ID: 1038851277

View in Genome Browser
Species Human (GRCh38)
Location 8:31279442-31279464
Sequence GTTCTCAGAGGTGCACAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038851277_1038851281 10 Left 1038851277 8:31279442-31279464 CCTGATTGTGCACCTCTGAGAAC No data
Right 1038851281 8:31279475-31279497 GCTGGGTCATAAAGTTCAAATGG No data
1038851277_1038851282 13 Left 1038851277 8:31279442-31279464 CCTGATTGTGCACCTCTGAGAAC No data
Right 1038851282 8:31279478-31279500 GGGTCATAAAGTTCAAATGGCGG No data
1038851277_1038851279 -8 Left 1038851277 8:31279442-31279464 CCTGATTGTGCACCTCTGAGAAC No data
Right 1038851279 8:31279457-31279479 CTGAGAACTGCTGACTTTGCTGG No data
1038851277_1038851280 -7 Left 1038851277 8:31279442-31279464 CCTGATTGTGCACCTCTGAGAAC No data
Right 1038851280 8:31279458-31279480 TGAGAACTGCTGACTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038851277 Original CRISPR GTTCTCAGAGGTGCACAATC AGG (reversed) Intergenic
No off target data available for this crispr