ID: 1038865128

View in Genome Browser
Species Human (GRCh38)
Location 8:31431233-31431255
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 4, 1: 24, 2: 90, 3: 185, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038865128_1038865134 21 Left 1038865128 8:31431233-31431255 CCTGCTCCTTGGCTGTAAATCCC 0: 4
1: 24
2: 90
3: 185
4: 362
Right 1038865134 8:31431277-31431299 TTGAGCCCAGTTCTATAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038865128 Original CRISPR GGGATTTACAGCCAAGGAGC AGG (reversed) Intergenic
900462254 1:2807301-2807323 GGGGTTCACAGCCCAGGAGCAGG + Intergenic
900688259 1:3963159-3963181 AAGATTTACAGCTAAGGAGCAGG + Intergenic
900783617 1:4633830-4633852 GAGATTCACAGCCCAGGAGCAGG + Intergenic
900804043 1:4755788-4755810 GGAATTTGCAGCCAAGGGGTAGG + Intronic
900843025 1:5071020-5071042 GGGATTCATAGCCAAGGAGCAGG - Intergenic
900913648 1:5619594-5619616 AGGATTTATAGCCAAAGAGCAGG + Intergenic
901221094 1:7584271-7584293 GGGATTTATCAGCAAGGAGCAGG + Intronic
901381010 1:8874265-8874287 GTGGTTTTAAGCCAAGGAGCTGG + Intronic
902047364 1:13535780-13535802 AGCATTTACAGCCAAAGAGTTGG - Intergenic
902665018 1:17931394-17931416 AGGAATTACAGCCATGGAGGCGG - Intergenic
902687566 1:18088644-18088666 TGAATTTTTAGCCAAGGAGCAGG + Intergenic
902982986 1:20138928-20138950 GGAATTCATAGCCAAGGAGCAGG - Intergenic
903517957 1:23925090-23925112 GAAATTTATAGCCAAGGAGCAGG - Intergenic
905640787 1:39588399-39588421 GGAATTTACTGCCAAGGAGCAGG - Intergenic
906273926 1:44501961-44501983 GGGAGCTACAGCCACGCAGCAGG + Intronic
906665078 1:47615746-47615768 GGGAATTATAGCCAAGGAGCAGG + Intergenic
907688560 1:56638439-56638461 GAGATTTATAGCCAAGGAGGAGG - Intronic
908019534 1:59886004-59886026 GGTATTTATAGCCAAGAAGCTGG - Intergenic
908233231 1:62126267-62126289 GTGATTCCCAGTCAAGGAGCTGG - Intronic
908588149 1:65597191-65597213 GGAATTTATAGCCAAGAAGGAGG - Intronic
909207435 1:72777090-72777112 GGGATTTACAGCTAAGGAGCAGG - Intergenic
909212591 1:72843379-72843401 GGGCTTTACAGACAAGAACCTGG - Intergenic
909561579 1:77014374-77014396 GTGATTTACAGACAATTAGCAGG + Intronic
909611056 1:77552243-77552265 GGAATTTATAGTCAAAGAGCAGG - Intronic
910365895 1:86465267-86465289 GGAATTTATAACCAAGGAGAAGG + Intergenic
910439974 1:87241993-87242015 GGGGTTTACAACCATGGAGTAGG + Intergenic
910719681 1:90272387-90272409 GGGATTTATAGCCAAGGAGAAGG - Intergenic
911271647 1:95808799-95808821 GGGATTTATAGCCAAGAAGCAGG - Intergenic
911560057 1:99393980-99394002 GAATTTTACAGCTAAGGAGCAGG - Intergenic
911722173 1:101203223-101203245 AGGAAACACAGCCAAGGAGCTGG - Intergenic
911763191 1:101640426-101640448 GTTATTTATAGCCAAGGAGAAGG + Intergenic
911936766 1:103986398-103986420 GGAATTTATTGCCAAGGAGGAGG + Intergenic
912223079 1:107699834-107699856 GAGATTTATAGCCAAGGAGGAGG + Intronic
912486577 1:110033912-110033934 GGGATTTATAACCAAAGAGCAGG - Intronic
912692603 1:111815645-111815667 CGAATTTATAGCCAAGGAGCAGG - Intronic
913188177 1:116389291-116389313 AGCATGTACAGCCAAAGAGCTGG + Intronic
915040432 1:152963728-152963750 AGAATCTATAGCCAAGGAGCAGG - Intergenic
916980952 1:170136357-170136379 GGAATTTATAGCTAAGAAGCAGG + Intergenic
917277365 1:173345463-173345485 GAGATTTACAGCCAAAAATCAGG + Intergenic
918903946 1:190465658-190465680 AGAATTTCTAGCCAAGGAGCAGG - Intronic
918983099 1:191588882-191588904 GCGACTTATAGCCAAGAAGCAGG + Intergenic
919239389 1:194891996-194892018 GGGTTTTGCAGCCAAGGAGATGG + Intergenic
919750918 1:201037621-201037643 GGGATTTTCAGGCAGGGAGCGGG + Intergenic
920286268 1:204882034-204882056 GGAATTTATAGCCAAGAAGCAGG - Intronic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
922369558 1:224895820-224895842 GAAATTTAAAGCCAAGGAGCAGG + Intergenic
922625502 1:227037098-227037120 GGGACTTAAAGCCAGGTAGCTGG + Intronic
924505832 1:244683007-244683029 GGAATTTGCAGCCAGGGAGCAGG + Intronic
924669095 1:246104997-246105019 GGAATTTATAGCCAAAGAGGAGG + Intronic
924803580 1:247345381-247345403 GAAATTTATAGCCAAGGAGCAGG - Intergenic
1063151935 10:3345032-3345054 GACATTTACAGCCACGGAGCAGG - Intergenic
1063166058 10:3463557-3463579 AGAATTTACAGCCTTGGAGCAGG + Intergenic
1063256097 10:4329064-4329086 GGAATTCACAGCCAAGGAGCAGG + Intergenic
1063323429 10:5073809-5073831 GGGATTTACAACCACAGAACAGG - Intronic
1063849184 10:10164725-10164747 GGAATTTACAGCCAAGGAGCAGG + Intergenic
1064232217 10:13538982-13539004 GAGAATTACAGACATGGAGCTGG - Intergenic
1064326413 10:14355408-14355430 GATATTTCCAGCCAAGGAACAGG - Intronic
1064392545 10:14954199-14954221 GTGATTTAAACCCAAGCAGCGGG - Intronic
1064443330 10:15371944-15371966 GGGATTTATAACCGAGGACCAGG + Intergenic
1065067205 10:21982074-21982096 GAGATTTATAGCCAAGGAACAGG - Intronic
1066182361 10:32975581-32975603 GGGTGTTGCAGCCAAGGAGATGG - Intronic
1067045368 10:42982260-42982282 GGGTTTTAGACCCAAGTAGCAGG - Intergenic
1067249985 10:44578043-44578065 GGGACTGACAGCCAAGGAGCAGG + Intergenic
1067522065 10:47015176-47015198 AGGATTTATAGCCAAGGTGCAGG + Intergenic
1067708587 10:48629341-48629363 GGGATTGACACCCATGGAGAGGG - Intronic
1068140797 10:53004605-53004627 GGAATTTATAGCCAAGAAACAGG + Intergenic
1068243874 10:54339920-54339942 GGACTTTATAACCAAGGAGCAGG - Intronic
1068602871 10:58974218-58974240 AAGATTTATAGCCAAAGAGCAGG + Intergenic
1068719179 10:60223300-60223322 GGAATTTATAGCCAAGGAGTAGG - Intronic
1068887488 10:62112365-62112387 GAGATTTATAGCCAAGGGGCAGG + Intergenic
1069373377 10:67769760-67769782 GGCATTTCCAGCCATGGAGCAGG + Intergenic
1070572602 10:77651261-77651283 GGGCTTTAAAGCCAAGGATGAGG + Intergenic
1070728641 10:78809428-78809450 GAGATTTGCAGCCAATCAGCTGG + Intergenic
1071334765 10:84591471-84591493 CAGATTTAAAGTCAAGGAGCAGG - Intergenic
1071424985 10:85540378-85540400 GGAATTTATAGCCAGAGAGCAGG + Intergenic
1071586709 10:86830076-86830098 GGAATTTGTAGCCAAGGAGCTGG + Intronic
1071651152 10:87394249-87394271 GGGAATTATAGTCAAGGAGGAGG - Intergenic
1071847960 10:89539043-89539065 GGAATTTATAGCCAAGAAACAGG - Intronic
1071930803 10:90467417-90467439 GGGATTCGTAGCCCAGGAGCAGG - Intergenic
1072486211 10:95858320-95858342 GGGATTGAAAGCCAGGGTGCTGG + Intronic
1073531633 10:104237862-104237884 GGAATTTATAGCCAAGGAGCAGG - Intronic
1073981294 10:109156674-109156696 AGGATTTACAGTCAAGGAGCAGG - Intergenic
1074047438 10:109851519-109851541 GCAATTTATAGCCAAGGAGCAGG - Intergenic
1075292973 10:121246109-121246131 GGGCTTTACAGCCTGGGAGATGG + Intergenic
1075575599 10:123575276-123575298 GTGATTTACAGCCAAGGATCTGG + Intergenic
1075976813 10:126703241-126703263 GGGCTTGACAGACAAGAAGCAGG + Intergenic
1076047116 10:127303166-127303188 GGGATTTATAGCCAACAACCTGG + Intronic
1077226183 11:1440031-1440053 GGGCTGTACAGCCAAGGGGGTGG - Intronic
1078708295 11:13766054-13766076 GGAATTTATAGCCAAGGAGCAGG + Intergenic
1078865792 11:15296135-15296157 GTGATTAACAGCCAGGGATCAGG + Intergenic
1079154280 11:17930007-17930029 GGGATTTATAGCCAAGCTACAGG + Intronic
1079789013 11:24712458-24712480 AGGATTTGCAGCTAAGGAACAGG + Intronic
1081385327 11:42465374-42465396 GGGATTCACATTCAGGGAGCTGG - Intergenic
1084148097 11:67275595-67275617 GGGCTTCACAGCCAAGGAGTGGG - Intronic
1084661158 11:70547129-70547151 GGGATTTAGGGCCCAGGAGTGGG - Intronic
1084900246 11:72304404-72304426 GGGATTTGAACCCAAGCAGCTGG + Intronic
1086077566 11:82870753-82870775 GATATTTACAACCCAGGAGCAGG + Intronic
1086191534 11:84084902-84084924 GGGATTTACAGCCAAGGAGCAGG - Intronic
1086836544 11:91631323-91631345 GAGATTTATAACCAAGGAGTAGG + Intergenic
1086989944 11:93291890-93291912 AAGATTTATAGCCAAGGAGCAGG + Intergenic
1087403835 11:97703530-97703552 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1087642294 11:100768259-100768281 GGAATTTATTGCCAAGGAGCAGG + Intronic
1088145423 11:106670976-106670998 GGGATTTATAGCCAACAAGCAGG - Intergenic
1088552370 11:111025963-111025985 GAGACTTAGAGCCAAGGAACAGG - Intergenic
1088634505 11:111806910-111806932 GGGATTTTGATCCAAGGAACTGG - Intronic
1088842104 11:113635790-113635812 GGGATTTATAGCCAATGACAGGG - Intergenic
1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG + Intronic
1090017078 11:123095680-123095702 GGAGTTTACAACCAAGGAGCAGG + Intronic
1090305312 11:125686339-125686361 GGGTGTTACAGTCAAGGAGCAGG - Intergenic
1090517631 11:127446036-127446058 GGAATTTAAAACCAAGGAGCAGG + Intergenic
1090576098 11:128105623-128105645 GGAATGTATAGCCAAGGAACAGG + Intergenic
1091149909 11:133318513-133318535 GGAATTTATAGCCCAGGAACAGG - Intronic
1091885899 12:4016873-4016895 GCAATGTATAGCCAAGGAGCAGG + Intergenic
1091922927 12:4320463-4320485 GAGATTTATAGCCAGGGGGCGGG + Intergenic
1092173129 12:6385477-6385499 GGAATTTTAAGCCAAGGATCTGG - Intronic
1092861663 12:12724528-12724550 GGGCTTCACAGGCGAGGAGCGGG + Intergenic
1093625238 12:21338501-21338523 GAGATTTTTAGCCAAGCAGCAGG - Intronic
1093738954 12:22658651-22658673 GGAATGTATACCCAAGGAGCAGG + Intronic
1094177143 12:27552804-27552826 GGCATTTATAGCCAAGGAGCAGG + Intronic
1094364531 12:29665961-29665983 GGAATTTATAGCCAGTGAGCAGG - Intronic
1095541231 12:43310849-43310871 GAGACTTATAGCCAAGGAGCAGG - Intergenic
1096345471 12:50842635-50842657 AGAATTTACAGCCACGGAGCAGG + Intergenic
1097387218 12:58963820-58963842 GGACTTTATAGCCAAGGAGCAGG - Intergenic
1097443034 12:59634450-59634472 AGAATTCATAGCCAAGGAGCAGG + Intronic
1098290663 12:68954578-68954600 GGGAGTTAAAGCCAAGGGGCTGG - Intronic
1098307854 12:69119229-69119251 GGTATTTAAAGCCAAGGACCTGG - Intergenic
1098572641 12:72006364-72006386 AGAATTTATAGCCAAGGAACAGG + Intronic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1098908064 12:76181546-76181568 GGGATTTATAGCCACGGAGCAGG + Intergenic
1099513640 12:83569115-83569137 AGGATTTATAACCAAGGAACAGG + Intergenic
1100763719 12:97839196-97839218 GGAATTTATAGCCAAGGAGCAGG + Intergenic
1100989223 12:100234304-100234326 GGAATTTATAGCCAAGAAGCAGG + Intronic
1101920625 12:108929691-108929713 GGGATTTATAGCCAGGGAGCAGG - Intronic
1102637521 12:114337030-114337052 GGAATTTATAGCCAAGAAGCAGG - Intergenic
1102677913 12:114671071-114671093 GGGATTTAAAGGGAAGGAGTGGG - Exonic
1105587557 13:21759023-21759045 GGGATTCATAGCTAAGGAGCAGG + Intergenic
1105770957 13:23611322-23611344 GGGATATATAGCCAAGGAGCAGG + Intronic
1105815462 13:24032236-24032258 GGAATTTATAGCCAAGGAGCAGG - Intronic
1106332709 13:28754220-28754242 GGAATGTATAGCCAAGGAGCAGG - Intergenic
1106467082 13:30023083-30023105 CGGATGCATAGCCAAGGAGCAGG - Intergenic
1106825850 13:33519519-33519541 GGAATTTATAGCCAAGGAGGAGG - Intergenic
1106942603 13:34794595-34794617 GGAATTTATAGCCAAGAAGCAGG - Intergenic
1107963394 13:45578299-45578321 AGAATTTATACCCAAGGAGCAGG - Intronic
1108283593 13:48883576-48883598 GGGATTTATAGCCAAGGACAAGG - Intergenic
1108383265 13:49874588-49874610 GGGTGCTACAGCCAAGGAGATGG - Intergenic
1108481191 13:50873879-50873901 GGAATTTATAGCCAAGCAGCAGG + Intergenic
1108524423 13:51273913-51273935 GTGTTTTACAGCCAATGGGCAGG + Intronic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1109342998 13:61085762-61085784 GGGATTTTTAGTCAAGGAGTAGG + Intergenic
1109501266 13:63238760-63238782 GAGTGCTACAGCCAAGGAGCTGG - Intergenic
1109935789 13:69282661-69282683 GGAATTTATAGTCAAGGAGCAGG + Intergenic
1110959810 13:81607455-81607477 GGAATTTATAGCCAAGGGGAGGG - Intergenic
1111025790 13:82521025-82521047 GGAATTTAGAGCCAATGAGCAGG - Intergenic
1111192598 13:84830333-84830355 GGGATTTATAGCCAAGGACCAGG + Intergenic
1111427219 13:88102778-88102800 GGGATTTATAGCCAAGGAGAAGG + Intergenic
1111647255 13:91046667-91046689 GGGATTTATAGTCAAGAACCAGG - Intergenic
1112027612 13:95426122-95426144 AGAATTTATAGCCAAGGAGAGGG + Intergenic
1112278665 13:98044041-98044063 GGAAGTTACAGCCCAGGAGCAGG + Intergenic
1112414778 13:99195178-99195200 GGGATTTATAATCAAGGAGCAGG - Intergenic
1112769416 13:102779812-102779834 GGCATTTATAGCCAAGGAGCAGG + Intergenic
1113699965 13:112377094-112377116 GAGATTTGCAGCCAAGGATCAGG + Intronic
1114960920 14:27888155-27888177 TAGATTTAAAGCCAAGGATCAGG + Intergenic
1115168004 14:30471279-30471301 GGGATTCATAGCTAAGGAACAGG - Intergenic
1115821655 14:37219078-37219100 GGACTTTACAGCTAAGGAGCAGG + Intronic
1116132850 14:40880982-40881004 GGGATTTATAGTCAAGGAAGTGG + Intergenic
1116201396 14:41802261-41802283 GGGATTTATAGCCGAGGAACAGG + Intronic
1116425318 14:44783469-44783491 GGAATTTACAGCCAAGGAGTAGG + Intergenic
1117015740 14:51515174-51515196 GGTATTTAGAACCAAGAAGCAGG - Intronic
1117650833 14:57903228-57903250 GGAATTTGTAGCCAAGGAACAGG + Intronic
1117889380 14:60401883-60401905 GGAACTTACAGCCTAGTAGCAGG + Intronic
1118065928 14:62190069-62190091 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1118523212 14:66610766-66610788 GGAATTTATAGCCAATGAGAAGG + Intronic
1118866256 14:69706049-69706071 TGGATTTACAGACAAGGACCAGG + Intronic
1119506691 14:75179143-75179165 GGGATTTACAGCCAAAAATCAGG + Intergenic
1119813576 14:77544942-77544964 AGGATTTACAGCCAAGGAACAGG - Intronic
1120647891 14:87095123-87095145 GGCATTTAGAGCCATGAAGCTGG + Intergenic
1120737948 14:88076491-88076513 GGATTTCACAGCCAAGCAGCTGG + Intergenic
1120853035 14:89187863-89187885 GGCAAGTACAGTCAAGGAGCAGG - Intronic
1121263256 14:92581850-92581872 GGGGGTTATAGCCAAGGAGCAGG + Intronic
1121909558 14:97776645-97776667 AGAATTTATGGCCAAGGAGCAGG - Intergenic
1122717235 14:103703010-103703032 GGGGTTTACGCCCGAGGAGCAGG - Intronic
1123077686 14:105677346-105677368 GGGATTGACAGCCAGGGAGCTGG - Intergenic
1123180759 14:106468064-106468086 GGGATTTAAAGCCAAGCAGCAGG + Intergenic
1202946139 14_KI270726v1_random:28594-28616 GGGATTTAAAGCCAAGCAGCAGG - Intergenic
1123901961 15:24886328-24886350 GCAATTTATAGCCAAGGAACAGG - Intronic
1124910372 15:33914676-33914698 GGGATATACAAACATGGAGCAGG + Intronic
1125333534 15:38605206-38605228 GAAATTTATAGCCAAGGAGCAGG - Intergenic
1125602579 15:40923604-40923626 GGTATTTCCAGCCACGGAGCAGG - Intergenic
1126209313 15:46081680-46081702 AGGATTTATAGCCAAGAAGCTGG - Intergenic
1126335549 15:47583104-47583126 GGGATGTACATCCTAGGAGGAGG - Intronic
1126493718 15:49267186-49267208 GGAAGTTATAGCCAAGGAGCAGG + Intronic
1126901759 15:53321717-53321739 GGAATTTACGGCTAAGAAGCAGG - Intergenic
1127086057 15:55425420-55425442 GGGGTTTATAGCCAAGGAGTAGG - Intronic
1128480353 15:68032248-68032270 AGAATTTATAGCCAAGGAGCAGG - Intergenic
1129147209 15:73659440-73659462 GGAATTTATAACCAAGGAGCAGG - Intergenic
1129491018 15:75925810-75925832 GGGATTTATAGCCAAGGAGGAGG + Intronic
1129934050 15:79434552-79434574 GGGATTTAAAGGCCAGGAGAAGG + Intronic
1131162457 15:90116402-90116424 GGGATCTATAACCAAGGAGCGGG + Intergenic
1131233152 15:90674037-90674059 GGGATTGAGAGCCCAGGAGCAGG + Intergenic
1131508370 15:93035414-93035436 GGAATTGATGGCCAAGGAGCAGG + Intronic
1133260385 16:4545696-4545718 GAGATTGATAGCCAAGGAGTGGG - Intergenic
1133936024 16:10270069-10270091 GGGGTTTATAGCCAAAGGGCAGG - Intergenic
1134790449 16:16984780-16984802 GGGAATTACAGCCATTCAGCAGG - Intergenic
1134880436 16:17741221-17741243 GCAATTTACAGGCAAGGAGTGGG - Intergenic
1136085047 16:27878868-27878890 GGGATTCACAGCCAAGGAGCAGG + Intronic
1137376056 16:47952831-47952853 GGGATTTACAGCCAAGCAGTAGG + Intergenic
1137534379 16:49306827-49306849 GGGATTTTCAGCATAGGAGAAGG - Intergenic
1137748609 16:50841820-50841842 GGGATTTACAGCCGAGCAGGAGG - Intergenic
1137814375 16:51384268-51384290 GGGATTTATAGCCAAGGAACAGG - Intergenic
1138761561 16:59550167-59550189 GAAATGTATAGCCAAGGAGCAGG + Intergenic
1138857755 16:60714946-60714968 AGAATTTATAGCAAAGGAGCAGG - Intergenic
1139556001 16:67710803-67710825 GGGATTGATAGTCAAGGAGCAGG - Intronic
1140156033 16:72427620-72427642 GGGATTTACAGCCCAGTTACGGG + Intergenic
1140213651 16:72990273-72990295 GGCATTTACAGGCCAGGACCTGG - Intronic
1140624146 16:76771350-76771372 GGGATTGGCAGCCAAGAAGCAGG - Intergenic
1141192214 16:81833075-81833097 GGGACTTACAGCCAAGGTGAGGG + Intronic
1141192330 16:81833725-81833747 GGAACTTACAGCCAAGGTGAGGG + Intronic
1144181888 17:12759863-12759885 GGGGTTTTCATCCCAGGAGCAGG - Intronic
1144253091 17:13439250-13439272 GGGGTTTATCGTCAAGGAGCAGG + Intergenic
1144344866 17:14340417-14340439 GGGGTTTAGAGCCAAGGAGCAGG - Intronic
1144566597 17:16364503-16364525 GGAATTTACAGCCAAGAAGCAGG + Intergenic
1144588245 17:16501989-16502011 GGAGTTTATAGCCAAGGAGCAGG - Intergenic
1144591658 17:16529163-16529185 GGAGTTTATAACCAAGGAGCAGG - Intergenic
1145815373 17:27791563-27791585 GGAATTTATAGCCAAGGATCAGG - Intronic
1146886420 17:36473929-36473951 GGGATTCAAAGCCAAGCAACAGG - Intergenic
1146935836 17:36812233-36812255 TGGATTTGAAGCCAAGGACCTGG - Intergenic
1147531958 17:41287679-41287701 AGAATTTACAGCCAAGGAGCAGG + Intergenic
1147590256 17:41678534-41678556 GGGATTTATAGCCAAGGAACAGG - Intergenic
1147871274 17:43589215-43589237 GAGATTTATAGCCAAGGAACAGG - Intergenic
1149310048 17:55384796-55384818 GAGATGTATAGACAAGGAGCAGG + Intergenic
1149514666 17:57271368-57271390 GGTATGAGCAGCCAAGGAGCGGG + Intronic
1149667596 17:58376612-58376634 GGAATTTTCAGCCAGGAAGCGGG + Intronic
1150152902 17:62825199-62825221 GGCATTTACAGCCATGGTCCCGG - Intergenic
1150922807 17:69501106-69501128 GGGATTTCCAGCCAAGTAACTGG - Intronic
1152145365 17:78565125-78565147 GGAATTTCTAGCAAAGGAGCAGG - Intronic
1152219728 17:79056610-79056632 GGGATTTATAGCCGGGGAGCAGG + Intergenic
1152258853 17:79255766-79255788 GGGAATTGCAGCCATGGAGGAGG - Intronic
1152408691 17:80111378-80111400 TGGATTTCTAGCCAGGGAGCAGG + Intergenic
1152696681 17:81801086-81801108 GGGATTTAGATCTGAGGAGCAGG + Intergenic
1153439591 18:5101774-5101796 GGGATTTATAACAAAGGAGCAGG + Intergenic
1153453568 18:5256547-5256569 GAAATTTATAGCCAAGGAGCAGG - Intergenic
1153614674 18:6923543-6923565 GGGGTTTCTAGCCAAGGAGCAGG - Intergenic
1153879565 18:9408594-9408616 GGTATATACAGCCAAGTATCAGG - Intergenic
1153944007 18:10003055-10003077 GGAAGGTATAGCCAAGGAGCAGG - Intergenic
1155077140 18:22368998-22369020 GGAGTCTACAGCCCAGGAGCTGG - Intergenic
1155310148 18:24515353-24515375 GGAATTTACAGCCAAGGAGCAGG - Intergenic
1155602180 18:27562367-27562389 GAGATTTATAGCCAAGGAGTAGG + Intergenic
1155707038 18:28828722-28828744 GGGATTTGTAACCAAGGAGCAGG - Intergenic
1156526085 18:37768583-37768605 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1156625934 18:38909122-38909144 GTGATTTAAAGCCCAGCAGCTGG - Intergenic
1157427424 18:47595770-47595792 GAGATTTACAGCCAGCGGGCAGG + Intergenic
1157660023 18:49433114-49433136 GAGAATCACAGCCATGGAGCAGG + Intronic
1158383785 18:56966157-56966179 AGGATTTATAACCAAGGAGCAGG + Intronic
1159003390 18:62992358-62992380 GGAATTTCTAGCCTAGGAGCCGG + Intergenic
1159036141 18:63278603-63278625 GGGATTTATAGTCAAGCAGCAGG - Intronic
1159140942 18:64393436-64393458 GCAATTTACAGTCAAGGAGCAGG - Intergenic
1159256488 18:65953893-65953915 GGGTGGTACAGCCAAGGAGGTGG - Intergenic
1159620513 18:70632540-70632562 GAGATTTATAGCCAAGGAGGAGG - Intronic
1159870064 18:73751059-73751081 GGGATTCACAGAAAAGGTGCTGG - Intergenic
1160203058 18:76810901-76810923 GGTATTTATAGCTAAGGAGAAGG - Intronic
1161374383 19:3931772-3931794 GGAAATTATAGCCCAGGAGCAGG - Intergenic
1163407342 19:17131138-17131160 GGACTTTATAACCAAGGAGCAGG - Intronic
1163459683 19:17429549-17429571 GGGATTTATAGCCACGGAGCAGG + Intronic
1165682728 19:37791312-37791334 GGAATTTATAGTCAAGGAGCAGG + Intronic
1165782718 19:38443275-38443297 GTGATTTCCAGCCAAGGTGAAGG + Intronic
1166348716 19:42183441-42183463 GGGACTGACAGCAAAGGCGCCGG + Intronic
1167097803 19:47384193-47384215 GAGATGTGCAGCCAAGGAGATGG - Intergenic
1167564654 19:50248855-50248877 GGTACTTACACTCAAGGAGCTGG + Intronic
1168500139 19:56885946-56885968 GGAATTCACAGCCAAGGAGCAGG + Intergenic
925748729 2:7068033-7068055 GGAATTTATATCCAAGGAGCAGG - Intronic
925933834 2:8734100-8734122 GGGATCTACCACCAAGGGGCAGG + Intronic
926345862 2:11944331-11944353 GGGTGTTTCAGCCAAGGAGATGG + Intergenic
926376868 2:12238680-12238702 AAGACTTACAGCCAAGGAGCTGG - Intergenic
926787854 2:16536256-16536278 GGAATTTATAGTCAAGGAGCAGG + Intergenic
927064815 2:19460678-19460700 GAACTTTATAGCCAAGGAGCAGG - Intergenic
927213935 2:20655626-20655648 GGAATTTATAGCCAAGGAACAGG + Intergenic
928101278 2:28438896-28438918 GGCATTTTCAGCCGAGGAGATGG - Intergenic
928646283 2:33356103-33356125 GGGTGCTACAGCCAAGGAGATGG + Intronic
928824993 2:35409745-35409767 GGAATTTATAACCAAGGATCAGG + Intergenic
930086087 2:47498237-47498259 GGGACTTGCAGCCATGAAGCAGG - Intronic
930176279 2:48304537-48304559 GGAATTTATAGCCAAGGAGCAGG - Intergenic
930444500 2:51452659-51452681 GGAATTTATAGCCAAGGAGTAGG - Intergenic
931019791 2:58031001-58031023 GTGACTCACAGCCTAGGAGCTGG - Intronic
931804085 2:65787985-65788007 AGAATTTATAGCCGAGGAGCAGG - Intergenic
931824933 2:65990523-65990545 GGAATTTGTAGCCAAGGAGTGGG - Intergenic
934103658 2:88676803-88676825 GGGATTTATAATCAAGGAGCAGG - Intergenic
934700360 2:96434749-96434771 GGAATTTATAGTCAAGGAGCAGG - Intergenic
935034213 2:99352909-99352931 AGGATTGACAGCCCAGGAGAGGG - Intronic
935723888 2:106006442-106006464 AGAATTTATAGCCAAGGAGGAGG + Intergenic
935736302 2:106109116-106109138 AGAATTTACAGCCAAGGAGCAGG - Intronic
935865246 2:107380899-107380921 GGGTGCTACAGCCAAGGAGGTGG - Intergenic
936480867 2:112883806-112883828 GGAATGTATAGCCTAGGAGCAGG + Intergenic
936928606 2:117763496-117763518 AGGATTTATAGCCAAGAAGCAGG + Intergenic
937133116 2:119528110-119528132 AAGATTTACAGCCCAGGTGCAGG - Intergenic
937436166 2:121883293-121883315 GGGACTTACAGCCAAGAAGCAGG - Intergenic
937667140 2:124500402-124500424 GGGATTTATAGCCAAGGAGTAGG + Intronic
937757566 2:125558860-125558882 TTGATTTACAGCCAAGCATCTGG - Intergenic
937874548 2:126811858-126811880 GGAATTTATAACCAAGGAGCAGG - Intergenic
938160387 2:128980165-128980187 GTAATGTATAGCCAAGGAGCAGG + Intergenic
938373112 2:130786271-130786293 GGCATTTACAGCTAGTGAGCAGG + Intergenic
938733841 2:134168203-134168225 GGGATTCACAGCCAAGGCAAGGG - Intronic
939709325 2:145496620-145496642 GGGATATTCATCCATGGAGCTGG - Intergenic
940449248 2:153817569-153817591 GGAATTTATAGCAGAGGAGCAGG - Intergenic
940898039 2:159099807-159099829 GGAATTTATAGCCAAGGAACAGG - Intronic
942597680 2:177607865-177607887 GGAATTTATAGCCAAGGAGCAGG + Intergenic
942682031 2:178487070-178487092 GGAATTTATAGCCAAGGAGCAGG + Intronic
943012310 2:182464700-182464722 GGAATTCATAGCCAAGGATCAGG + Intronic
943374667 2:187061543-187061565 GGGATTTATAGCCAAGAAGCAGG + Intergenic
943940007 2:193980748-193980770 GGGTGTTGCAGCCAAGGAGATGG - Intergenic
945067868 2:205962210-205962232 GGAATTTATAGCCCAGGAGCAGG - Intergenic
945253848 2:207787673-207787695 GAGATTTACAGCCAAGGAGCAGG + Intergenic
945293793 2:208150669-208150691 GGGATTTACAACCTAGGAGTGGG + Intergenic
945303022 2:208231907-208231929 GGAATTTATAGCCAAGGAGCAGG - Intergenic
945356012 2:208840744-208840766 GGAATTTATAGCCAGGGAGCAGG + Intronic
945930841 2:215853479-215853501 GGGATTTATAGCCCAGGAGCAGG + Intergenic
946015961 2:216604225-216604247 GGGATTTGTAGCCAAGGAGCAGG + Intergenic
946230865 2:218290572-218290594 GGGATTTACTGCCAAGGGCCGGG + Intronic
946366667 2:219253151-219253173 GGTATTTATAGCCCAGGAGCGGG - Intronic
946446633 2:219745765-219745787 GGAATTTAAAACCAAGGAACTGG + Intergenic
946767204 2:223051762-223051784 GGGATTTACAGTCAAGGAACTGG - Intergenic
947445106 2:230157217-230157239 GGGATTTATAGCCATGGAGCAGG - Intergenic
948433499 2:237936012-237936034 GGGACTTGTAGCCAAGGAGCAGG - Intergenic
1169387386 20:5162660-5162682 GGTAATTAAAGCCAAGGGGCTGG + Intronic
1170233319 20:14074159-14074181 GGAATTTATAGCCAAGGGGCAGG - Intronic
1170233986 20:14081281-14081303 GGGATTTATAGCCAAGGAGCAGG - Intronic
1170418076 20:16165551-16165573 GGAATTTACAGCTAAGGAGCAGG + Intergenic
1170594376 20:17794140-17794162 GGGGGTGACAGCAAAGGAGCTGG + Intergenic
1170694803 20:18648414-18648436 GGGATGTACAGCGAGGGACCAGG + Intronic
1171119874 20:22558963-22558985 GGACTTTACAGCAAAAGAGCAGG - Intergenic
1171273243 20:23832734-23832756 CGGATTTATAGCCAAGGATCAGG - Intergenic
1171279582 20:23884413-23884435 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1171284662 20:23927013-23927035 AGGATATATAGCCAAGGAGCAGG - Intergenic
1171313554 20:24166306-24166328 GAAATTTATAGCCAAGGACCAGG - Intergenic
1171452403 20:25245500-25245522 GGCATTTATAGCCAAGGACTGGG + Intergenic
1173447660 20:43134534-43134556 GAGATTTATAGCCAAGGAGCAGG - Intronic
1173484425 20:43429998-43430020 GAGATTTATCGCCAAGGAGCAGG + Intergenic
1173722503 20:45271824-45271846 GGGATTTAGAACCAAGAACCAGG - Intergenic
1174075700 20:47934472-47934494 TGGGTTTATAGCCAAGGAGCAGG + Intergenic
1175033548 20:55978273-55978295 GAGTTTTTCAGCCAAAGAGCAGG - Intergenic
1175073899 20:56358028-56358050 GAGATTGACTGCCAAGGAGTGGG - Intergenic
1175082072 20:56429086-56429108 GGGATTTCCATCCCAGGAACAGG + Intronic
1175117389 20:56692230-56692252 GTGATTTACAGCCAAAGACATGG - Intergenic
1175765799 20:61592046-61592068 AGGATTGACAGACAAGCAGCAGG - Intronic
1176263962 20:64198933-64198955 GGCATTTACAGCCCTGGAGGAGG - Intronic
1177292879 21:19138294-19138316 AGAATTTATAGCCAAGGAGCAGG + Intergenic
1177403440 21:20636184-20636206 GGAATTTATAGCCAAGGAGCAGG + Intergenic
1178346455 21:31832612-31832634 GGGATTTATAGCCAGTGAGCAGG - Intergenic
1178728818 21:35080161-35080183 TGAATTTACAGCCTCGGAGCTGG - Intronic
1178776631 21:35557911-35557933 GAAATTTACAGCCAAGGAACAGG + Intronic
1179022480 21:37652744-37652766 GGGACTTAAAGCACAGGAGCTGG + Intronic
1179558191 21:42194047-42194069 GGCACTTAGACCCAAGGAGCTGG + Intergenic
1179595853 21:42442768-42442790 GGGAGTTATAGCCACAGAGCAGG + Intronic
1180727090 22:17954330-17954352 GGAATTCAGAGCCAAGGAGCAGG + Intronic
1180874614 22:19169395-19169417 GGGAGGGACAGCCAAGGAGGTGG + Intergenic
1180938072 22:19638888-19638910 GGGATTGTCTGCCCAGGAGCTGG + Intergenic
1181497862 22:23298134-23298156 GGGACTTGCAGCCAAGAAGCAGG + Intronic
1182006583 22:26965210-26965232 GGGATTTATAGCCAATGGGCAGG + Intergenic
1182273532 22:29170798-29170820 GGGATTGATCGCCAAGGAGCAGG + Intergenic
1183607187 22:38872562-38872584 GGGATTAAGAGGCAAGGAGAGGG - Intergenic
1184080669 22:42217394-42217416 GGGAGTTACAGCCAGGGAAAAGG - Intronic
1184321439 22:43744844-43744866 GGGAGGTACAGCCAGTGAGCAGG + Intronic
1184785297 22:46668633-46668655 GTGACTGACAGCCCAGGAGCGGG + Intronic
1184908522 22:47509325-47509347 AGAACTTATAGCCAAGGAGCAGG + Intergenic
1184950843 22:47841708-47841730 GGGATTCACAGCCAGGGAGGAGG + Intergenic
1184965189 22:47966292-47966314 GGGATTAGTAGCCAAGGAGAAGG - Intergenic
1185169144 22:49282257-49282279 TGGAATAACAGCCAGGGAGCTGG - Intergenic
1185405292 22:50644741-50644763 GGAGTTTATAGCCAAGGAGCAGG - Intergenic
949722748 3:7010068-7010090 GAGACTTACAGCTAAGGAGCAGG + Intronic
950305837 3:11914930-11914952 GGGACTGACAGCCATGGAGACGG + Intergenic
950794772 3:15501851-15501873 GGGAATTATAGCCAAGAAGCAGG - Intronic
950830835 3:15874432-15874454 GGAATTTTCAGCCAAAGATCTGG + Intergenic
950924765 3:16729458-16729480 GAAATTTACAGCCAAGGAGCAGG + Intergenic
951461709 3:22958164-22958186 GGGATTTTTAATCAAGGAGCAGG - Intergenic
952114002 3:30158032-30158054 AAGATTTATAGCCAAGAAGCAGG + Intergenic
952170771 3:30804678-30804700 GGGATTCATAGCCAAGGGGCAGG - Intronic
952296407 3:32066362-32066384 GAGATTTATAACCAAAGAGCAGG - Intronic
952422502 3:33144693-33144715 GGCATTTAAAGCCATGCAGCTGG + Exonic
952675360 3:36023431-36023453 GGGATTTATAGCCAACAAGCCGG - Intergenic
952932062 3:38368217-38368239 GGGAGTAAGAGCCAAGGAACAGG - Exonic
953142542 3:40242325-40242347 GGAATTTACAGCCAAAGTGATGG - Intronic
954225615 3:49178921-49178943 GGCATTTAGAGCCAAGAGGCTGG - Intronic
954230800 3:49215640-49215662 GGGTGCTACAGCCAAGGAGATGG + Intronic
954685501 3:52368001-52368023 GGAATCTATAGCCAAGGGGCAGG + Intronic
955256006 3:57332019-57332041 GGGATTTATAGTCAAGGAGCAGG - Intronic
956687121 3:71840420-71840442 GGAATTTATGGCCAAGGAGCAGG + Intergenic
956892107 3:73623521-73623543 GGGCTTTGCAGCCAACTAGCTGG - Intronic
957767149 3:84639923-84639945 GAGATTTATAGCCAAGGAGCAGG + Intergenic
957931800 3:86888250-86888272 GGGATTTACAGCTAAGAAGTAGG + Intergenic
958772210 3:98438313-98438335 GGGATTTGTAGCCAAGGAACAGG + Intergenic
959051609 3:101529592-101529614 GGAATTTATAGCCAAGTAGTAGG - Intergenic
959154365 3:102648636-102648658 GGAATTTGTAGCCAAGTAGCAGG - Intergenic
959255223 3:104002262-104002284 GAGATGTATAGTCAAGGAGCCGG + Intergenic
959312419 3:104756107-104756129 GGGTGCTACAGCCAAGGAGATGG + Intergenic
959770565 3:110090314-110090336 GGGATTTATAGCCAAGGAGCAGG + Intergenic
959980938 3:112516796-112516818 GGAATTTATAGCCAAGGAGCAGG - Intergenic
960876058 3:122296264-122296286 GGGATTCGTAGCGAAGGAGCAGG - Intergenic
962465285 3:135651801-135651823 GGGAGCTACATGCAAGGAGCAGG + Intergenic
962732074 3:138292753-138292775 GGTATTTAAAGCCATGGAGCTGG + Intronic
962745379 3:138394177-138394199 AGGACCTACAGCCAAGGACCGGG - Intronic
963343299 3:144063681-144063703 GAGATTTATAGGCAAGGAGAAGG - Intergenic
963469451 3:145721605-145721627 GGAATTTATAGCCGAGGAGCAGG - Intergenic
964546091 3:157835272-157835294 GGAATTTATAGCAAAGGAGCAGG - Intergenic
964979526 3:162662311-162662333 GGAATTCACATCCAAAGAGCAGG + Intergenic
965587029 3:170327758-170327780 GGGATCTAGCGCCATGGAGCAGG - Intergenic
965935736 3:174108612-174108634 GAGATTTATAGCCAAGGAACAGG + Intronic
966221521 3:177556495-177556517 GGGATTTATAGCCAAGAAGCAGG + Intergenic
966238433 3:177728394-177728416 AGAATTTATAGTCAAGGAGCAGG + Intergenic
966420408 3:179729168-179729190 GGGATTTATAAACAAGGAGTTGG + Intronic
966674266 3:182568358-182568380 GGACTTTCCAGCCAAGCAGCAGG + Intergenic
969476321 4:7424455-7424477 GGATTTTATAGCCAAGGGGCTGG - Intronic
969579974 4:8058974-8058996 GGGGGTTGCAGCCAATGAGCAGG - Intronic
970764192 4:19527206-19527228 GGAATTTATAGCCAAGGAGCAGG + Intergenic
971390893 4:26184358-26184380 GGGATTGACAGCCAGGGAGCAGG + Intronic
971680918 4:29699671-29699693 GGAATTTATAGCCAAGAAGCAGG + Intergenic
971691801 4:29846342-29846364 GAAATTTATAGCCAAGGAGCAGG + Intergenic
971955990 4:33419209-33419231 GGCTTTTATAGCCAAGGACCAGG + Intergenic
972228580 4:37043743-37043765 GGGATTTATAGCCAAGGAGCAGG + Intergenic
972774315 4:42227434-42227456 GGGACTTACCGCAGAGGAGCTGG - Intergenic
972875438 4:43352890-43352912 GGGATGCATAGCCAAGGAGCAGG - Intergenic
973117130 4:46475801-46475823 GGGATTTGTAGCCAAGGATCAGG - Intergenic
973851083 4:54962299-54962321 GGGATTTGAAGCCAGGCAGCTGG - Intergenic
976194844 4:82522749-82522771 GGAATCTATAGCCAAGGAGCTGG + Intronic
976287111 4:83381424-83381446 GGAATTTAGAGCCAAGGAGCAGG - Intergenic
976436385 4:85023384-85023406 AGGATTTATAGTCAAGGAGCAGG + Intergenic
976846946 4:89499870-89499892 GGGATTTATAGTTAAGGATCAGG + Intergenic
978593028 4:110346859-110346881 GGCATTCAAAGGCAAGGAGCAGG - Intergenic
978885802 4:113764685-113764707 GGGATTTACAAGCAAGGAGCAGG + Intergenic
978941385 4:114440043-114440065 GGGATTTAAAAGCAAGGTGCAGG - Intergenic
979775399 4:124583211-124583233 GGGAGCTGCAGCCAAGGTGCTGG - Intergenic
980132188 4:128827099-128827121 GAGATTTATAACCAAGGAGGAGG - Intronic
980933056 4:139199668-139199690 GAAATTTATAGCCAAGGAGAAGG - Intergenic
981915117 4:150024842-150024864 GGAATTTATAGCCAAGGAGCAGG + Intergenic
981932668 4:150207947-150207969 GGGGATTATAACCAAGGAGCAGG + Intronic
982780755 4:159488527-159488549 GAGATTTACAGTCAAACAGCAGG - Intergenic
982793775 4:159621619-159621641 GGAATTTATAGCCAATAAGCAGG - Intergenic
983082329 4:163401995-163402017 GGAATATATAGTCAAGGAGCAGG + Intergenic
983243060 4:165255625-165255647 GGGTTTTGCGGCCAAGGAGTAGG - Intronic
983677484 4:170312564-170312586 GGAATTTATAGACAAGAAGCAGG - Intergenic
984279368 4:177650356-177650378 GAAATTTATAGCCAAGGAGCAGG - Intergenic
984661863 4:182383102-182383124 GGGATTTACAGCCAAAGAACAGG + Intronic
984890096 4:184484126-184484148 GGGTGTTGCAGCCAAGGAGATGG + Intergenic
985931124 5:3058611-3058633 GGGATTCTCATCCATGGAGCAGG + Intergenic
985961483 5:3306334-3306356 GGTGTTCACAGCCGAGGAGCGGG - Intergenic
986178437 5:5371700-5371722 AGAATTTATAGCCAAGGGGCAGG - Intergenic
986494805 5:8331659-8331681 TGGATCTCCAGCCTAGGAGCAGG - Intergenic
986792367 5:11174281-11174303 GGTATTTAAAGCCAAGGGACTGG + Intronic
986817237 5:11426082-11426104 GGAATTTATAGCCAAGGAGGAGG - Intronic
987027568 5:13942766-13942788 AGGATTTGTAGCCAAGGAGCAGG - Intronic
987569481 5:19637781-19637803 GGAATTTATATCCAAGGAGTTGG - Intronic
988028386 5:25729136-25729158 GGAATTTATAGCCAAAAAGCAGG + Intergenic
988422604 5:31024430-31024452 GGAATTTATAGCCAAGGAGCAGG - Intergenic
988672420 5:33396236-33396258 GGAATTTACAGCCAAGGAGCAGG + Intergenic
988890589 5:35612525-35612547 GGGATTTATAGCCAAAGAGCAGG + Intergenic
989208129 5:38831659-38831681 GAAATGTATAGCCAAGGAGCAGG - Intergenic
990156563 5:52884617-52884639 GGCATTTATAGTCAAGGAACAGG + Intronic
990276408 5:54201644-54201666 GGAATTCATAGCCAAAGAGCAGG - Intronic
990410483 5:55535752-55535774 GGGATTTATAGCCAAGGAACAGG - Intergenic
990617657 5:57523786-57523808 AGGATGCACAGCCAAGGAGCAGG + Intergenic
991069517 5:62461191-62461213 GGAATTTATTGCCAAGGAGCAGG + Intronic
992262380 5:74984480-74984502 GAAATTTATAGCCAAGGAGGAGG + Intergenic
992288655 5:75262273-75262295 GGCATTTATAGCCAAGGAGCAGG - Intergenic
992466945 5:77015515-77015537 GAGATTTACAGCCAAGGAGCAGG - Intergenic
992654498 5:78894999-78895021 GGGATGAACAGCCAAGGGCCAGG + Intronic
993398251 5:87417248-87417270 GGAATTTATAACCAAGAAGCAGG - Intergenic
995139988 5:108725121-108725143 GGAATTTATAGAGAAGGAGCAGG + Intergenic
995861740 5:116648140-116648162 GGGATTTACTGCAAAGTAGTAGG + Intergenic
995898705 5:117044719-117044741 GGAATTTATAGCCAAGGAGCAGG - Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
996787542 5:127256529-127256551 GGGATTTATGACCATGGAGCAGG - Intergenic
997336227 5:133110699-133110721 GGGATTTACATCCTGGAAGCTGG - Intergenic
998806401 5:145921352-145921374 TGGATTTTCAGCCCTGGAGCAGG - Intergenic
999642169 5:153682677-153682699 GGAATATATAGCCAAGGAGCAGG - Intronic
999958410 5:156727142-156727164 GGAATGTACAGCCAAGTAGCAGG + Intronic
1000097432 5:157984303-157984325 GGAATTTATAGCCAAGGAACAGG + Intergenic
1000299252 5:159940495-159940517 GGAATTTATGGCCAAGGAGCAGG - Intronic
1000338839 5:160261550-160261572 GGGATTTCCAGCCATGCAGGAGG - Intronic
1000490510 5:161906877-161906899 GGGGTTTGCAGCCAAGAAGCTGG - Intergenic
1001117621 5:168952889-168952911 GGGGTTTATAGCCAAAGAGCAGG + Intronic
1001425015 5:171617228-171617250 GGAGTTTATAGCCGAGGAGCAGG - Intergenic
1001449939 5:171816905-171816927 GGGATTTATAGGCAAGGAGCAGG - Intergenic
1001676235 5:173518970-173518992 TGAACTGACAGCCAAGGAGCGGG - Intergenic
1001705935 5:173741279-173741301 GGGATTTAAATCGAAGGATCTGG + Intergenic
1002272573 5:178082275-178082297 GGGGGTGATAGCCAAGGAGCAGG - Intergenic
1002449723 5:179311762-179311784 GGGGGTGATAGCCAAGGAGCAGG - Intronic
1002875263 6:1204380-1204402 GGGATTTATAGTAAAGGAGCAGG + Intergenic
1003075770 6:2982668-2982690 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1003866121 6:10364330-10364352 GGGCGTTGCAGCCAAGGAGATGG + Intergenic
1004450243 6:15738747-15738769 GAGATTTATAGCCAAGGAGCAGG - Intergenic
1004450757 6:15743530-15743552 GAGATTTATAGCCAAGGAGTTGG - Intergenic
1004773419 6:18813035-18813057 GGAATCTAAAGCCCAGGAGCAGG + Intergenic
1005349333 6:24918829-24918851 TGGATTCAGAGCCTAGGAGCAGG - Intronic
1005577686 6:27205336-27205358 GGAATTTATAGCCAAGGATCGGG - Intergenic
1007044594 6:38759855-38759877 GGAATGTATAGCCAAGGGGCAGG - Intronic
1007281039 6:40712699-40712721 TGGATGTGCAGCCAGGGAGCAGG + Intergenic
1008044986 6:46842710-46842732 GGGGTATACAAACAAGGAGCAGG - Intergenic
1008157231 6:48031336-48031358 GTAATTTACAGTCAAGGAGCAGG - Intronic
1008157602 6:48035862-48035884 CGAATTTATAGCCAAGGAGCAGG - Intronic
1008333755 6:50274892-50274914 GAAATTTATAGCCAAAGAGCAGG - Intergenic
1008806935 6:55441127-55441149 AGAATTTATAGCCAAGGAGTGGG + Intronic
1008976109 6:57429239-57429261 GATATTTATAGCCAAGGAGCAGG + Intronic
1009164639 6:60326381-60326403 GATATTTATAGCCAAGGAGCAGG + Intergenic
1009376697 6:62980087-62980109 TGAATTTATAGCTAAGGAGCAGG - Intergenic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1009641231 6:66339739-66339761 GCAAATTATAGCCAAGGAGCTGG + Intergenic
1010004780 6:70983844-70983866 AGAATTTATAGTCAAGGAGCAGG + Intergenic
1010300337 6:74252745-74252767 GGGATTTATAGCCAAAGAGCAGG + Intergenic
1010578724 6:77566854-77566876 GGAATTTATAGCCAGGGAGAAGG - Intergenic
1010917514 6:81638651-81638673 GGAATTTATAGCCAAGGAGCAGG - Intronic
1011053312 6:83177936-83177958 GGGCTTTATAGCCAAGGAGCAGG - Intronic
1011417124 6:87133518-87133540 GGAATTTATAGCCAAGGAGCAGG - Intergenic
1012451453 6:99356436-99356458 AGGATTTACAGCAAAGTGGCAGG + Intergenic
1013744555 6:113329983-113330005 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1013774367 6:113663235-113663257 GGGATTTCCACCCAAGGTGATGG + Intergenic
1013819764 6:114140604-114140626 TGGATTCACAGCCAAGGTGAGGG - Intronic
1013962052 6:115912246-115912268 GGAATTTATAGCCAAGGAACAGG + Intergenic
1014163728 6:118200330-118200352 GGGATTTACAGCCAAAGAACAGG + Intronic
1014450675 6:121577941-121577963 GAGATTTATAACCAAGGAGCAGG + Intergenic
1015231292 6:130917588-130917610 GAAATTTATAGTCAAGGAGCAGG - Intronic
1015852574 6:137589220-137589242 GGGATTTTCAGCCTAGAAGGCGG - Intergenic
1016009729 6:139126892-139126914 GGGATTTGTAGCCAAGGAGCAGG + Intergenic
1016443500 6:144109085-144109107 GGAATTTATAACCAAGGAGCAGG + Intergenic
1016764619 6:147778282-147778304 GGTATTTAAAGCCAGGGGGCTGG - Intergenic
1017303328 6:152887583-152887605 GAGATTTCTAGCCAAGGAGTTGG - Intergenic
1017574133 6:155782610-155782632 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1018554053 6:165032695-165032717 GGAATTTATAGCCACAGAGCAGG - Intergenic
1019561603 7:1662078-1662100 GGGATTAACCGCGAAGGAGTGGG - Intergenic
1020209836 7:6150418-6150440 GGGAGAGACAGCAAAGGAGCAGG - Exonic
1020277016 7:6630680-6630702 GAGACTTCCAGCCTAGGAGCAGG - Intergenic
1021212488 7:17871691-17871713 GGGATTTATAGCCAAGGAGCAGG - Intronic
1021509923 7:21424690-21424712 GAGATCTGAAGCCAAGGAGCAGG + Intergenic
1021601768 7:22371460-22371482 GGGATTTACAGGAAAGGTTCAGG - Intergenic
1022159551 7:27695512-27695534 GGAATTTATAGCCAAGAAGCAGG + Intergenic
1022225444 7:28358021-28358043 GGGTTCTACAGTGAAGGAGCTGG + Intronic
1022378799 7:29840777-29840799 GGAATGTATAGCCCAGGAGCAGG + Intronic
1022574248 7:31482366-31482388 GAGATTTATAGCCAGGGAGCAGG - Intergenic
1022660137 7:32359226-32359248 GGGATTTATAACCAAGGAGCAGG - Intergenic
1023279363 7:38553926-38553948 AGAATTTACAACCAAAGAGCTGG + Intronic
1024121754 7:46248947-46248969 GAAACTTACAGCCAAGAAGCAGG - Intergenic
1024549148 7:50546363-50546385 GGGACTTACAGCCAACGGTCAGG + Intronic
1024658909 7:51474898-51474920 GGGATTTGCAGCCTAGAAGTAGG - Intergenic
1024813097 7:53236171-53236193 GGGATATACAGCCAAGGAGCAGG - Intergenic
1024889810 7:54186926-54186948 GAGTTTTACAGCCAAGGGGTAGG + Intergenic
1026268444 7:68815815-68815837 GAAATTTACAGCCTAGTAGCTGG - Intergenic
1026505460 7:70979148-70979170 GGGATTTACAGGCAGGGTGGTGG + Intergenic
1027607438 7:80317767-80317789 AGAATTTATAGCCAAGGAGCAGG - Intergenic
1027671553 7:81105669-81105691 GGAATTTACAGCCAAGGAGCAGG + Intergenic
1028335941 7:89655054-89655076 GGGATTGATAGCTAAGCAGCAGG + Intergenic
1028344044 7:89758543-89758565 GGGCTTTATAGTCAAGGAGCAGG + Intergenic
1028636362 7:92993938-92993960 GGGAATTAAAGGGAAGGAGCTGG - Intergenic
1028668931 7:93378554-93378576 GTGGTTTACTGCCAAGCAGCTGG + Intergenic
1029354863 7:100044228-100044250 GCAATTTATAGCCAAGGAGCAGG - Intergenic
1030527311 7:110670224-110670246 GGCATCAACAGCCAAGGAGGGGG + Intronic
1030613048 7:111709539-111709561 GGGACTTACAGCCAATGAGAAGG + Intergenic
1030785097 7:113650278-113650300 GGAACTTATAGTCAAGGAGCAGG - Intergenic
1031049741 7:116932801-116932823 GAAATTTTTAGCCAAGGAGCAGG - Intergenic
1031062471 7:117067468-117067490 GGGTTTTATAGCCAGGGAGCAGG + Intronic
1031241656 7:119251234-119251256 GAAATTTACAATCAAGGAGCAGG - Intergenic
1031357110 7:120800604-120800626 GGAATTTATAGTCAAGGAACAGG - Intronic
1032634260 7:133689443-133689465 GAGATTTATAGCCAAGGATATGG + Intronic
1032783503 7:135183051-135183073 GGAATTCATAGCCAAGGAGCAGG - Intergenic
1032917983 7:136512468-136512490 GGGATCTAAAGCCAAGCAACAGG - Intergenic
1033055470 7:138048997-138049019 GGGCTCTGCAGCCAAGGAGATGG + Intronic
1033309012 7:140246044-140246066 GGGATTCACAGCCAAAGAGCAGG - Intergenic
1033646066 7:143305244-143305266 GGGCTTCACAGAAAAGGAGCTGG - Exonic
1034211750 7:149369763-149369785 GGTATTTATAGCCAAGGAGCAGG - Intergenic
1035241927 7:157537840-157537862 GGGCTTCCCAGCCAAGGAGTGGG - Intergenic
1035555285 8:563039-563061 GGAATCTATAGCCAAGGAGCAGG + Intergenic
1035716514 8:1759373-1759395 GGAATGTACAGCCACGGAGAGGG + Intronic
1036436907 8:8743090-8743112 GGGGTTTAGTGCCAAGGAGTGGG - Intergenic
1037938000 8:22928117-22928139 TTGCCTTACAGCCAAGGAGCAGG - Intronic
1038713720 8:29972924-29972946 GGACTTTATAGTCAAGGAGCAGG - Intergenic
1038865128 8:31431233-31431255 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1039392020 8:37189096-37189118 TGAATTTCCAGCCAAGCAGCTGG + Intergenic
1039716336 8:40113579-40113601 GGGCTTTACCGACAAGGACCTGG + Intergenic
1039811639 8:41054338-41054360 GGCCTTTACAGCCAAGGGACAGG - Intergenic
1040489907 8:47910235-47910257 GGGATTGATAGCCAAGGAGCAGG - Intronic
1040676498 8:49757107-49757129 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1041077252 8:54179948-54179970 GGATTTTATAGCCAAGGACCAGG - Intergenic
1041445699 8:57948989-57949011 GCAATTTATAGCCGAGGAGCAGG + Intergenic
1041670237 8:60484338-60484360 GGGATTCACTGGAAAGGAGCTGG - Intergenic
1042341548 8:67684961-67684983 GGAATGTATAGCCAAGGAGCAGG - Intronic
1043661834 8:82752982-82753004 GGGATTTACAGCCCAAGGGTGGG + Intergenic
1046309297 8:112414078-112414100 GGAATTTATAGACAAGAAGCAGG - Intronic
1047757280 8:127928337-127928359 GAAATTCACAGCCAAGAAGCAGG - Intergenic
1048409885 8:134161923-134161945 AGGGTTTTCAGCCAAGGAGCAGG + Intergenic
1048494003 8:134920405-134920427 GGGGTTTGCAGCCAAGAAACTGG - Intergenic
1048949430 8:139483153-139483175 AGAATTTATAGCCAAGGAGCAGG + Intergenic
1049297398 8:141850066-141850088 GGGGATTACAGCCGAGGAGCAGG + Intergenic
1049379684 8:142305721-142305743 GGGATTTGCTGGCAAGGTGCTGG + Intronic
1049498976 8:142951180-142951202 TGGAGTCACAGCCAAAGAGCAGG - Intergenic
1049762342 8:144337086-144337108 GGCTTTTAAAGCCCAGGAGCTGG + Intergenic
1050171995 9:2829564-2829586 GGGATTTAAAGCCAATGCTCTGG + Intronic
1050418744 9:5440446-5440468 GGGATTTATAGCCGAGGAGCAGG + Intergenic
1051231249 9:14957888-14957910 GGAATTCACAGCCAAGGAGCAGG + Intergenic
1052255590 9:26452557-26452579 GGAATTTATAGCCAAGGAGCAGG - Intergenic
1053185345 9:36011718-36011740 GGAATTTTTAGCCAAGGAGGGGG + Intergenic
1054925586 9:70585615-70585637 GGGATTTAAAACAGAGGAGCTGG - Intronic
1055037089 9:71829293-71829315 GAGATTTACAACCAAGGAGTAGG + Intergenic
1055577014 9:77670659-77670681 GGGATTTATAGCCAAAGAAAAGG + Intergenic
1055713742 9:79094290-79094312 GGGATTTATAGCCAAGGAACAGG + Intergenic
1055934163 9:81589507-81589529 GGTATTTACTCCCCAGGAGCCGG + Intronic
1055953818 9:81755468-81755490 GGGACTTATAGCCAAGGAGCAGG - Intergenic
1056056087 9:82825669-82825691 AGGCTTTACAGGCAAGGTGCTGG + Intergenic
1056252881 9:84768778-84768800 GGAATTCATAGCCAAGAAGCAGG + Intronic
1056601881 9:88053099-88053121 GGATTTTACAGCCAAGGAGCAGG + Intergenic
1056637409 9:88342745-88342767 GGGACTGATAGCCAAAGAGCAGG + Intergenic
1056658626 9:88528875-88528897 GGGATTTACAGCCCAGGAACAGG + Intergenic
1056740375 9:89249481-89249503 GGAGTTTATAGCCAAGGAGCAGG + Intergenic
1057377065 9:94534830-94534852 GGCATTTATAGCCAAGGAGCAGG - Intergenic
1057630303 9:96714718-96714740 AGAATGTACAGCCAAGGAGTAGG + Intergenic
1057647952 9:96894537-96894559 GGAATTTATTGCCAAGGAGTAGG - Intergenic
1057817777 9:98308263-98308285 GAGATTTACAGCCAACCACCAGG - Intronic
1057866695 9:98687218-98687240 GGGATTTACAGCCAAGGGGCAGG + Intronic
1058048158 9:100379491-100379513 GGGATTTATAACCAAAGATCAGG + Intergenic
1058320740 9:103627401-103627423 GGGATTTCCAGCAAAGGTGGAGG + Intergenic
1058537566 9:105977895-105977917 GGGATTTATAACCGAGGAGCAGG + Intergenic
1059306955 9:113361167-113361189 GGAATTTATAGCTAAGGAGCAGG - Intronic
1059350272 9:113659415-113659437 GGGACTTACAGCTGAGGGGCAGG + Intergenic
1059592152 9:115673221-115673243 TTGATTTAAAGCAAAGGAGCTGG - Intergenic
1059717795 9:116930038-116930060 TGCATTTACAGCCAGGGAACTGG - Intronic
1059826373 9:118033764-118033786 GAGATTTATAGCTAAGGAGTAGG - Intergenic
1060378621 9:123142634-123142656 AGGATTTGTAGCCAAGGAACAGG - Intronic
1060472219 9:123957482-123957504 GGGCTTTGCTGCCAGGGAGCAGG + Intergenic
1061494403 9:130963506-130963528 GAGATTAATAGCCGAGGAGCAGG + Intergenic
1062191502 9:135250118-135250140 GGGATTTACAGCCGAGGAGCCGG + Intergenic
1185986855 X:4844747-4844769 GGGATTTATAGCCGGGGAGCAGG - Intergenic
1186221514 X:7354270-7354292 GGGATTTATAGACAGGGAACAGG - Exonic
1186527642 X:10264112-10264134 GGGATTTAGAGCCATGTAGATGG + Intergenic
1186533079 X:10317043-10317065 GAGATTTATAGCCAAGGAGCAGG - Intergenic
1186550283 X:10497582-10497604 GGGATTTACAGCCAAGGAGCAGG - Intronic
1187827473 X:23346377-23346399 GGAATTTATAGCCAAGGAGCAGG + Intronic
1188495696 X:30780845-30780867 GGAATGTATAGCCAAGGAGCAGG - Intergenic
1188539597 X:31234861-31234883 GGAATTGATAGCCAAGGAGCAGG + Intronic
1188933764 X:36148120-36148142 GGAATTTACAGCCAAGGAGCAGG + Intergenic
1189078503 X:37943438-37943460 GGGATTTACAACCAAGGAGCAGG + Intronic
1189967572 X:46390374-46390396 GGAATTTATTGCCAGGGAGCAGG - Intergenic
1190175591 X:48146467-48146489 GGGATTTGTAGTCAAGGAGTAGG - Intergenic
1190182497 X:48205031-48205053 GGGATTTATAGTCAAGGAGTAGG + Intronic
1190182879 X:48208359-48208381 GGGATTTGTAGTCAAGGAGTAGG - Intronic
1190668566 X:52718091-52718113 GGGATTTGTAGTCAAGGAGTAGG + Intergenic
1190670851 X:52740313-52740335 GGGATTTGTAGTCAAGGAGTAGG - Intergenic
1190761912 X:53444032-53444054 GAGATTTGTAACCAAGGAGCAGG + Intergenic
1190952821 X:55162662-55162684 GAAATTTATAGCCAAGGAGCAGG - Intronic
1191764963 X:64688087-64688109 GAGATTTACAGCCAAGGAGCAGG - Intergenic
1192092937 X:68180050-68180072 GAAATTTATATCCAAGGAGCAGG - Intronic
1192574488 X:72232225-72232247 GAGATTTAAAGCCAAGAACCTGG + Intronic
1192670091 X:73130694-73130716 GGGATTTGTAGCAAAGCAGCAGG - Intergenic
1192811732 X:74553148-74553170 GGACTTTACAGCCAAGGACCAGG + Intergenic
1193024372 X:76829337-76829359 GAGATTTATAGCCAAGAAGCAGG - Intergenic
1194600093 X:95909952-95909974 AGAATTTATAGCCAAGGTGCAGG - Intergenic
1194712634 X:97253931-97253953 GGGATTTATAGCCAAGAAGCAGG + Intronic
1195550146 X:106159821-106159843 GGGATTGACAAGCAAAGAGCAGG - Intergenic
1195652330 X:107298348-107298370 GAATTTTATAGCCAAGGAGCAGG + Intergenic
1196038852 X:111178702-111178724 ATTATTTACAGCCAAGGAGTGGG + Intronic
1196078184 X:111600598-111600620 GGAATTTATAGCCAAGAAGCAGG - Intergenic
1196140288 X:112253957-112253979 GGGATTTATAGCCAAGGATCAGG - Intergenic
1196663804 X:118295366-118295388 GGGATGTACATACAAAGAGCTGG - Intergenic
1197214092 X:123851957-123851979 AGAATTTATAGCCAAGGAACAGG + Intergenic
1197995523 X:132368370-132368392 GGAATTTATAGCCAAGGAGCAGG - Intergenic
1198453677 X:136793894-136793916 GGGATTTACTGCCATGAAGCTGG - Intergenic
1199059396 X:143336593-143336615 GAGATTTATAGCCAAAAAGCAGG + Intergenic
1199936570 X:152580159-152580181 GGGATTTATAATCAGGGAGCAGG - Intergenic
1200403585 Y:2785347-2785369 GGGATTTATAGCCAAGGAGCAGG + Intergenic
1201589687 Y:15601355-15601377 GGGATTCATAGCCAGGGAGCAGG - Intergenic
1202056587 Y:20839621-20839643 GGAATTTACAGCCGAGGTGCAGG - Intergenic