ID: 1038855001

View in Genome Browser
Species Human (GRCh38)
Location 8:31321321-31321343
Sequence CAGTGGCCTTCACTGGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038854998_1038855001 -10 Left 1038854998 8:31321308-31321330 CCACGTGGGATCTCAGTGGCCTT No data
Right 1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG No data
1038854996_1038855001 -2 Left 1038854996 8:31321300-31321322 CCAAGAGACCACGTGGGATCTCA No data
Right 1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG No data
1038854995_1038855001 -1 Left 1038854995 8:31321299-31321321 CCCAAGAGACCACGTGGGATCTC No data
Right 1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038855001 Original CRISPR CAGTGGCCTTCACTGGGTTG TGG Intergenic
No off target data available for this crispr