ID: 1038833470

View in Genome Browser
Species Human (GRCh38)
Location 8:31090856-31090878
Sequence CTACATAAACAGGTGGATAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038833470_1038833476 19 Left 1038833470 8:31090856-31090878 CCAGTATCCACCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1038833476 8:31090898-31090920 CTCTCCCCTTATTTCTCTGATGG 0: 1
1: 0
2: 6
3: 55
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038833470 Original CRISPR CTACATAAACAGGTGGATAC TGG (reversed) Exonic
902282597 1:15385217-15385239 CTGCCTAAACAGATGTATACAGG - Intronic
903984062 1:27212243-27212265 CTGCATATATACGTGGATACTGG + Intergenic
904303682 1:29573102-29573124 CCAGATAAAGAAGTGGATACTGG + Intergenic
908162437 1:61423728-61423750 CTACAGAAACAATTGGATAAGGG - Intronic
908424758 1:63995940-63995962 ATACAAAAAGATGTGGATACAGG + Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
919037109 1:192327182-192327204 CTTAATAAAGAGGTGGATATGGG + Intronic
923222088 1:231904550-231904572 CTAAATACACAGATAGATACAGG + Intronic
924359761 1:243226519-243226541 ACACATAAACAGGTGGAAAAGGG + Intronic
1068419400 10:56770734-56770756 CAACATAAAAACCTGGATACAGG + Intergenic
1068762069 10:60723495-60723517 ACTCATAAACAGGTGGACACTGG + Intronic
1074173496 10:110970690-110970712 CAACAAAAACAGATAGATACTGG - Intronic
1075371770 10:121942937-121942959 CCACATACACAGGGGGATGCTGG - Intergenic
1076124823 10:127965802-127965824 CTCCAGAAAGAGGTGGAGACTGG - Intronic
1080964961 11:37203509-37203531 ATACATAAACATATGTATACAGG + Intergenic
1081178625 11:39959493-39959515 CTACAGAAACAGCTGGTAACTGG - Intergenic
1083274682 11:61590081-61590103 GTGCATTAACAGGTGGATTCAGG + Intergenic
1085168580 11:74427527-74427549 CTACATAAGAATGTGCATACAGG - Intergenic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1088377192 11:109154246-109154268 GTACAAAAACAGGTGGAGACTGG + Intergenic
1090650450 11:128801546-128801568 ATACATAAATAGGTGGATTGTGG + Intronic
1090879495 11:130821120-130821142 CTGCAGAAACAGGAGGAAACAGG + Intergenic
1096603420 12:52746848-52746870 CTACATATGCAGTTGGATCCAGG - Intergenic
1105581507 13:21701262-21701284 CTATATAAGCACGTGGACACTGG + Exonic
1109791602 13:67255618-67255640 CCACATATAGGGGTGGATACTGG - Intergenic
1109896608 13:68699965-68699987 TTTCATAAACAGCTGGATATGGG + Intergenic
1110089444 13:71426432-71426454 CCAAATAAACAGGTGGAAAGCGG + Intergenic
1111976728 13:94974100-94974122 CTACAGATGCAGCTGGATACAGG - Intergenic
1115204757 14:30890327-30890349 CTACAAAAGCAGTTTGATACAGG - Exonic
1115829035 14:37313808-37313830 CTATATGAAAAGGTGCATACAGG + Intronic
1119783484 14:77295330-77295352 CAACTTAAAGAGGAGGATACAGG + Intronic
1120471055 14:84925058-84925080 ATACATAAACAGATTGCTACAGG - Intergenic
1121362717 14:93276588-93276610 CTACAAAACCAAGTGAATACTGG + Intronic
1122841951 14:104469780-104469802 CTGCATGAACATGTAGATACGGG + Intergenic
1125917773 15:43504707-43504729 CTGAATAAAAAGGTTGATACAGG + Intronic
1127149618 15:56060093-56060115 AGAGATAAACAGGTGGGTACAGG + Intergenic
1131060889 15:89404007-89404029 CTAAATAAACAGTTTGATAGTGG - Intergenic
1133561471 16:6954585-6954607 CTACATAATGAGGAGGATATAGG - Intronic
1140274059 16:73493095-73493117 TTACAGAGAGAGGTGGATACGGG - Intergenic
1143335974 17:6171738-6171760 CAACATCAACTGGTGGAGACGGG - Intergenic
1144196090 17:12896584-12896606 CTACATAAACAGCTACATCCAGG - Intronic
1147027977 17:37605500-37605522 ATACATAAACAGATGTATAAAGG + Intronic
1151047602 17:70940026-70940048 TTACAAAAACAGGTGGTTGCAGG + Intergenic
1154078483 18:11229986-11230008 GAACATAAACAGGTGAATACCGG - Intergenic
1156318492 18:35994529-35994551 CTTCATAAGCAGGTGGATATCGG + Intronic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1166973917 19:46592148-46592170 CTTTATAAAAAGGTGGATGCTGG - Intronic
929864996 2:45710185-45710207 CTACATCATCAGGTTGTTACAGG - Intronic
931459156 2:62435150-62435172 CACCAGATACAGGTGGATACAGG - Intergenic
935005616 2:99073370-99073392 CTCCAAAAACAGGTGGTTATAGG - Intronic
936330720 2:111545920-111545942 CCACATAAACAGGTAGTCACGGG + Intergenic
938389204 2:130891934-130891956 TTACAGAAACAGGTGGCAACTGG + Intronic
939062403 2:137438568-137438590 TTACAAAAACAGGTGGAGGCTGG + Intronic
942693263 2:178609960-178609982 CTACATCTACAGGTGGATCAGGG + Exonic
944293666 2:198036970-198036992 TTAAATCAACAGGTGGACACTGG + Intronic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1170997822 20:21381350-21381372 CTACATAAACTGACGGATATAGG - Intronic
1181031923 22:20152449-20152471 CTACATCAAGAGGCGGGTACTGG + Intergenic
1184325780 22:43783224-43783246 CTACCTGAATAGGTGGATAACGG + Intronic
949124399 3:429319-429341 CTACATAAGCACTTGGATAAGGG - Intergenic
949872333 3:8599370-8599392 GGACATCAACAGGTGGACACAGG - Intergenic
951269022 3:20602853-20602875 TTAAATAATCAGGTGGAGACAGG + Intergenic
951808611 3:26675158-26675180 CTATATAAGCAGGTAGATACAGG + Intronic
952251636 3:31662027-31662049 CTACAAAAACAGGGCTATACTGG + Exonic
954403230 3:50330404-50330426 CTACACCCACAGGTGGACACAGG + Exonic
955769633 3:62374319-62374341 CTCCTTAAACAGGTGGAGATGGG - Intronic
956721916 3:72125459-72125481 CTACATAAACAGGTGGGATTTGG + Intergenic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
976028907 4:80726853-80726875 TTATATAATCAGTTGGATACAGG + Intronic
976251747 4:83059437-83059459 CTACATAAACAGGAGCTTTCCGG - Intronic
976661830 4:87547724-87547746 TTACAAAAACAGGTGGTTAGAGG - Intergenic
976893917 4:90084456-90084478 CTACAAAAGCAGGTGGCTTCTGG - Intergenic
977052815 4:92150962-92150984 GTAAATAAACAGGATGATACTGG + Intergenic
978297002 4:107217142-107217164 CTACATAATTAAGTGGATAATGG - Intronic
980619548 4:135281459-135281481 CTCCACAAACATGTGTATACAGG + Intergenic
981978190 4:150758121-150758143 CTGCATATACAGGTGTCTACTGG - Intronic
984864573 4:184270699-184270721 ATAGATAGACAGGTGGATAGAGG - Intergenic
989294303 5:39806156-39806178 CCACAAAGACAGGTGGTTACTGG + Intergenic
990205846 5:53428683-53428705 CTACATAAATGGATGGATAGAGG + Intergenic
993165351 5:84346909-84346931 CTTCAAACACAGGTGGATCCAGG - Intronic
998565865 5:143215233-143215255 CTACATTGACAGGTGAATCCAGG + Intronic
999589484 5:153129344-153129366 CTACTTACACAGCTGGATACTGG - Intergenic
1000870504 5:166571190-166571212 CTACATAAATAGGAGCACACAGG - Intergenic
1002943024 6:1734297-1734319 CTACATGAACAGCTGTATAATGG - Intronic
1003556789 6:7147004-7147026 CTCCAAAAACAGCTGGAGACTGG - Intronic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1010551818 6:77232625-77232647 CTACATAAACAGCAGGTAACAGG - Intergenic
1013187170 6:107769772-107769794 CTCCATACACAGCTGGACACTGG - Intronic
1015297079 6:131608107-131608129 CTACTTAAAGAGATGAATACAGG + Intronic
1017568189 6:155710986-155711008 CCACATAAGCAGGTGTAAACAGG - Intergenic
1029067963 7:97871768-97871790 CTACAGAGACAGGTGGGGACTGG + Exonic
1031916079 7:127564244-127564266 CTACATAAACAGAGGGCTAGAGG + Intergenic
1033643468 7:143284307-143284329 CTACATAACCAGGTAAATGCTGG + Intronic
1034054600 7:148021440-148021462 CTACATAAATAGGGAGACACGGG + Intronic
1036577073 8:10037598-10037620 CTAAATAAACAGGTAGGAACGGG + Intergenic
1038833470 8:31090856-31090878 CTACATAAACAGGTGGATACTGG - Exonic
1041745084 8:61199793-61199815 CTACATAAAAAGGTGGAAAGTGG - Intronic
1042968078 8:74377794-74377816 CTGCACAAACATGTGGATATTGG - Intronic
1048711160 8:137212384-137212406 CTACATAAACAGGTTGTAAGTGG + Intergenic
1050422579 9:5482195-5482217 CTCCATAAACAGATATATACAGG - Intergenic
1051008725 9:12382962-12382984 CTCCTTAAATAGGTGGATAAAGG + Intergenic
1185567257 X:1104507-1104529 ATACATAGATAGGTAGATACAGG + Intergenic
1185681898 X:1895453-1895475 CTACACACACAGGTGCATGCAGG + Intergenic
1186670457 X:11762231-11762253 CTACATTAACAGGAGGAAACGGG + Exonic
1186737855 X:12485063-12485085 ATACTTAAACAAGTGGACACTGG + Intronic
1187899442 X:24013607-24013629 CTACATACACAAATGCATACTGG + Intronic
1188403207 X:29773357-29773379 CTACAGAAATATGTGGGTACAGG - Intronic
1188585187 X:31765684-31765706 ATACATAAAAGTGTGGATACAGG + Intronic
1190867615 X:54397880-54397902 CCACATAAAGAAGTAGATACAGG - Intergenic
1192729031 X:73783765-73783787 CTACACAAAATGGTGGAAACTGG - Intergenic
1193899782 X:87163101-87163123 CTGAATAAATAGGTGGATCCAGG - Intergenic
1198187623 X:134269298-134269320 CTACATACAAAGGTGTACACTGG + Intergenic
1198500504 X:137240620-137240642 CTACAAAAACAAGTGGAGAAAGG + Intergenic
1201693421 Y:16795150-16795172 ATACATAAACAGGTGACTTCAGG + Intergenic