ID: 1038880544

View in Genome Browser
Species Human (GRCh38)
Location 8:31606103-31606125
Sequence AAGCCATTCAATACATGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038880542_1038880544 3 Left 1038880542 8:31606077-31606099 CCTTATTACTATCAGCATTTTGG 0: 89
1: 1245
2: 1904
3: 1509
4: 1023
Right 1038880544 8:31606103-31606125 AAGCCATTCAATACATGTCTAGG No data
1038880540_1038880544 27 Left 1038880540 8:31606053-31606075 CCATCTCAGCATGAACTTCATTG No data
Right 1038880544 8:31606103-31606125 AAGCCATTCAATACATGTCTAGG No data
1038880541_1038880544 4 Left 1038880541 8:31606076-31606098 CCCTTATTACTATCAGCATTTTG No data
Right 1038880544 8:31606103-31606125 AAGCCATTCAATACATGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038880544 Original CRISPR AAGCCATTCAATACATGTCT AGG Intergenic
No off target data available for this crispr