ID: 1038884429

View in Genome Browser
Species Human (GRCh38)
Location 8:31647768-31647790
Sequence TCATTCCCATCCATAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038884425_1038884429 3 Left 1038884425 8:31647742-31647764 CCGGACAATCCTTTCCTCTGTTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG No data
1038884422_1038884429 14 Left 1038884422 8:31647731-31647753 CCCGGACACCTCCGGACAATCCT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG No data
1038884426_1038884429 -6 Left 1038884426 8:31647751-31647773 CCTTTCCTCTGTTGTCTTCATTC 0: 1
1: 0
2: 3
3: 78
4: 648
Right 1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG No data
1038884423_1038884429 13 Left 1038884423 8:31647732-31647754 CCGGACACCTCCGGACAATCCTT 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG No data
1038884424_1038884429 6 Left 1038884424 8:31647739-31647761 CCTCCGGACAATCCTTTCCTCTG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1038884429 8:31647768-31647790 TCATTCCCATCCATAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038884429 Original CRISPR TCATTCCCATCCATAGAGAT GGG Intronic
No off target data available for this crispr