ID: 1038843867 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:31211044-31211066 |
| Sequence | CTGAATGTACAAATAGACAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1038843863_1038843867 | 30 | Left | 1038843863 | 8:31210991-31211013 | CCTCTCATTTGTAAAATGAGAAC | No data | ||
| Right | 1038843867 | 8:31211044-31211066 | CTGAATGTACAAATAGACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1038843867 | Original CRISPR | CTGAATGTACAAATAGACAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||