ID: 1038885718

View in Genome Browser
Species Human (GRCh38)
Location 8:31660564-31660586
Sequence ACAGAAGTTACCCAAAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038885718_1038885720 -7 Left 1038885718 8:31660564-31660586 CCCTATCTTTGGGTAACTTCTGT 0: 1
1: 0
2: 2
3: 16
4: 193
Right 1038885720 8:31660580-31660602 CTTCTGTACTAACAAAACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038885718 Original CRISPR ACAGAAGTTACCCAAAGATA GGG (reversed) Intronic
901392314 1:8954726-8954748 ACAAAAATAACCCAAAAATATGG - Intronic
901827254 1:11870269-11870291 ACAGAAGCTCCCCCAAGACAGGG - Intergenic
902520961 1:17016142-17016164 ACAGAAGCTATCCACAGACATGG + Intergenic
902744856 1:18467007-18467029 ACAGATGCTACCCAGAGATAAGG + Intergenic
902849952 1:19147407-19147429 ACAGAAGCTAACCAAAGCTCTGG + Intronic
908177555 1:61570845-61570867 ATAGAAGTTATCCAAGGGTAAGG - Intergenic
908309240 1:62859683-62859705 AAAAAAGTTACAGAAAGATATGG - Intronic
911880729 1:103235727-103235749 TGAGAAGATACCCAAAAATATGG + Intergenic
913546926 1:119878246-119878268 ACAAAAATTACTCAAAGGTATGG - Intergenic
914239413 1:145842681-145842703 AAAGAAGTTACCCACACCTATGG + Intergenic
914866408 1:151433626-151433648 AAAGAATTTTCCCAAAAATATGG + Intronic
919017719 1:192061814-192061836 ACAGATGTTTCTCATAGATAAGG - Intergenic
919045143 1:192441940-192441962 CCATAAGTTACCCAAAGATAAGG + Intergenic
919409982 1:197230766-197230788 ACATAATTTACCCAAAGAAAAGG + Intergenic
919416636 1:197318812-197318834 ACAGTAGTTGCCACAAGATAGGG + Intronic
919460972 1:197876514-197876536 ACAGGAATTAACCAAGGATAAGG - Intergenic
920860661 1:209703678-209703700 ACAGAATTTACACAAGGTTAAGG - Intronic
922468248 1:225859567-225859589 CCAGAACCTACCCAAAGAGATGG + Intronic
1062802029 10:387930-387952 ACAGAATTTCCACCAAGATACGG - Intronic
1064513121 10:16116776-16116798 ACAGAAATTCACCAAAAATATGG + Intergenic
1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065522314 10:26584709-26584731 CCAGAAGATGCCCAAAGATAGGG + Intergenic
1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065528793 10:26648266-26648288 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065558110 10:26936731-26936753 CCAGAAGACACCCAAAGGTAGGG - Intergenic
1067430827 10:46243650-46243672 ACACAACATACCCAAACATATGG + Intergenic
1067672247 10:48333846-48333868 CCAGAAGATGCCCAAAGGTAGGG - Intronic
1068129314 10:52877625-52877647 ACAGAAGCTACTTAAAGATATGG - Intergenic
1071214932 10:83390184-83390206 ACAGATGTTCATCAAAGATATGG - Intergenic
1071664317 10:87539367-87539389 GCAGAAGTATCCCAAAGAAAAGG - Intronic
1073459163 10:103656174-103656196 AGAAAAGTTACCCAAAAACATGG - Intronic
1074514358 10:114151109-114151131 TCAGCAGTTACACAAAGAGATGG - Exonic
1075600520 10:123764772-123764794 ACAGAAGAAACCCAAAGAAAGGG - Intronic
1077892167 11:6426862-6426884 AAAGCAGTTACCCAAAAATCGGG - Intergenic
1078756875 11:14219482-14219504 ACAGAAGTGACCCTGAGATCTGG + Intronic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1084984834 11:72859747-72859769 GAAGAAATTACCCAAAGCTAGGG + Intronic
1086810833 11:91308281-91308303 ACAGAAGTTACCTACCGGTATGG + Intergenic
1087082923 11:94189119-94189141 AAAGAAATTACCCAAAACTATGG + Intergenic
1090037435 11:123261109-123261131 AAAGAATTTGCCCAAAGATAAGG + Intergenic
1092510960 12:9156254-9156276 ACTGAAGTTTCCCAAAGCGAAGG - Intronic
1093710639 12:22326419-22326441 ACAGAATTTGTCCAAAGACATGG + Intronic
1093943626 12:25082905-25082927 ACAGAAATTACCAAAAGGAATGG + Intronic
1094631874 12:32183786-32183808 TCAGATGTTACTCACAGATAAGG - Intronic
1098705856 12:73688297-73688319 ACACAAGATACCCAAACTTATGG + Intergenic
1099013271 12:77317369-77317391 AAATAAGTTACCCAAAAACATGG - Intergenic
1100786641 12:98085838-98085860 ATAGTATTTACCCCAAGATAAGG - Intergenic
1100796109 12:98183336-98183358 TCAGATGTTAGCCAAAGATGGGG - Intergenic
1103882854 12:124179848-124179870 GCAGAAGTTAGCCATAGAGATGG + Intronic
1104608210 12:130205287-130205309 ACTCAAGTTACCCAAAGCTCCGG + Intergenic
1105941164 13:25149258-25149280 ACTGAAGCTACACAAAGAAAAGG - Intergenic
1107398019 13:40038613-40038635 ACAGGTGTTATGCAAAGATATGG + Intergenic
1107627539 13:42305230-42305252 ACAGAAGCTACTCAAAAATCTGG - Intronic
1107864900 13:44694110-44694132 AAAAAAGTTGCCCAAAGCTATGG + Intergenic
1109010084 13:56929202-56929224 AGAAAAGTTATCCAAACATATGG - Intergenic
1111868282 13:93797327-93797349 ACAGAGGTTAGACAAAGCTAAGG + Intronic
1113361094 13:109632292-109632314 AAAGAAGTTAACAAATGATATGG - Intergenic
1114687663 14:24549232-24549254 TCAGAAGATACCCAAAAATGTGG - Intergenic
1115457793 14:33624686-33624708 ACATAATTTACCAAAATATAAGG - Intronic
1115920084 14:38363170-38363192 ACAGCTGTTACCCATTGATAAGG + Intergenic
1116502786 14:45640407-45640429 AAAGAAGATAAACAAAGATAAGG + Intergenic
1117744724 14:58857557-58857579 ACACAAGCTACCAAAAGCTATGG - Intergenic
1118527944 14:66667130-66667152 TCAGAAATTACACAAAGAAATGG + Intronic
1119163978 14:72477079-72477101 ACAGCAGTTACCCCAAGGCATGG - Intronic
1119738144 14:76997179-76997201 ACAGATGTTACCCTAAAATAGGG + Intergenic
1120335898 14:83154672-83154694 ACAGAACTAAACCAAAAATAAGG + Intergenic
1122927365 14:104911588-104911610 ACAGAAGATACAAAAACATAAGG + Intergenic
1124238393 15:28009144-28009166 ACAGAAGTCACAGAAACATAAGG + Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127555305 15:60081892-60081914 ACAGAAGTTACTCTAACAGAAGG + Intergenic
1127933232 15:63611549-63611571 CCAGAAGGAACCCAAAGATGTGG - Intronic
1128642241 15:69348152-69348174 ACAGAGGTGTCCCAAAGTTAGGG - Intronic
1129444543 15:75607794-75607816 ACAGGAGTTCCCGAAAGAGAAGG + Intronic
1132081671 15:98871215-98871237 TCAGAGGTTACTCAAAGTTACGG - Intronic
1137445598 16:48529963-48529985 ACAGCAGTGACCGAAAGACATGG - Intergenic
1137821796 16:51453018-51453040 CCAGAAGCAACCCAAAGACAAGG - Intergenic
1138138616 16:54546708-54546730 ACTGAAGTTGCCCAAACAAATGG + Intergenic
1138221380 16:55254487-55254509 ACAGAAGTTTAACAAAGTTATGG - Intergenic
1139040974 16:62998544-62998566 ACAGAAGTTCCCCCTAGGTAGGG + Intergenic
1139073582 16:63415180-63415202 ACAAAAGCTACCCAGAAATAAGG - Intergenic
1140155202 16:72417773-72417795 GAAGAAGTTAAGCAAAGATAGGG - Intergenic
1144560450 17:16316696-16316718 AGGGAAGTTACCTAAAGGTAAGG + Exonic
1147046539 17:37756259-37756281 CCAGAAGTTCCTCAAAGACAGGG + Intergenic
1147992214 17:44341468-44341490 ACAGAAGTTAACCATGGATGAGG + Intergenic
1149818844 17:59754577-59754599 AAAGAAATTACCAAAAGTTAAGG + Intronic
1150498831 17:65630497-65630519 ACAGAACCTACCCAGAGACAAGG - Intronic
1155245510 18:23904830-23904852 ACAGAAATTACCCATATCTAGGG - Intronic
1155563878 18:27111143-27111165 AAAGAAGTTACCTACAAATAAGG - Intronic
1155721192 18:29013914-29013936 AAAGATGTTACACAAAAATAAGG - Intergenic
1157233128 18:45938158-45938180 ACAGGAGTAATCTAAAGATAAGG + Intronic
1159323107 18:66880549-66880571 ACAGAAGTGAACCACAGCTATGG - Intergenic
1165394006 19:35554165-35554187 ACTGAAGATACACAGAGATAGGG - Intronic
926617338 2:15010328-15010350 ACAGAAGTTCCCCAAATCAAGGG - Intergenic
928115159 2:28540860-28540882 ACAGAAGAGACCCCAAGAGAGGG + Intronic
928711702 2:34014350-34014372 ACAGAATTAACCCAAGGATTAGG - Intergenic
929439311 2:41952840-41952862 AGAGAAGATACCCAAAGAGCAGG + Intronic
931917010 2:66967292-66967314 AGAGAAGGGACCCACAGATATGG - Intergenic
933403755 2:81831719-81831741 ACACAACTTACCAAAATATATGG + Intergenic
934982507 2:98855530-98855552 ACAAAAGTTATCCAAAAAAAAGG + Intronic
935529611 2:104216370-104216392 ACTGAACTTACCCAAAGGTTAGG + Intergenic
937743082 2:125378622-125378644 AGTGAAGTTACCCAAAGACTTGG - Intergenic
939793660 2:146614234-146614256 ACAGAAATTAAGAAAAGATAAGG - Intergenic
939934816 2:148278497-148278519 ATACAAATTACCCAAAGAAATGG - Intronic
940039222 2:149342312-149342334 ATAGAAATTACCCACTGATATGG - Intronic
941756520 2:169192360-169192382 AAAAAAGTTACCAAAATATAAGG - Intronic
943192318 2:184694889-184694911 ACAGAACTTCCCCACAGATCAGG - Intronic
944995986 2:205294241-205294263 CCAGAATCTACCCACAGATAAGG + Intronic
947702098 2:232243049-232243071 ACAGAAGTGCCCCAAAGGTGAGG + Intronic
1170613971 20:17934632-17934654 TCAGCAGTTTCCCAAAGATCGGG - Intergenic
1171118808 20:22550385-22550407 TGAAAAGTTACCCAAAAATATGG - Intergenic
1173324689 20:42021918-42021940 AAAGAAGAGACCCAAAGAGAAGG - Intergenic
1174509211 20:51038260-51038282 AAAGAACTTGTCCAAAGATATGG - Intergenic
1177139591 21:17343928-17343950 AGAAAAGTTACCCAAAAATGTGG + Intergenic
1177320827 21:19518120-19518142 ACTGAGGTTACCCTAAGACATGG - Intergenic
1177673085 21:24258988-24259010 AAAAAAATCACCCAAAGATATGG - Intergenic
1183765032 22:39865287-39865309 ACAGCAGTTCACCAAACATAGGG + Intronic
950137488 3:10591910-10591932 AGACAAGATACCCAAAGGTAAGG + Intronic
951316613 3:21194921-21194943 ACAGTATTTACCCAAAGGTATGG - Intergenic
951509410 3:23484965-23484987 TCAGTAGTTACCCACTGATATGG - Intronic
951799108 3:26575481-26575503 AAAGAAGTTATCCTAAGAGATGG - Intergenic
951887598 3:27539367-27539389 TCAGAAGTTCCTCATAGATAAGG - Intergenic
952072266 3:29652028-29652050 TCAGTAGTTATCCAAAGAGAAGG - Intronic
952359217 3:32613204-32613226 AGAGAATTTACCAAAAGATTTGG + Intergenic
955631001 3:60974944-60974966 ACAGAAGTTTCCAAAAAAGAAGG + Intronic
955825494 3:62942244-62942266 ACAGAAATAACCTCAAGATATGG - Intergenic
958768013 3:98394460-98394482 ACACAAGTCAGCCAAAGAGAAGG + Intergenic
959475355 3:106804643-106804665 TCAAAAGTTGGCCAAAGATAGGG - Intergenic
962156607 3:132954984-132955006 ACGAAAGTAACCCACAGATATGG - Intergenic
962776912 3:138669790-138669812 ACAGAAGGTACCTCAAGATTTGG + Intronic
965444694 3:168760644-168760666 ACACAACTTACCAAAACATATGG - Intergenic
966589346 3:181663552-181663574 ACAGAAGTTGCTCAAGTATATGG - Intergenic
970482082 4:16486370-16486392 ATAGAAGTTAGCCACAGAAAGGG + Intergenic
971269449 4:25127253-25127275 AAAGAAATTACCTAAAGATATGG + Exonic
971785793 4:31100637-31100659 ACAGAAGTAATCCAAATTTATGG + Intronic
971868767 4:32208434-32208456 AGAGTTGTTACCCAAAGATTAGG - Intergenic
974107033 4:57481355-57481377 ACAGCAGTTACCAGAAGATGGGG + Intergenic
976153604 4:82118474-82118496 ACAGAAGTAACTCAAAGGAAGGG + Intergenic
979395365 4:120181444-120181466 ACACAACATACCCAAACATATGG + Intergenic
981364299 4:143884215-143884237 CCAGTAGTTAGGCAAAGATAGGG - Intronic
981385412 4:144124705-144124727 CCAGTAGTTAGGCAAAGATAGGG - Intronic
983078966 4:163361771-163361793 ACACAAGTTACCCAGAGTTGAGG - Intergenic
984118545 4:175712806-175712828 ACAGAAGTGATCAAAAAATATGG + Intronic
984594957 4:181656280-181656302 ACAGAAGCCAGCCAAAGAAAGGG + Intergenic
985434648 4:189917086-189917108 CCAGAAGACACCCAAAGGTAAGG - Intergenic
987984790 5:25133234-25133256 TGAGAAGATACCCAAAAATATGG + Intergenic
993174651 5:84468348-84468370 ACAGTATTTAGCCCAAGATAGGG - Intergenic
994952469 5:106481996-106482018 ACAGAGGTTTCCAAAAGACATGG - Intergenic
995551688 5:113287980-113288002 AGAGAAGTTACTCAAAGACCAGG - Intronic
996139380 5:119887431-119887453 ACAGAATTTACTGATAGATAGGG - Intergenic
997830347 5:137144268-137144290 ACAGGAGTTAGCCTAAGGTAGGG - Intronic
999087141 5:148902883-148902905 ACAGAAATTAGGCAGAGATAAGG + Intergenic
1000361727 5:160453865-160453887 ACCTAAGTTACCCTAAGATGTGG - Intergenic
1001917670 5:175575256-175575278 ACAGAAGTTACCTACAGGTTGGG - Intergenic
1002678582 5:180940362-180940384 ACACAAGATACCAAAACATATGG + Intronic
1003559968 6:7172289-7172311 TCAGAAGATACCCAAAGAGGAGG + Intronic
1005172796 6:23007389-23007411 ACTGAGTTTACCCAAAGCTAAGG + Intergenic
1005435393 6:25805338-25805360 ACACAAGTTACCAAAACATCTGG + Intronic
1005442322 6:25883297-25883319 ACAGAGGTTACCAAACGTTACGG + Intergenic
1005665501 6:28049471-28049493 ACAGAAGCTTCAAAAAGATAGGG + Intergenic
1008726283 6:54424931-54424953 ACAGAGGTTACTAAAAGAAATGG - Intergenic
1008751907 6:54745207-54745229 CTAAAAGTTTCCCAAAGATATGG - Intergenic
1009479424 6:64138419-64138441 TCAGAATTCACACAAAGATAGGG + Intronic
1009953796 6:70427180-70427202 ACTGAAGTCACCCAACAATAGGG + Intronic
1010596000 6:77764923-77764945 ACAGAATTTACCGAAACCTATGG + Intronic
1012613262 6:101242824-101242846 AAATAAGTTGCCCAAAGATTAGG + Intergenic
1012672517 6:102073236-102073258 AAAGAAAAGACCCAAAGATAGGG - Intergenic
1014511549 6:122328580-122328602 ACAGTAGTTACTCAAAGAGAGGG - Intergenic
1014904572 6:127010718-127010740 ACAGAAATGTCCCATAGATAAGG + Intergenic
1015228168 6:130882663-130882685 ACAGAAGTAGCCCAAAGATGAGG + Intronic
1015602008 6:134919701-134919723 AAAGAAGTAAACCAAAGACAGGG + Intronic
1017912728 6:158808190-158808212 TCAGATGTTCCCCATAGATAAGG - Intronic
1021062856 7:16134711-16134733 ACAGAAATGACCTAAAAATATGG + Intronic
1021557445 7:21935352-21935374 ACAAAATTTACCAAAATATATGG + Intronic
1021613101 7:22476580-22476602 TCAGATGTTCCTCAAAGATAAGG + Intronic
1022154710 7:27647956-27647978 ACAGAATTTAACCAAAGAGTGGG - Intronic
1024117835 7:46209878-46209900 AAAGAAGTTCACCAAAGAGAAGG - Intergenic
1024585319 7:50836858-50836880 ACAGAAGGAACCCACAGATGGGG + Intergenic
1027611162 7:80362495-80362517 ACAGAAGTATCCAAAAAATATGG - Intergenic
1030247679 7:107402635-107402657 ACAGAAGTCACACAAAGAAAGGG - Intronic
1030309075 7:108050960-108050982 ACAGAAATAACTCAAAGGTAGGG + Intronic
1030604466 7:111625045-111625067 ACAGAAGTTAACTAAAGATACGG + Intergenic
1031553659 7:123145273-123145295 ACAGAAGTTAAGCTAATATATGG + Intronic
1032379240 7:131459027-131459049 GAAGAAATGACCCAAAGATACGG + Intronic
1032388021 7:131538036-131538058 ACATCAGTTTCCCAAAGACAGGG - Intronic
1032629866 7:133637718-133637740 AAAGAAGTTACTCAAATACAGGG - Intronic
1034433742 7:151053418-151053440 ACAGGAGAGCCCCAAAGATATGG - Intergenic
1038063200 8:23935104-23935126 AAAGAAGTTACCGAAAGACAAGG - Intergenic
1038885718 8:31660564-31660586 ACAGAAGTTACCCAAAGATAGGG - Intronic
1042065550 8:64870873-64870895 ATAGAAGGTAACCAAAGCTAAGG + Intergenic
1043645622 8:82514718-82514740 AAAGAAGTTACACTAAGATAAGG + Intergenic
1044261245 8:90125329-90125351 ACAGAAGTTTCCCAAAAATGTGG - Intergenic
1045214886 8:100138478-100138500 GCAGAAGTCACCCAATGATGGGG + Intronic
1045697970 8:104832568-104832590 ACAAAAGTTATCAAAATATAAGG + Intronic
1046717472 8:117583566-117583588 ACAGAAGTTACCCAAGGACTTGG + Intergenic
1051933013 9:22409188-22409210 ACACAAGTTACCAAAATATCTGG + Intergenic
1052461995 9:28776858-28776880 ACAGAAGTTACTCCATAATATGG + Intergenic
1052841493 9:33295107-33295129 AGAGAAGATACCCACAGAAAAGG + Exonic
1055648906 9:78387981-78388003 CCAGCAGTCACCTAAAGATAAGG + Intergenic
1059822800 9:117992633-117992655 AGAGAAGTTTCCAAAAGATTTGG - Intergenic
1060412321 9:123408017-123408039 TCAGATGTTACCCGAAGATTTGG - Intronic
1185999998 X:4998533-4998555 AAAGATGTTACCATAAGATATGG - Intergenic
1186420468 X:9421480-9421502 ACTCAAGTTACCCAAGGATGAGG - Intergenic
1187697601 X:21937587-21937609 TCAGATGTTCCCCATAGATAAGG - Intergenic
1192161311 X:68790167-68790189 TCAGATGTTCCTCAAAGATAAGG - Intergenic
1193124137 X:77853258-77853280 ACAGTAATTACTCAAAGATGGGG - Intronic
1193141779 X:78035220-78035242 ACAGGACTTAGCTAAAGATATGG - Intronic
1193487204 X:82101307-82101329 ACAGAACTTCCCCAAACCTAGGG - Intergenic
1196043892 X:111235617-111235639 ACAAAAATTATTCAAAGATAAGG + Intergenic
1197419514 X:126221367-126221389 AAAAAAGTTACCTTAAGATAAGG - Intergenic
1197537841 X:127712265-127712287 ACACAAGATACCCAAACCTATGG + Intergenic
1200125212 X:153810281-153810303 ACAGACCTTACCCACAGCTAAGG + Intronic