ID: 1038883997

View in Genome Browser
Species Human (GRCh38)
Location 8:31642499-31642521
Sequence TTCCATTTCCAAACATTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038883997_1038884002 27 Left 1038883997 8:31642499-31642521 CCAGAGAATGTTTGGAAATGGAA 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1038884002 8:31642549-31642571 TCTATTCTTGTGCTTCTAAGGGG No data
1038883997_1038883999 -4 Left 1038883997 8:31642499-31642521 CCAGAGAATGTTTGGAAATGGAA 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1038883999 8:31642518-31642540 GGAAAACTCATGTTGTTTGGAGG No data
1038883997_1038884000 25 Left 1038883997 8:31642499-31642521 CCAGAGAATGTTTGGAAATGGAA 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1038884000 8:31642547-31642569 ATTCTATTCTTGTGCTTCTAAGG No data
1038883997_1038884001 26 Left 1038883997 8:31642499-31642521 CCAGAGAATGTTTGGAAATGGAA 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1038884001 8:31642548-31642570 TTCTATTCTTGTGCTTCTAAGGG No data
1038883997_1038883998 -7 Left 1038883997 8:31642499-31642521 CCAGAGAATGTTTGGAAATGGAA 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1038883998 8:31642515-31642537 AATGGAAAACTCATGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038883997 Original CRISPR TTCCATTTCCAAACATTCTC TGG (reversed) Intronic
900966269 1:5960875-5960897 TTCAGTTTCCAAAAATCCTCAGG + Intronic
902461178 1:16578224-16578246 TGCTATCTCCACACATTCTCGGG + Intronic
902654174 1:17856338-17856360 TTCCATTTCCAAAAACTCCCAGG + Intergenic
903156839 1:21450937-21450959 TTCCATTTCCAAACTATTTTGGG - Intronic
905899695 1:41573352-41573374 CACCATTTCCAAACACTCTGCGG + Intronic
907189162 1:52634005-52634027 TTCCATCTTCAAACATTCACAGG + Intronic
908248313 1:62245228-62245250 CTCCTTTTCCAAACATTATGTGG - Intronic
911886426 1:103306010-103306032 GTCCATTTTAAAACATTCTGGGG - Intergenic
913604242 1:120450347-120450369 TGCTATCTCCACACATTCTCGGG - Intergenic
913641114 1:120813058-120813080 TGCTATCTCCACACATTCTCGGG - Intronic
913990844 1:143610259-143610281 TTCTACTTCCACACATTCTCAGG + Intergenic
914277369 1:146137266-146137288 TGCTATCTCCACACATTCTCGGG + Intronic
914538417 1:148588214-148588236 TGCTATCTCCACACATTCTCGGG + Intronic
914587343 1:149074681-149074703 TGCTATCTCCACACATTCTCGGG + Intronic
914924129 1:151869261-151869283 TTCCATTTCCATATCTTCTTTGG + Intergenic
915217089 1:154347630-154347652 TTCCATTTTCAAAACATCTCTGG - Intronic
917304350 1:173611849-173611871 TTCTATTTCCTCCCATTCTCTGG - Intronic
917976438 1:180242678-180242700 TAGCATTTCCAAAGATTCTTTGG + Intronic
920869364 1:209781212-209781234 TTCCCTTCCCAGCCATTCTCAGG - Exonic
922925802 1:229345883-229345905 TTCCAAATACAAACATACTCAGG - Intergenic
923207282 1:231771323-231771345 CCCCATTTCCAAACACCCTCAGG + Intronic
923261386 1:232271238-232271260 TTCCTTTTCCCAACAGCCTCAGG - Intergenic
923473465 1:234312468-234312490 ATCCATTCCCAAACAGTATCTGG + Intronic
1063773760 10:9236201-9236223 TTCCACTTTCAAACAAACTCTGG + Intergenic
1066098228 10:32093329-32093351 TTCTATTTCCAAATATTCCATGG + Intergenic
1066459389 10:35599962-35599984 TTCCATTTCCAAAGATGCCTGGG + Intergenic
1067010850 10:42712265-42712287 TTCCATTTGCTAACATTGTGAGG + Intergenic
1067312661 10:45128944-45128966 TTCCATTTGCTAACATTGTGAGG - Intergenic
1068505232 10:57891807-57891829 GTCCATTTCTATTCATTCTCAGG + Intergenic
1071021064 10:81057314-81057336 TTTCATTTCTAAAAATGCTCTGG - Intergenic
1071092178 10:81931449-81931471 TTCAATTTCCACACAATCCCTGG + Intronic
1072152400 10:92693600-92693622 TTCTATTTCAAAATATTCTTTGG - Intronic
1072625313 10:97107610-97107632 TTCCTTTTCCAAAAATTAGCTGG - Intronic
1073243723 10:102074809-102074831 TTCCCTTTCCCAATATTCACAGG - Intergenic
1073904561 10:108262921-108262943 TCCCACTTCCAAAGCTTCTCTGG - Intergenic
1074356142 10:112785165-112785187 TTCCCTTTCCCACCATTCTGGGG - Intronic
1074398225 10:113118059-113118081 GTCCATTTCCAACCATTTCCAGG + Intronic
1074866842 10:117549159-117549181 TTCCCTTTCCTAACATCCTGAGG + Exonic
1075276265 10:121095653-121095675 TTCCATTAACAAATATTCACTGG + Intergenic
1075977451 10:126707988-126708010 TTGCATTTCTAAAAGTTCTCTGG + Intergenic
1079113342 11:17621135-17621157 TTCAATTTAAAAACATTGTCAGG - Intronic
1079997446 11:27309340-27309362 TACCAGTTCCAAACATTCCTTGG + Intergenic
1080070648 11:28081418-28081440 TACCATTTACAAACATCCTAGGG + Intronic
1080302817 11:30803338-30803360 GTCCATTTCTAAACTTACTCTGG - Intergenic
1084312972 11:68327254-68327276 TTCCATTTCCTCACAGTCTCGGG + Intronic
1084854324 11:71972280-71972302 TTCCTTTACACAACATTCTCCGG - Intronic
1085064299 11:73478958-73478980 TTCTATTTCCCAACTTTCCCAGG + Intronic
1085351264 11:75799294-75799316 TTCCCCTCCCAAACACTCTCTGG - Intronic
1086575402 11:88334300-88334322 TTCCAATTGCAAACATACTCAGG - Intronic
1087867372 11:103247514-103247536 TGACATTGCCAAATATTCTCTGG - Intronic
1088740434 11:112762535-112762557 TTCCATTTCCAGACATGCTCTGG + Intergenic
1090337519 11:125982688-125982710 TTCCATTTTTAAACATTATCAGG + Intronic
1090787548 11:130063374-130063396 TTCCTTTTCCTTACATTTTCAGG - Intergenic
1091261865 11:134241121-134241143 TTTGAGTTCCAAACATTCTCAGG - Intronic
1093297807 12:17412681-17412703 TTCCACTTAGAAACATCCTCTGG - Intergenic
1093515974 12:19987350-19987372 TTCCACTGCCAAACATTCAGTGG + Intergenic
1094574579 12:31673359-31673381 TTTCATTTCTATACACTCTCTGG - Intronic
1094580265 12:31728270-31728292 TTCCATTTCCGTACAATTTCTGG + Intronic
1098587659 12:72173200-72173222 TGCCATTTGCAATCATTATCTGG + Intronic
1098930906 12:76412255-76412277 TTCTATTTACAAACAATCTATGG + Intronic
1100202178 12:92311066-92311088 TTCCTTTCCCTACCATTCTCAGG + Intergenic
1103116511 12:118338354-118338376 TTCCAGTACCAAACAGTGTCTGG + Intronic
1104081394 12:125433396-125433418 TTCCTCTTTCAAACACTCTCCGG + Intronic
1104723112 12:131057317-131057339 TTCCCCTTCCAAGCATTCTCTGG - Intronic
1106175897 13:27331190-27331212 TTCCATTTTCAAATATTCATAGG - Intergenic
1106518712 13:30477629-30477651 TTGCATTTCCTGGCATTCTCTGG - Intronic
1107818112 13:44262366-44262388 TGCCTTTCCCAAACATTATCAGG - Intergenic
1108209764 13:48126238-48126260 GTCTATTTGCACACATTCTCAGG - Intergenic
1108922914 13:55698477-55698499 TTTGATTTCCAAATATTGTCAGG - Intergenic
1109351162 13:61183100-61183122 TTCCATTTCCAGACAAAATCAGG - Intergenic
1109725523 13:66335992-66336014 CTCCATTCCCCAACATCCTCTGG + Intronic
1109750517 13:66685413-66685435 TGGCATTTCCATACATCCTCTGG - Intronic
1109777543 13:67061784-67061806 TTACATTCTCAAACATTTTCAGG + Intronic
1110090495 13:71440431-71440453 GTACATTTACAAACATTCTCAGG + Exonic
1110837535 13:80101668-80101690 TTCCATTGCCACATCTTCTCAGG + Intergenic
1111231150 13:85345666-85345688 TTCCATTTCAAAACCTTCTTGGG - Intergenic
1111734279 13:92117755-92117777 TTCCATTTCTAAACGTTCTTTGG + Intronic
1112221166 13:97492496-97492518 TTCCCTTTCCAAATATTGTATGG - Intergenic
1113853568 13:113431582-113431604 TTCCATTTTCAAACCACCTCTGG - Intronic
1113984962 13:114306799-114306821 TTCCATTTCCAAGTGTTCTTTGG + Intergenic
1116364009 14:44038376-44038398 TTCCATTACAAAACCTTCTCAGG + Intergenic
1116504036 14:45655686-45655708 TTCCTTTTCAAAGCCTTCTCTGG + Intergenic
1116790972 14:49339554-49339576 TTCCGTGTCTAGACATTCTCGGG - Intergenic
1116988863 14:51251815-51251837 TTCCATTTCTTAAAATTCCCAGG + Intronic
1117045496 14:51809134-51809156 TTGCATTTCTAACAATTCTCAGG - Intergenic
1117284616 14:54275056-54275078 TTCCATTTACAAAGACACTCAGG - Intergenic
1117979069 14:61323811-61323833 TTTCATTTCCAGAAATTCACAGG - Intronic
1118060145 14:62128049-62128071 TTGCATTCTCAAACTTTCTCTGG + Intergenic
1118101212 14:62605369-62605391 TGTCATTTCCAAACATTTTCAGG + Intergenic
1118343911 14:64920046-64920068 TTCCATTTTTAAACATTCCCTGG + Intronic
1120199920 14:81526057-81526079 TTCCATTACTAACCACTCTCAGG - Intronic
1120622312 14:86778975-86778997 TTCAATTTTCACACATTCTGTGG - Intergenic
1120899416 14:89562742-89562764 CTCCATTTCAAAACATACCCAGG + Intronic
1122427822 14:101621939-101621961 TTCCATTTTCCCACATCCTCTGG + Intergenic
1202847406 14_GL000009v2_random:192519-192541 TTCCATGGCCAACCATTCCCAGG + Intergenic
1202916871 14_GL000194v1_random:183077-183099 TTCCATGGCCAACCATTCCCAGG + Intergenic
1202875916 14_KI270722v1_random:120-142 TTCCATGGCCAACCATTCCCAGG - Intergenic
1123673302 15:22682674-22682696 TTCTATTTCCAAACGTTGTTTGG + Intergenic
1124325359 15:28755974-28755996 TTCTATTTCCAAACGTTGTTTGG + Intergenic
1124356883 15:29002345-29002367 TTGCATTTCCATACAGTCTAGGG + Intronic
1126981456 15:54248842-54248864 TACCATTACCAAACATATTCTGG + Intronic
1127649226 15:60990491-60990513 TTTCATTTCCAATCATTCCCGGG + Intronic
1127926874 15:63554642-63554664 TGCAATTTTCAAACATTCTATGG - Intronic
1128251076 15:66164824-66164846 TTCCAATTTCAAATGTTCTCTGG - Intronic
1130148052 15:81290293-81290315 TTCCATTTCCAGAAATACCCCGG - Intronic
1132050693 15:98605565-98605587 TTCCATTTTCTAACAATCCCAGG + Intergenic
1133508492 16:6434981-6435003 TTCCATTTATTAACATTCTTTGG + Intronic
1133619049 16:7508598-7508620 TTCCATTTCCAATCATACCTTGG - Intronic
1135798212 16:25466503-25466525 TTCTATTTCCATTCCTTCTCAGG + Intergenic
1136691503 16:32034621-32034643 CTCCATTTCCAAACACTTTGTGG - Intergenic
1136792092 16:32978186-32978208 CTCCATTTCCAAACACTTTGTGG - Intergenic
1136877725 16:33875722-33875744 CTCCATTTCCAAACACTTTGTGG + Intergenic
1140155601 16:72422743-72422765 TACCAATTCTAAACAATCTCAGG - Intergenic
1141227324 16:82130242-82130264 TTTCAGTGCCAAAGATTCTCAGG + Intergenic
1141271893 16:82548798-82548820 TTCCAATACCCAACAGTCTCTGG - Intergenic
1141532989 16:84659638-84659660 TCCCTTTCCCAAACATTCTCCGG + Intronic
1141955128 16:87365653-87365675 ATGCATTTCCAAACAATTTCTGG + Intronic
1203094301 16_KI270728v1_random:1239650-1239672 CTCCATTTCCAAACACTTTGTGG - Intergenic
1143662731 17:8336718-8336740 TCCCAAGTCCAAGCATTCTCTGG - Intergenic
1143795960 17:9336945-9336967 TTTCAATTCCAATCATTCCCTGG + Intronic
1144051428 17:11500297-11500319 TTCCATCTCTAAACATTCTGGGG - Intronic
1154002422 18:10493810-10493832 TTCACCTTTCAAACATTCTCAGG + Intergenic
1155287162 18:24301858-24301880 TAACATTTCCTCACATTCTCTGG + Intronic
1155443362 18:25884911-25884933 TGACATTTCCAAACATGCCCTGG + Intergenic
1155823640 18:30410089-30410111 TTTTATTTCCATGCATTCTCAGG - Intergenic
1157985594 18:52434650-52434672 TTGCATTTCCAAAGGGTCTCTGG - Intronic
1159696891 18:71571015-71571037 TTCCATTTCCTAAGATGTTCTGG - Intergenic
1159762497 18:72445647-72445669 GTATTTTTCCAAACATTCTCTGG - Intergenic
1161182972 19:2897706-2897728 TTCCATTGCTAAAATTTCTCTGG + Intergenic
1161650613 19:5482128-5482150 ATCCATTTCTAAGCCTTCTCGGG + Intergenic
1162172849 19:8804937-8804959 TTCCATGTTCTAACATTCCCTGG + Intergenic
1165383966 19:35499774-35499796 CTCCACTTCCAAACTGTCTCAGG + Intronic
1168247124 19:55117864-55117886 CTCCATTTCCCAGCATTCCCCGG - Intergenic
1202674749 1_KI270710v1_random:32690-32712 TTCCATGGCCAACCATTCCCAGG + Intergenic
1202677613 1_KI270711v1_random:21964-21986 TGCTATCTCCACACATTCTCGGG + Intergenic
925197689 2:1939989-1940011 TTCCATTGCCACAGATTCTCTGG - Intronic
925827285 2:7861969-7861991 TTCCTTTTTCAAGCATGCTCTGG + Intergenic
927357285 2:22187791-22187813 TTCCATTTGCAAAATTTCCCAGG - Intergenic
929747595 2:44675041-44675063 TTCTGTTTGCAAACATGCTCGGG + Intronic
929750875 2:44711992-44712014 TTGCATTTCCTTACATGCTCTGG + Intronic
929844795 2:45512724-45512746 TTACATTGCCAAAGATTCACTGG + Intronic
930384326 2:50674631-50674653 TTCTACTCCCAAACACTCTCAGG - Intronic
930781117 2:55225411-55225433 TTCCTTTTTCAAACATTAGCTGG - Intronic
931896641 2:66738915-66738937 TTCCATTTCCATATCTTCTCTGG + Intergenic
932147379 2:69334752-69334774 TTCCATTTACAAAAATTTTCTGG + Intronic
934146307 2:89098101-89098123 TTACATTTGCAAATATTTTCAGG - Intergenic
934148036 2:89115594-89115616 TTACATTTGCAAATATTTTCAGG - Intergenic
934221249 2:90085015-90085037 TTACATTTGCAAATATTTTCAGG + Intergenic
934222958 2:90102473-90102495 TTACATTTGCAAATATTTTCAGG + Intergenic
936289145 2:111206183-111206205 TTTCATTTTTAAACATTCCCAGG + Intergenic
936454608 2:112662776-112662798 CTCCTTGTCCAAACAGTCTCAGG + Intronic
937625005 2:124034356-124034378 TTCCATTTTCAAACAAAGTCTGG + Intronic
938375164 2:130800046-130800068 ATCCATTTCCACACATTTACTGG - Intergenic
939557920 2:143699437-143699459 TTCCACTTTCACACATTCTTGGG - Intronic
940202443 2:151166539-151166561 CTAGATTTCCACACATTCTCTGG - Intergenic
943836086 2:192515719-192515741 TTTCTTTTCTAAAGATTCTCTGG + Intergenic
945246427 2:207721703-207721725 TTCTAGTTTCAAACATTCTTAGG + Intronic
947109955 2:226707964-226707986 CTCCATTTCCACACAAACTCAGG + Intergenic
947896700 2:233681012-233681034 TTTCATTTCCAAATCTTCTGAGG - Intronic
1169691272 20:8334883-8334905 TGCCATTGCAGAACATTCTCAGG + Intronic
1170535767 20:17339239-17339261 CTCCACTTCAAAACATGCTCAGG - Intronic
1170676660 20:18488221-18488243 TTTCATTTCCCAACATTTTTTGG - Exonic
1171445222 20:25197962-25197984 TTCCGTTTACACACATTCCCAGG + Intronic
1172080128 20:32333862-32333884 GTCCCTTTCCAAGCAGTCTCTGG + Exonic
1172834713 20:37865645-37865667 TTGTATTTCGAAGCATTCTCGGG - Intronic
1175553627 20:59832572-59832594 TTGCATTTGCAAACACTCTCCGG - Intronic
1175699839 20:61128977-61128999 TTCCATCTTCAAACATGCTGTGG + Intergenic
1176079656 20:63265857-63265879 GTCCACTTCCAAACAATCACCGG - Intronic
1179615840 21:42582688-42582710 CTCCATTTCCAAAAGTTCTCAGG - Intergenic
1180570606 22:16714520-16714542 TTCCATAAGCAAACATTCACTGG + Intergenic
1181781602 22:25197790-25197812 TTTCATTACCAGACATGCTCTGG - Intergenic
1181782298 22:25201977-25201999 TGCCCTTTCCAAACCATCTCCGG + Intronic
1182213578 22:28697369-28697391 TTCCCTTTAAAAATATTCTCAGG - Intronic
1182650383 22:31846869-31846891 GCCCATTTCCACGCATTCTCTGG + Exonic
1183757942 22:39787948-39787970 TTCCCATTCCAAAAATTCTAAGG + Intronic
1184710057 22:46244501-46244523 TTCCTTTTCCAAACATGAGCTGG + Exonic
952289414 3:32000910-32000932 TTCCAGTTCCAAAGATTTCCAGG - Intronic
953866313 3:46586264-46586286 TCCCATTTGTCAACATTCTCTGG + Intronic
954731133 3:52663231-52663253 TTTCATTTCCAAGGCTTCTCTGG + Intronic
955898454 3:63726157-63726179 TAGCATTTCAAAACATTCTAAGG + Intergenic
956680431 3:71774489-71774511 TTCCATTTCCAAAATTGTTCTGG + Exonic
957107960 3:75915174-75915196 TTCCATAAGCAAACATTCACTGG - Intronic
959186820 3:103055744-103055766 TTCCATTTCCCAACAACCTCTGG - Intergenic
959563849 3:107814523-107814545 TTACGTTTCCAAATATTCTTAGG - Intergenic
962274552 3:134002143-134002165 TGCCATTTCCAAACTATCTGGGG + Intronic
963574364 3:147041336-147041358 TCCCACTTCCAAGGATTCTCAGG + Intergenic
963778544 3:149464285-149464307 TTCCAGTTCCAACCATGATCTGG + Intergenic
963804528 3:149709960-149709982 TTCCGTTCCTAAACTTTCTCAGG - Intronic
965847469 3:172981043-172981065 TTCATTTTCTATACATTCTCAGG + Intronic
966225718 3:177595813-177595835 TTCCATTCCCAATCATCCTTTGG + Intergenic
971575150 4:28263439-28263461 TTCCTTTTTCATATATTCTCGGG + Intergenic
972525434 4:39905710-39905732 AGACACTTCCAAACATTCTCAGG + Intronic
978143280 4:105341887-105341909 TTGAATTTCCAAAAATTCTCAGG - Intergenic
978459503 4:108935652-108935674 TTTCATATCAAAACTTTCTCAGG - Intronic
979749807 4:124264836-124264858 TTTCATTTCCAAAGATACTTAGG + Intergenic
980052215 4:128049888-128049910 TTCCTTTTCCTTACATTGTCAGG - Intergenic
980317779 4:131226122-131226144 TTCTATTTTCAAAAATTTTCTGG - Intergenic
981294354 4:143114001-143114023 TTCAATTTCCATATTTTCTCAGG - Intergenic
982660092 4:158196369-158196391 TTCCAATTTCAAATATTCTAAGG + Intergenic
984381680 4:179000759-179000781 ATTCTTTTCCAAAGATTCTCTGG + Intergenic
984451072 4:179902949-179902971 TTCAATTTTAAAATATTCTCTGG + Intergenic
984670174 4:182474527-182474549 CCCCGTTTCCAGACATTCTCAGG + Intronic
986139727 5:5018225-5018247 TTCCTCTCCCAAGCATTCTCTGG + Intergenic
986363263 5:7002784-7002806 TTAGACTTCCAAAGATTCTCAGG + Intergenic
986817116 5:11425101-11425123 TTCCATTGCCATATGTTCTCAGG + Intronic
988609032 5:32708559-32708581 TCCCATTTAAAAATATTCTCAGG + Intronic
988616500 5:32780143-32780165 TTGTTTATCCAAACATTCTCTGG - Intronic
989090052 5:37721150-37721172 TTCCAGTTCCAACCATGATCTGG - Exonic
990972799 5:61528034-61528056 TTTTATTTCCAACCATTCTTAGG + Intronic
992621329 5:78596202-78596224 TTCAATTTCCAAAATTTGTCGGG - Intronic
993104838 5:83588450-83588472 TTACATTTCCTTAAATTCTCAGG + Intergenic
993658628 5:90602919-90602941 TTCCATTTCAAAACACTTTCAGG + Intronic
994520811 5:100832415-100832437 TTTCATTTTCAAACATGCTTTGG + Intronic
995181087 5:109230868-109230890 TTGCTTATCCTAACATTCTCGGG + Intergenic
996331447 5:122333921-122333943 TTCCATTTCCCCACAATTTCTGG - Intronic
996397772 5:123030938-123030960 TTCCCTTCCTAAACATTCACAGG - Intronic
996641636 5:125761804-125761826 AGCCATTTCCATACATCCTCTGG - Intergenic
996644427 5:125796859-125796881 TTCCTCTCCAAAACATTCTCAGG + Intergenic
998502882 5:142648764-142648786 CTCCAGTGACAAACATTCTCAGG - Intronic
1000676659 5:164130168-164130190 TTCCAACACCAGACATTCTCAGG + Intergenic
1001712344 5:173788986-173789008 TTCCACTTCCAAACCTTCCTTGG - Intergenic
1001970605 5:175952285-175952307 TTTGATTTTCTAACATTCTCAGG - Intronic
1002246832 5:177891480-177891502 TTTGATTTTCTAACATTCTCAGG + Intergenic
1003137065 6:3441767-3441789 TTCAATTTCCCAACCGTCTCCGG + Intronic
1003729408 6:8804326-8804348 TTCCATTTCTAAAAATTCCTGGG - Intergenic
1004466436 6:15889622-15889644 TTCCATTGCCTAACATCTTCTGG - Intergenic
1005165327 6:22913257-22913279 ATACATTTGCAAACATTGTCTGG + Intergenic
1008253538 6:49269695-49269717 TTCCATTTTCAATCATTAGCTGG - Intergenic
1008911417 6:56738125-56738147 TTCCATTTCCTATCACTGTCAGG + Intronic
1008959695 6:57253836-57253858 TTCCACTTTCCAACTTTCTCTGG - Intergenic
1009297288 6:61968295-61968317 ATGCATTGCCAAACATTTTCAGG - Intronic
1010873117 6:81065690-81065712 ATCCATTTCCCAAGTTTCTCAGG + Intergenic
1014210674 6:118704902-118704924 TTCCATTTTTAAAAATTCACAGG + Intronic
1014829254 6:126081954-126081976 TTCCTTTTCAAAACAGTTTCTGG + Intergenic
1014945922 6:127497385-127497407 TTCCTTATCCAAACATTCAGGGG + Intronic
1015029464 6:128576834-128576856 TTGCATTTCTAAACATTTCCAGG - Intergenic
1015764422 6:136700752-136700774 TACCATATCCAATAATTCTCAGG - Intronic
1015944554 6:138486690-138486712 TGACTTTTCCAAACATTTTCAGG + Intronic
1016014824 6:139173014-139173036 TGCAATTCCCAAACATTCCCAGG - Intronic
1016076491 6:139802795-139802817 CTTCATTTCCAAACATTTTGTGG + Intergenic
1018115785 6:160583877-160583899 TTCCCTTTCTAAACTATCTCAGG + Intronic
1018614644 6:165675567-165675589 TTCCATTTTCAGATTTTCTCTGG - Intronic
1020000317 7:4751893-4751915 TTCCACTTGAAATCATTCTCTGG + Intronic
1020872653 7:13651336-13651358 CTCCATTACAAACCATTCTCTGG - Intergenic
1021549667 7:21856581-21856603 TTCAATTTGCCAACATTTTCTGG - Intronic
1023692683 7:42807683-42807705 TTCCAGGTTCAAGCATTCTCCGG - Intergenic
1024535555 7:50428269-50428291 CTCCATTTCCAAGCTTACTCGGG + Intergenic
1026126036 7:67580441-67580463 TTCCAATTCCAGCTATTCTCAGG - Intergenic
1026647909 7:72188685-72188707 TTCTATTTCCATACATTTTTGGG - Intronic
1026997466 7:74627430-74627452 GTCCATTTCCAAACAGTCTAAGG + Intergenic
1028334900 7:89639733-89639755 TTCCATTACCAAATATCCTCTGG - Intergenic
1030511984 7:110493944-110493966 TTCCATTTCAAAACACTCTAGGG - Intergenic
1031078019 7:117231429-117231451 TTACATTTCCAAGCCTTCCCTGG - Intergenic
1031429043 7:121643381-121643403 TTCTATATCCTCACATTCTCAGG - Intergenic
1033677855 7:143561526-143561548 TGCCATTTAAAAACAATCTCGGG + Intergenic
1036145309 8:6249677-6249699 TTCTATTTCCAAACATTAGGAGG - Intergenic
1036412148 8:8512313-8512335 TTCCTTATCCAAATATTCACTGG - Intergenic
1038883997 8:31642499-31642521 TTCCATTTCCAAACATTCTCTGG - Intronic
1039106616 8:33996617-33996639 TTCCAACTCCAAATATTCCCAGG - Intergenic
1039980847 8:42408935-42408957 GTCCATTTCCCCACATCCTCAGG + Intergenic
1041814952 8:61959885-61959907 TTCCATTTCTACAAATTCTCTGG - Intergenic
1042314193 8:67408175-67408197 TTGCATTTCTTAACATTCCCAGG + Intergenic
1044425212 8:92042142-92042164 TTTCATATGTAAACATTCTCTGG + Intronic
1044789784 8:95835547-95835569 TTCCATTCTCAAACATTCTATGG + Intergenic
1047865585 8:129020830-129020852 TTTCCTGTCTAAACATTCTCAGG + Intergenic
1049027920 8:140009518-140009540 CCCCATTTCCACAGATTCTCAGG + Intronic
1050082096 9:1926470-1926492 CTCCACTTCCAAATGTTCTCTGG + Intergenic
1050838127 9:10110577-10110599 CTCCATTTTGAAACAATCTCAGG - Intronic
1051081399 9:13298525-13298547 TATCATTTCAAAACATTCTGAGG - Intergenic
1051256662 9:15220677-15220699 TTTCATTTCCAAATAATTTCAGG + Intronic
1051571992 9:18569211-18569233 ATCCAATTCAAAACATTTTCTGG - Intronic
1052128704 9:24813582-24813604 TTCCATCTCTAAATATTCTCCGG - Intergenic
1056376999 9:86024486-86024508 CTCCCTTTTCAACCATTCTCAGG - Intergenic
1056702100 9:88919197-88919219 TTCCTTTTCTACACATTGTCAGG + Intergenic
1057820595 9:98327513-98327535 TTGCATTTCCAAAACTTCTTTGG - Intronic
1058546814 9:106069398-106069420 TTCCATTTTCAAACACACTTAGG - Intergenic
1058914911 9:109556382-109556404 TGTCATTTCAAAACATGCTCAGG + Intergenic
1059966134 9:119616167-119616189 ACCCACTTCCAAACTTTCTCAGG + Intergenic
1203652563 Un_KI270751v1:141311-141333 TTCCATGGCCAACCATTCCCGGG + Intergenic
1188323761 X:28774028-28774050 TTTCATTTCAAAACTTTTTCTGG + Intronic
1188927779 X:36067020-36067042 CTCCATCTTCAAACTTTCTCTGG + Intronic
1189733661 X:44047869-44047891 TACCATTTCTAATGATTCTCAGG - Intergenic
1190690831 X:52911691-52911713 TTCTATTTCCTTACATTCTCCGG - Intergenic
1190695152 X:52944101-52944123 TTCTATTTCCTTACATTCTCCGG + Intronic
1196321597 X:114347119-114347141 TCCCATATCCAAAAATACTCTGG + Intergenic
1196697794 X:118632802-118632824 TTCATTTGCCAAACATTTTCAGG + Intronic
1197156199 X:123272847-123272869 GTCCATTTACAAACATTCCCTGG + Intronic
1197431763 X:126376038-126376060 TTGCATCTCCCAACATTCCCAGG - Intergenic
1198215391 X:134550082-134550104 TTCCTTTCCCAAACCATCTCAGG - Intergenic
1198712043 X:139514936-139514958 TTCCATTTCCTCACATTTTTTGG - Intergenic
1200287795 X:154840132-154840154 TTCCCTTTCCTAACAATCTGTGG + Intronic
1201172499 Y:11282466-11282488 TTCCATGGCCAACCATTCCCAGG + Intergenic
1201369682 Y:13249186-13249208 TTCCATTCACAAATATTTTCAGG + Exonic