ID: 1038891241

View in Genome Browser
Species Human (GRCh38)
Location 8:31726815-31726837
Sequence CATGGGATACAGGATGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038891239_1038891241 -7 Left 1038891239 8:31726799-31726821 CCTTGCATTCATCAGTCATGGGA No data
Right 1038891241 8:31726815-31726837 CATGGGATACAGGATGCCCCAGG No data
1038891233_1038891241 24 Left 1038891233 8:31726768-31726790 CCTGGAATGAGGCAAGGAGGAGG No data
Right 1038891241 8:31726815-31726837 CATGGGATACAGGATGCCCCAGG No data
1038891237_1038891241 -6 Left 1038891237 8:31726798-31726820 CCCTTGCATTCATCAGTCATGGG No data
Right 1038891241 8:31726815-31726837 CATGGGATACAGGATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038891241 Original CRISPR CATGGGATACAGGATGCCCC AGG Intronic