ID: 1038891213

View in Genome Browser
Species Human (GRCh38)
Location 8:31726637-31726659
Sequence TTTCACTCCCCCACTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038891213_1038891215 7 Left 1038891213 8:31726637-31726659 CCAATACCAGTGGGGGAGTGAAA 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1038891215 8:31726667-31726689 GTCTGTAGAGCAGAAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038891213 Original CRISPR TTTCACTCCCCCACTGGTAT TGG (reversed) Intronic
903242695 1:21994217-21994239 TTTCAATCTCCCACTGGAAGTGG - Intronic
908667655 1:66510446-66510468 TTTCACTCCCCTAGTGGTATTGG - Intergenic
910557859 1:88556349-88556371 TTTCACACCCACTGTGGTATAGG + Intergenic
913459072 1:119064182-119064204 TTTGACTGCCCCACTGATCTTGG + Intronic
917471874 1:175332653-175332675 TTTCTTTCCCTCACTGGGATTGG + Intronic
917495006 1:175532487-175532509 TTTCTCTGACCCACTGGTATTGG + Intronic
919119096 1:193316669-193316691 TTCCCCTCCCCCATTGGAATAGG - Intergenic
920454954 1:206093740-206093762 TTTCCCTCCTCCACTGATACAGG - Intronic
921099443 1:211915689-211915711 CTTCACTCCCCCATAGGTGTGGG + Intergenic
1071576310 10:86729425-86729447 TTGCCCTTCCCCACTGGTGTGGG + Intronic
1072274495 10:93809723-93809745 TTTCACTGTCCCATTGGTTTAGG - Intergenic
1073153508 10:101328269-101328291 TTTGACTGCCCCACTGATTTTGG + Intergenic
1076264321 10:129097965-129097987 CTTAACTCCCCCACTGGAAGTGG + Intergenic
1076338732 10:129728316-129728338 TTTTTCTCACCCACTTGTATGGG - Intronic
1077011423 11:380910-380932 CTTCACCCCCCCACTGGTCTCGG - Exonic
1077552330 11:3206197-3206219 TCTCCCTCCCCCACTTGTGTTGG + Intergenic
1084754339 11:71225412-71225434 TTTCACTCCGGCATTAGTATAGG + Intronic
1085924345 11:80997790-80997812 TTTAACTCCAACACTGGTGTGGG + Intergenic
1086846644 11:91758105-91758127 TTTCATTCCCACACAGGTGTTGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088601287 11:111478355-111478377 CTTCTCTCCCCCACTGGAATAGG + Intronic
1092640348 12:10500885-10500907 TTTCACTCACCTATTGTTATCGG - Intergenic
1099059587 12:77889991-77890013 TTTCCCTCACCTACTGGTTTTGG - Intronic
1099180638 12:79470462-79470484 TTGCACTCCCCCTGAGGTATTGG - Intergenic
1105300365 13:19128482-19128504 TTTCATTCCTCCACTGGTGGGGG + Intergenic
1106442280 13:29786545-29786567 TTTCTCTCCCCCACCGAAATGGG + Intronic
1106614470 13:31314158-31314180 TTTCCCTTCCCCACTAGCATAGG - Intronic
1107750194 13:43557211-43557233 TTTGACTCCCCAAATGGTCTTGG - Intronic
1109727156 13:66356996-66357018 TTTCCCCCACACACTGGTATGGG - Intronic
1110595883 13:77319967-77319989 TTTCACTGCCCCACAGTTGTTGG - Intronic
1112535077 13:100245906-100245928 CTTCATTCCCCCTCAGGTATTGG - Intronic
1112857722 13:103791920-103791942 TTTGACTGCCCCACTGGATTTGG - Intergenic
1114587053 14:23824998-23825020 TGTCAATTCCCCACTGGTCTTGG - Intergenic
1115724071 14:36194048-36194070 TTTCACACTGCTACTGGTATTGG + Intergenic
1115748074 14:36459071-36459093 TTTCACTCCCTCCCTCATATTGG + Intergenic
1116495652 14:45556924-45556946 TTTGACTCCTACACTGGTAATGG - Intergenic
1118263341 14:64268911-64268933 TTTCCCTCCCACTCTGCTATAGG - Exonic
1120885910 14:89451837-89451859 TGTCACTCCAGCACTGGTAACGG + Intronic
1202844473 14_GL000009v2_random:155593-155615 TTTCACTCTTCCACAGGTGTTGG - Intergenic
1202913865 14_GL000194v1_random:145834-145856 TTTCACTCTTCCACAGGTGTTGG - Intergenic
1202878792 14_KI270722v1_random:36868-36890 TTTCACTCTTCCACGGGTGTTGG + Intergenic
1125279356 15:38027343-38027365 TTTGACTGCCCCACTGGATTTGG + Intergenic
1127164632 15:56231902-56231924 TTTGACTGCCCCACTGGATTTGG - Intronic
1128327756 15:66736135-66736157 TTTAATTTCCCCATTGGTATCGG - Intronic
1130996390 15:88906853-88906875 CTTCACTCCCCCACTGGGTGGGG + Intronic
1134789617 16:16977492-16977514 CTTCTCTGCCCCACTAGTATTGG - Intergenic
1139845907 16:69921203-69921225 TTTTCCTCCCCCTCTGGCATTGG + Intronic
1143811834 17:9478042-9478064 CTTCACTCACTCACTGGTGTAGG + Intronic
1145752174 17:27363011-27363033 TTTCACTTTCCCACTGGCCTTGG - Intergenic
1145960826 17:28885715-28885737 TTTCTCTCCTCCACTGCTCTGGG - Intronic
1146658903 17:34651652-34651674 ATTCATTTCCCCACTGCTATGGG + Intergenic
1149774375 17:59345746-59345768 TTTTTCTCCCTCACTGGTAAGGG + Intronic
1151132780 17:71915481-71915503 TTTCCCCCCCCCACTGGAAGTGG + Intergenic
1152007720 17:77693059-77693081 TTTCACTCCCCCACTGACGGGGG + Intergenic
1154363300 18:13683331-13683353 TTTCTCTCCACCATTGATATGGG - Intronic
1157643376 18:49241595-49241617 TTTCTCTCCACCACTTGTAGAGG + Intronic
1158711221 18:59839841-59839863 TGTCACTCCCCACCTTGTATTGG - Intergenic
1167702216 19:51055992-51056014 TTTCATTCTCACACTGTTATGGG - Intergenic
1202654414 1_KI270708v1_random:5902-5924 TTTCACTCTTCCACAGGTGTTGG + Intergenic
927894363 2:26771911-26771933 TTTCTTTGCCCCACTGGTACTGG + Intronic
929911995 2:46097857-46097879 TTTCACCCCCCAACTGTCATTGG - Intronic
929988305 2:46759869-46759891 TTTCACTCCTCCACTGTAACGGG + Exonic
931602457 2:64018722-64018744 TTTCACTCTCCCTCCGGGATCGG - Intronic
937554118 2:123132770-123132792 TTTGACTGCCCCACTGGATTTGG + Intergenic
938031876 2:128001905-128001927 TTTCACTCCTTCTCTGGTAATGG - Intronic
939350893 2:141036454-141036476 TTTCTCTTCCCCAGTGGTTTAGG - Intronic
942833409 2:180263902-180263924 TTCCAGTCCCTAACTGGTATAGG - Intergenic
943114415 2:183648644-183648666 TTTCTCTCCCCCACTGGCTTAGG - Intergenic
946371063 2:219281674-219281696 TTTCACCCTCCCTCTGGGATGGG - Intronic
1170972987 20:21133928-21133950 TTTCTGACCCCCACTGGTAAGGG + Intronic
1176061626 20:63175218-63175240 TTTCACTCCCCCACTGTCCCCGG + Intergenic
1176633220 21:9160509-9160531 TTTCACTCTTCCACAGGTGTTGG - Intergenic
1176640099 21:9294307-9294329 TTTCACTCTTCCACAGGTGTTGG + Intergenic
1177303084 21:19275703-19275725 TTTCACTCCCCCAAAGTTAGAGG + Intergenic
1178275554 21:31233732-31233754 TTTCCCTCCCCCACTGAAAATGG + Intronic
1178711974 21:34925267-34925289 TTTCACTTCCTCAATGTTATGGG + Intronic
1180349114 22:11783690-11783712 TTTCACTCTTCCACAGGTGTTGG + Intergenic
1180373402 22:12067144-12067166 TTTCACTCTTCCACAGGTGTTGG + Intergenic
1180424145 22:12901770-12901792 TTTCACTCTTCCACAGGTGTTGG + Intergenic
950471194 3:13187525-13187547 TCCCTCTCTCCCACTGGTATGGG + Intergenic
951287580 3:20833758-20833780 TTTCACTCCCCAACCTGAATAGG + Intergenic
952190624 3:31019198-31019220 CTTCACTGTCCCAGTGGTATTGG - Intergenic
955970712 3:64435835-64435857 TTTTACTGCCCCACTGGATTTGG + Intronic
957100090 3:75816465-75816487 TTTCACTCTCCCACAGGTGTTGG - Intergenic
959984739 3:112560527-112560549 TTTCACCCCCACACTGAGATTGG + Intronic
960664617 3:120096572-120096594 TTTCACCCTCCTACTGCTATCGG - Intergenic
960916661 3:122702094-122702116 TTTCACTTCCTCACTGGTGTTGG - Intronic
961430989 3:126882981-126883003 TTTCCCTTCCCCAGAGGTATGGG - Intronic
961927070 3:130492448-130492470 TATCCATCCCCTACTGGTATTGG - Intergenic
962882120 3:139588106-139588128 TTTCCCTTCCCCACTGCTCTAGG + Intronic
966153668 3:176892824-176892846 TTTGACTGCCCCACTGGATTTGG + Intergenic
966680142 3:182633077-182633099 TTCTATTCCCCCACTGGTTTTGG - Intergenic
1202746796 3_GL000221v1_random:110715-110737 TTTCACTCTTCCACAGGTGTTGG - Intergenic
969792910 4:9504615-9504637 ATTCTCTCCCCCACGGATATCGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971875399 4:32301451-32301473 TTTGACTGCCCCACTGGATTTGG + Intergenic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
978915640 4:114123624-114123646 TTTGACTGCCCCACTGGATTTGG - Intergenic
979391826 4:120137746-120137768 TTTCATTGCCCCACTGGATTTGG - Intergenic
1202754990 4_GL000008v2_random:52712-52734 TTTCACTCTTCCACAGGTGTTGG + Intergenic
986258643 5:6123507-6123529 TTTGACTGCCCCACTGGATTTGG - Intergenic
986533261 5:8760938-8760960 TTTTACTGCCCCACTGGATTTGG + Intergenic
988891617 5:35623636-35623658 TATAACTCCCCCACTGGTCTGGG - Intronic
992159699 5:73989255-73989277 TTTTTCTCCCCCACTGATTTAGG - Intergenic
993572744 5:89562272-89562294 TTTCACTTCCTGACTGGGATAGG + Intergenic
996030851 5:118702802-118702824 TTTGACTGCCCCACTGGATTTGG - Intergenic
997430995 5:133841152-133841174 TTTCTCTGACCCACTGGGATGGG + Intergenic
999703926 5:154254173-154254195 TTGCTCTCACCCACTTGTATAGG + Intronic
999799251 5:155017976-155017998 TTTCACTCCACCTCGGGAATGGG + Exonic
1002435489 5:179228501-179228523 CTTCACACCCACACTGGTTTTGG - Intronic
1005399338 6:25415476-25415498 CCCCACTCCCCCACTGGTAGTGG + Intronic
1010611944 6:77963510-77963532 TTTGACTGCCCCACTGGATTTGG + Intergenic
1012831438 6:104208195-104208217 TTTTATTCCCCCAGTGGCATTGG - Intergenic
1013735676 6:113223806-113223828 TTTCACTCCTCCACTGTAACAGG + Intergenic
1019505735 7:1389693-1389715 TTTCCCTCCCCCACTGTCCTTGG - Intergenic
1027842245 7:83327840-83327862 TTTCACTCCCAAAATGTTATAGG - Intergenic
1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG + Intergenic
1032985381 7:137331466-137331488 TTTCACTCCTCCTCTGCGATCGG + Intronic
1033134512 7:138773555-138773577 TTCCACTCCCACACCGGTCTAGG + Intronic
1035570264 8:667910-667932 CTTCACTCCTCCTCTGGGATAGG + Intronic
1037029615 8:14088028-14088050 TGTCAGTCCCTCACTGGAATCGG + Intergenic
1038891213 8:31726637-31726659 TTTCACTCCCCCACTGGTATTGG - Intronic
1044291807 8:90480719-90480741 TTACATTCCCCCAATAGTATAGG + Intergenic
1049535450 8:143178528-143178550 TTTCTCTCCCAGACTGCTATGGG - Intergenic
1049894965 9:104437-104459 GTGCACGCCCCCACTGATATCGG - Intergenic
1050574372 9:6977808-6977830 TTTCAATCCCCCACAAGTCTGGG + Intronic
1050822075 9:9891216-9891238 TTTAACTTTCCCAGTGGTATGGG + Intronic
1051211929 9:14754293-14754315 GTTTACTCCCACACTGGTACAGG - Intronic
1053737356 9:41109499-41109521 GTGCACGCCCCCACTGATATCGG - Intergenic
1054690993 9:68321820-68321842 GTGCACGCCCCCACTGATATCGG + Intergenic
1058517720 9:105793534-105793556 GTGCACTCCCCCAGTGATATTGG + Intergenic
1060102993 9:120856652-120856674 TTTCAAACCCCCACTGGCAAGGG + Exonic
1060785847 9:126451157-126451179 TTTCACACCACCACTGCCATAGG + Intronic
1203756062 Un_GL000218v1:128137-128159 TTTCACTCTCCCACAGGTGTTGG - Intergenic
1203715434 Un_KI270742v1:140808-140830 TTTCACTCTTCCACAGGTGTTGG - Intergenic
1203535787 Un_KI270743v1:37421-37443 TTTCACTCTTCCACAGGTGTTGG + Intergenic
1203649679 Un_KI270751v1:104385-104407 TTTCACTCTTCCACAGGTGTTGG - Intergenic
1186149254 X:6656647-6656669 TATCACACCCCTACTGGTATTGG + Intergenic
1187592501 X:20733724-20733746 TTTCACTGCCCCATTGATTTTGG + Intergenic
1190531190 X:51378266-51378288 TTTCCCCCCTCCACGGGTATGGG - Intergenic
1190912986 X:54789089-54789111 TCTCATTCCCCCACTGCTGTGGG + Intronic
1191770255 X:64748391-64748413 TTTCAGTTCCCCACTATTATTGG + Intergenic
1194768825 X:97875294-97875316 TTTGACTCTCCCTCTTGTATAGG + Intergenic
1197713383 X:129688197-129688219 TTGAACGCCCCCACTGGTTTTGG + Intergenic
1197968109 X:132086361-132086383 TTTCAATCAGCCACTGGTATAGG + Intronic
1197975740 X:132163863-132163885 TTTGACTGCCCCACTGGATTTGG + Intergenic