ID: 1038868369

View in Genome Browser
Species Human (GRCh38)
Location 8:31464758-31464780
Sequence GCACCGTGGTAAACTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038868369_1038868374 3 Left 1038868369 8:31464758-31464780 CCTGTTGCAGTTTACCACGGTGC No data
Right 1038868374 8:31464784-31464806 TAATATATCCAGGTCCCATTGGG No data
1038868369_1038868380 23 Left 1038868369 8:31464758-31464780 CCTGTTGCAGTTTACCACGGTGC No data
Right 1038868380 8:31464804-31464826 GGGCTGGCTTCAGGCCGTGATGG No data
1038868369_1038868375 7 Left 1038868369 8:31464758-31464780 CCTGTTGCAGTTTACCACGGTGC No data
Right 1038868375 8:31464788-31464810 ATATCCAGGTCCCATTGGGCTGG No data
1038868369_1038868372 -7 Left 1038868369 8:31464758-31464780 CCTGTTGCAGTTTACCACGGTGC No data
Right 1038868372 8:31464774-31464796 ACGGTGCTGGTAATATATCCAGG No data
1038868369_1038868377 14 Left 1038868369 8:31464758-31464780 CCTGTTGCAGTTTACCACGGTGC No data
Right 1038868377 8:31464795-31464817 GGTCCCATTGGGCTGGCTTCAGG No data
1038868369_1038868373 2 Left 1038868369 8:31464758-31464780 CCTGTTGCAGTTTACCACGGTGC No data
Right 1038868373 8:31464783-31464805 GTAATATATCCAGGTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038868369 Original CRISPR GCACCGTGGTAAACTGCAAC AGG (reversed) Intergenic
No off target data available for this crispr