ID: 1038851724

View in Genome Browser
Species Human (GRCh38)
Location 8:31285158-31285180
Sequence CTGTACTTCTTGACATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038851724_1038851725 -10 Left 1038851724 8:31285158-31285180 CCTTCTTATGTCAAGAAGTACAG No data
Right 1038851725 8:31285171-31285193 AGAAGTACAGCTTGCTATTGTGG No data
1038851724_1038851729 23 Left 1038851724 8:31285158-31285180 CCTTCTTATGTCAAGAAGTACAG No data
Right 1038851729 8:31285204-31285226 ACAGTATTGAGGTGTTTTAATGG No data
1038851724_1038851726 -9 Left 1038851724 8:31285158-31285180 CCTTCTTATGTCAAGAAGTACAG No data
Right 1038851726 8:31285172-31285194 GAAGTACAGCTTGCTATTGTGGG No data
1038851724_1038851727 12 Left 1038851724 8:31285158-31285180 CCTTCTTATGTCAAGAAGTACAG No data
Right 1038851727 8:31285193-31285215 GGATACCTCTAACAGTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038851724 Original CRISPR CTGTACTTCTTGACATAAGA AGG (reversed) Intergenic
No off target data available for this crispr