ID: 1038871254

View in Genome Browser
Species Human (GRCh38)
Location 8:31496370-31496392
Sequence CAGTGGGCACAGAGTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038871249_1038871254 -7 Left 1038871249 8:31496354-31496376 CCCACAGTCACAGTCTCAGTGGG No data
Right 1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG No data
1038871247_1038871254 11 Left 1038871247 8:31496336-31496358 CCACAGTGATAATAGTAGCCCAC No data
Right 1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG No data
1038871251_1038871254 -8 Left 1038871251 8:31496355-31496377 CCACAGTCACAGTCTCAGTGGGC No data
Right 1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038871254 Original CRISPR CAGTGGGCACAGAGTGAGGG AGG Intergenic
No off target data available for this crispr