
1162959478 19:14117574-14117596 CACCCGCCGCGCCGCAGCTCCGG - Exonic
1162987147 19:14277935-14277957 CGCCCCCTGCTCCGCGGCGCCGG + Intergenic
1163592739 19:18203674-18203696 CTCCCCCTCCGCCGCAGAGCAGG + Intronic
1164639312 19:29812510-29812532 CTCACCCCGCGCCGCCCCGCAGG + Exonic
1166869819 19:45864410-45864432 TTCCCCCGGGGCCGGAGCGGGGG + Exonic
1167042742 19:47032285-47032307 CCGCCGCGGCCCCGCAGCGCTGG + Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1168175240 19:54623850-54623872 TTCCCCCGGCCCCGCAGGGAGGG + Intronic
1168332629 19:55579061-55579083 CTCCCGGGGCTCCGCGGCGCTGG + Exonic
1168538582 19:57191886-57191908 CACCCCCTGGGCCGCAGAGCTGG - Exonic
1168702881 19:58451985-58452007 CTCCCCCGCCCCCCCGGCGCGGG - Intronic
926140784 2:10366710-10366732 CTGCCCCGGCTCCCCAGCCCCGG + Intronic
927168763 2:20350941-20350963 CTCCCGCGCTGCCGCCGCGCGGG + Intronic
927472660 2:23386760-23386782 CTCGCCTGGGGCCGGAGCGCGGG + Intronic
927713666 2:25340449-25340471 CTCCCCCAGCCCCTCATCGCTGG - Intronic
931291935 2:60881364-60881386 CGCCCCCGGCGCTGCTGCGGCGG - Intergenic
933049967 2:77590802-77590824 CTCCCCCTGCTCCACAGCGCTGG + Intronic
934180088 2:89612062-89612084 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
934290379 2:91686322-91686344 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
934993151 2:98935760-98935782 CACCCCCGCCGCCGAAGCCCTGG - Intronic
938274488 2:130005990-130006012 CTCCCGGGGCGAGGCAGCGCAGG - Intergenic
938407361 2:131039941-131039963 CGCGCCCTGCGCCGCAGCGGCGG - Intronic
938440883 2:131331285-131331307 CTCCCGGGGCGAGGCAGCGCAGG + Intronic
940974368 2:159926886-159926908 CTCCACCGGGGACGCAGTGCTGG - Intergenic
942368587 2:175256949-175256971 CTCGCCTGCCGCCCCAGCGCGGG - Intergenic
944433206 2:199659322-199659344 CCCCCGCGGCGCCCAAGCGCGGG + Intergenic
948933620 2:241148971-241148993 CGCCCCCGACCCCGCGGCGCCGG + Intronic
1168760647 20:347591-347613 CTCCCCCGCCCGGGCAGCGCTGG + Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171977432 20:31604454-31604476 CTCCCACGGCGCGGCAGCTGCGG - Intergenic
1172775894 20:37406697-37406719 CTGACCCGCCGCGGCAGCGCGGG - Intergenic
1174092348 20:48059172-48059194 CACCCCCGGCTCCACGGCGCTGG + Intergenic
1175399667 20:58693135-58693157 CACCCCCGCCGCCGCCGGGCCGG + Intronic
1175841422 20:62030070-62030092 CTCGCCTGGCCTCGCAGCGCTGG - Intronic
1176418919 21:6499016-6499038 CTCCCCCGCCACCGCCGCGCCGG + Intergenic
1176566765 21:8392109-8392131 CCCCGCCGGCGGCGCGGCGCAGG - Intergenic
1179225059 21:39445747-39445769 CTGCGCCAACGCCGCAGCGCCGG + Intronic
1179694412 21:43107338-43107360 CTCCCCCGCCACCGCCGCGCCGG + Intronic
1179718782 21:43303794-43303816 CTCCCCCAGCCCCGCAGCATGGG + Intergenic
1179882639 21:44299979-44300001 CGCCCCCGGCGCCTCCTCGCAGG - Intergenic
1180945401 22:19689608-19689630 CTCCCCCAGGGCCCCAGCTCAGG - Intergenic
1180949323 22:19714223-19714245 CCTCCCCGGTGCCGCAGCCCAGG - Intergenic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
949507117 3:4738594-4738616 CTCCCCAGGAGCCTCAGTGCTGG - Intronic
949896006 3:8768119-8768141 GGCCCCCGGCGGCGCGGCGCTGG + Exonic
952377805 3:32781580-32781602 TCCGCCCGGCGCCGCCGCGCCGG - Intergenic
954427664 3:50451908-50451930 CTCACCCGAGGCCTCAGCGCTGG + Intronic
954839063 3:53495296-53495318 CTCCCCCTTCCCCGCGGCGCTGG + Intronic
955327490 3:58020505-58020527 CTCCCCAGCCGTCGCAGGGCTGG + Intronic
956080132 3:65549054-65549076 CTGCCCTGGCGCCGCAGCCAAGG + Intronic
956979025 3:74614800-74614822 CGCCCCCAGCGCCTCTGCGCCGG + Intergenic
961222724 3:125212764-125212786 CTGCCCCGGCTCGGCTGCGCGGG + Intronic
963236724 3:142963614-142963636 CGCCGCCGCTGCCGCAGCGCGGG - Exonic
963511129 3:146250886-146250908 CGCCCTCGGCCCCGCAGCCCGGG + Intronic
966108161 3:176362256-176362278 CGCCCCCTGCTCCGCGGCGCCGG - Intergenic
968505136 4:968000-968022 CTCCCTCTGCTCCGCGGCGCTGG - Exonic
969115010 4:4865968-4865990 CCCTCCCTGCGCCGCAGCCCGGG + Intergenic
970651121 4:18179093-18179115 CTCCCCCAGCCCCCCAGCCCCGG - Intergenic
973236719 4:47914098-47914120 CTCCTCCGGCGCCGCGGAGATGG + Exonic
973636963 4:52869582-52869604 CTCACCAGGCGCCGCAGATCCGG + Intergenic
981550555 4:145937583-145937605 CTCCCGCGGCGCCGAGGCGAGGG - Intronic
982288803 4:153759967-153759989 CTCCGCCGCCGCCGCAGATCCGG - Exonic
985537598 5:473652-473674 CGCCCCAGGCCCTGCAGCGCGGG + Intronic
985713907 5:1445410-1445432 CCCCTCCCGCTCCGCAGCGCTGG + Exonic
992105539 5:73447291-73447313 CGGCCCGGGCGCCTCAGCGCTGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
992105838 5:73448414-73448436 CTCCCTCTGCGCCCCAGCCCGGG + Intergenic
994043579 5:95284546-95284568 CTCGCCCGCCGCGGCAGCCCGGG + Exonic
997583980 5:135034037-135034059 CCCGCCCGGCGCCGCAGCCCCGG - Exonic
999326936 5:150649594-150649616 CTCCTCCGCCGCCGCGGGGCTGG - Exonic
1002523975 5:179805818-179805840 ATCCCCCCGCGCCGCCCCGCTGG - Intronic
1003038351 6:2664481-2664503 CTCCCCCAGCCACGCAGCACGGG - Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004614889 6:17280833-17280855 CTCCCCGCGCGGCGCGGCGCTGG - Intergenic
1006212265 6:32406370-32406392 CTGCCTCGGTGCCGCAGAGCTGG - Intronic
1006212269 6:32406398-32406420 CTGCCTCGGCACCGCAGAGCTGG - Intronic
1007038855 6:38702923-38702945 CTCCCCCAGCTCCGCTGGGCCGG - Intronic
1007368905 6:41413447-41413469 CTCCCCCGGCGCCCAAGGGAGGG - Intergenic
1014724881 6:124962354-124962376 CTCCCCACGCGCCGCAGCCTCGG + Intergenic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017446332 6:154510270-154510292 CTCCCCTGGCGGAGCCGCGCTGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019119064 6:169789179-169789201 CTGCCCAGGCTCCGCAGAGCAGG - Intergenic
1019256671 7:56843-56865 CTCCTCAGGCTCAGCAGCGCCGG + Intergenic
1019474334 7:1236725-1236747 CTCCCCGGGGGCCCCAGCCCCGG + Exonic
1019589513 7:1823793-1823815 CTCCCCCGGCCCAGCAGCTGCGG - Intronic
1019593246 7:1846232-1846254 CGCCCCCGGCGCTGCAGTCCTGG + Intronic
1019676169 7:2314083-2314105 CTCTCCCGGCGCAGGAGGGCAGG + Intronic
1020010649 7:4804092-4804114 CTCCCCCAGCCCGGCAGAGCTGG + Intronic
1020657051 7:10940478-10940500 CTCCCGCGGCGCCTGAGAGCCGG + Intergenic
1021101161 7:16586808-16586830 CTCCCGCGGGGCCCCAGCCCCGG - Intergenic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1022100104 7:27164463-27164485 CTCCCCCAGCGTCCCAGCTCCGG + Intronic
1029206052 7:98869938-98869960 CTCCTCCGGGCGCGCAGCGCGGG + Intronic
1029540667 7:101180300-101180322 CTCCCCCGGCGACGCTCCGGCGG + Intergenic
1030059870 7:105613812-105613834 CTCCCCCTGCCCCCCAGAGCCGG + Intronic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1032525689 7:132577054-132577076 CTCCCGCGGCCCCCCAGCCCCGG - Exonic
1034440539 7:151083519-151083541 CTTCCCCGCCGCCGCGGCCCGGG + Intronic
1034976688 7:155453384-155453406 CTCCCCTGGCGCTGGAGAGCCGG + Intergenic
1035102772 7:156415240-156415262 CTCCTCCGGCACCCCAGAGCTGG + Intergenic
1035159861 7:156942811-156942833 CTCCCCCGGGGTTGCACCGCTGG - Intergenic
1035171112 7:157017990-157018012 GGCCCCCGGAGCCGCAGCCCGGG + Intergenic
1035387013 7:158479846-158479868 CGCCCACTGCGCCGCAGAGCTGG - Intronic
1036642645 8:10593721-10593743 CTCCCCCGACGCCTGAGCTCTGG + Intergenic
1036910929 8:12755895-12755917 CTCCCCCGACGCCCCCGCCCAGG + Intronic
1037065077 8:14567166-14567188 CGCCCCCTGCTCCACAGCGCCGG + Intronic
1037985517 8:23288434-23288456 CTCCCGCGACCCCGCAACGCCGG - Intronic
1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG + Exonic
1039864744 8:41490816-41490838 TTCCCCCGACCCCGCAGCGCGGG + Exonic
1041746297 8:61212209-61212231 CTCCCCAGACGCTGCAGCCCTGG - Intronic
1043482600 8:80668397-80668419 CTCCCCAGGCGCCTCAGCCTGGG - Intronic
1043847286 8:85177524-85177546 CGCCCCCGCCGCCGCAGCTCGGG + Exonic
1047124830 8:121948490-121948512 CTCCACCTGCGCCCCAGTGCGGG + Intergenic
1048223855 8:132566427-132566449 CTCCCCCAACCCCGCAGAGCAGG - Intergenic
1049396521 8:142403454-142403476 CTCCCGAAGCGCCTCAGCGCCGG - Intergenic
1049466194 8:142752261-142752283 CACCCCCGGCCCCACAGCTCTGG + Intronic
1049552518 8:143267153-143267175 CTCCCCGGGCGGTGCAGGGCCGG + Intronic
1049776720 8:144409384-144409406 CTCACGCGGCGGCGCTGCGCAGG - Intergenic
1051206374 9:14693313-14693335 CTCCTCCGGCGCCGCCGCCCAGG + Exonic
1051265811 9:15307327-15307349 CTCCCCGGACGCCGCGCCGCTGG + Exonic
1052971778 9:34381135-34381157 CTCCCGCGGGTCCCCAGCGCAGG + Intronic
1057208135 9:93185211-93185233 CGCCCCCGCGCCCGCAGCGCTGG + Exonic
1057313374 9:93954982-93955004 CTCGCCCGCCGCGGCAGCGGCGG + Exonic
1057432360 9:95005378-95005400 CTCGCCGGGCGCCTCACCGCAGG - Intronic
1059176734 9:112175148-112175170 CTCCCGCGGCGCCGCGGGCCAGG + Exonic
1060821754 9:126665304-126665326 CGCCCCCGCCGCCCCAGCCCTGG - Intronic
1062162637 9:135088392-135088414 CTCCCCCGGCCCCGCGGCGAGGG - Intronic
1062537627 9:137027886-137027908 CTCCCCGGAGGCCGCAGCGCCGG + Exonic
1203771578 EBV:52458-52480 CTCACCCGCCACCGCATCGCCGG - Intergenic
1189988431 X:46573827-46573849 CTCTCCCGGCCCCTCTGCGCCGG - Exonic
1190062255 X:47219047-47219069 CGCCCCAGGCGCCGCCGCGCCGG + Intronic
1190693883 X:52935240-52935262 CTCCCCGGGCTCCGACGCGCAGG - Intronic
1190952569 X:55161259-55161281 CTCCCCGGGCTCCGATGCGCAGG - Intronic
1191841901 X:65519239-65519261 CTCCCACGGCTCCTCAGCACAGG - Intronic
1191859784 X:65656852-65656874 CTCCCACGGCTCCTCAGCACAGG - Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic