ID: 1038884000

View in Genome Browser
Species Human (GRCh38)
Location 8:31642547-31642569
Sequence ATTCTATTCTTGTGCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038883997_1038884000 25 Left 1038883997 8:31642499-31642521 CCAGAGAATGTTTGGAAATGGAA 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1038884000 8:31642547-31642569 ATTCTATTCTTGTGCTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038884000 Original CRISPR ATTCTATTCTTGTGCTTCTA AGG Intronic
No off target data available for this crispr