ID: 1038840526

View in Genome Browser
Species Human (GRCh38)
Location 8:31180668-31180690
Sequence TCTTGGCCCCCAAAGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038840524_1038840526 -4 Left 1038840524 8:31180649-31180671 CCTAGAGTATGTTAGATCTTCTT No data
Right 1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG No data
1038840521_1038840526 23 Left 1038840521 8:31180622-31180644 CCTCAAGGGAACTTTTGGTCCTG No data
Right 1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG No data
1038840523_1038840526 4 Left 1038840523 8:31180641-31180663 CCTGGTTTCCTAGAGTATGTTAG No data
Right 1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038840526 Original CRISPR TCTTGGCCCCCAAAGAATCA AGG Intergenic
No off target data available for this crispr