ID: 1038845204

View in Genome Browser
Species Human (GRCh38)
Location 8:31222613-31222635
Sequence CATTTTATGAAGAAATTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038845198_1038845204 26 Left 1038845198 8:31222564-31222586 CCCAAAGAACTTAAAATACTTTA No data
Right 1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG No data
1038845199_1038845204 25 Left 1038845199 8:31222565-31222587 CCAAAGAACTTAAAATACTTTAT No data
Right 1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG No data
1038845197_1038845204 27 Left 1038845197 8:31222563-31222585 CCCCAAAGAACTTAAAATACTTT No data
Right 1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038845204 Original CRISPR CATTTTATGAAGAAATTGGG GGG Intergenic
No off target data available for this crispr