ID: 1038854001

View in Genome Browser
Species Human (GRCh38)
Location 8:31311202-31311224
Sequence ACTGTAGGAAAAAAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038853997_1038854001 23 Left 1038853997 8:31311156-31311178 CCTGATGTATGGCAGAGCTATTC No data
Right 1038854001 8:31311202-31311224 ACTGTAGGAAAAAAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038854001 Original CRISPR ACTGTAGGAAAAAAGCAATG AGG Intergenic
No off target data available for this crispr