ID: 1038880541

View in Genome Browser
Species Human (GRCh38)
Location 8:31606076-31606098
Sequence CAAAATGCTGATAGTAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038880541_1038880544 4 Left 1038880541 8:31606076-31606098 CCCTTATTACTATCAGCATTTTG No data
Right 1038880544 8:31606103-31606125 AAGCCATTCAATACATGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038880541 Original CRISPR CAAAATGCTGATAGTAATAA GGG (reversed) Intergenic
No off target data available for this crispr