ID: 1038856985

View in Genome Browser
Species Human (GRCh38)
Location 8:31344684-31344706
Sequence GGAAAACAACATCCTGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038856981_1038856985 14 Left 1038856981 8:31344647-31344669 CCGAACTCTTCTTCTGTTCTTAT No data
Right 1038856985 8:31344684-31344706 GGAAAACAACATCCTGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038856985 Original CRISPR GGAAAACAACATCCTGGTCA TGG Intergenic
No off target data available for this crispr