ID: 1038843867

View in Genome Browser
Species Human (GRCh38)
Location 8:31211044-31211066
Sequence CTGAATGTACAAATAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038843863_1038843867 30 Left 1038843863 8:31210991-31211013 CCTCTCATTTGTAAAATGAGAAC No data
Right 1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038843867 Original CRISPR CTGAATGTACAAATAGACAA TGG Intergenic
No off target data available for this crispr