ID: 1038866240

View in Genome Browser
Species Human (GRCh38)
Location 8:31441421-31441443
Sequence GACACAGGTGGTATTCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038866240_1038866243 -8 Left 1038866240 8:31441421-31441443 CCACTCTGAATACCACCTGTGTC No data
Right 1038866243 8:31441436-31441458 CCTGTGTCCTCCCTGCAAGAAGG No data
1038866240_1038866245 -2 Left 1038866240 8:31441421-31441443 CCACTCTGAATACCACCTGTGTC No data
Right 1038866245 8:31441442-31441464 TCCTCCCTGCAAGAAGGAGGTGG No data
1038866240_1038866247 -1 Left 1038866240 8:31441421-31441443 CCACTCTGAATACCACCTGTGTC No data
Right 1038866247 8:31441443-31441465 CCTCCCTGCAAGAAGGAGGTGGG No data
1038866240_1038866251 25 Left 1038866240 8:31441421-31441443 CCACTCTGAATACCACCTGTGTC No data
Right 1038866251 8:31441469-31441491 TGCTATCTAATAATACACAATGG No data
1038866240_1038866244 -5 Left 1038866240 8:31441421-31441443 CCACTCTGAATACCACCTGTGTC No data
Right 1038866244 8:31441439-31441461 GTGTCCTCCCTGCAAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038866240 Original CRISPR GACACAGGTGGTATTCAGAG TGG (reversed) Intergenic
No off target data available for this crispr