ID: 1038853997

View in Genome Browser
Species Human (GRCh38)
Location 8:31311156-31311178
Sequence GAATAGCTCTGCCATACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038853997_1038853998 -8 Left 1038853997 8:31311156-31311178 CCTGATGTATGGCAGAGCTATTC No data
Right 1038853998 8:31311171-31311193 AGCTATTCAATAAATGCTGCTGG No data
1038853997_1038854000 8 Left 1038853997 8:31311156-31311178 CCTGATGTATGGCAGAGCTATTC No data
Right 1038854000 8:31311187-31311209 CTGCTGGGAGACTTAACTGTAGG No data
1038853997_1038854001 23 Left 1038853997 8:31311156-31311178 CCTGATGTATGGCAGAGCTATTC No data
Right 1038854001 8:31311202-31311224 ACTGTAGGAAAAAAGCAATGAGG No data
1038853997_1038853999 -7 Left 1038853997 8:31311156-31311178 CCTGATGTATGGCAGAGCTATTC No data
Right 1038853999 8:31311172-31311194 GCTATTCAATAAATGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038853997 Original CRISPR GAATAGCTCTGCCATACATC AGG (reversed) Intergenic
No off target data available for this crispr