ID: 1038891770

View in Genome Browser
Species Human (GRCh38)
Location 8:31733624-31733646
Sequence AGGTGTAACCTGGACTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038891770_1038891781 29 Left 1038891770 8:31733624-31733646 CCAGAAAAGTCCAGGTTACACCT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1038891781 8:31733676-31733698 TGTGAAGGCTTGCCTGGTAATGG No data
1038891770_1038891778 14 Left 1038891770 8:31733624-31733646 CCAGAAAAGTCCAGGTTACACCT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1038891778 8:31733661-31733683 AGCCAGAGGACAGAGTGTGAAGG No data
1038891770_1038891776 0 Left 1038891770 8:31733624-31733646 CCAGAAAAGTCCAGGTTACACCT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1038891776 8:31733647-31733669 GTGGAAGGGTTACCAGCCAGAGG No data
1038891770_1038891780 23 Left 1038891770 8:31733624-31733646 CCAGAAAAGTCCAGGTTACACCT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1038891780 8:31733670-31733692 ACAGAGTGTGAAGGCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038891770 Original CRISPR AGGTGTAACCTGGACTTTTC TGG (reversed) Intronic
900397872 1:2460644-2460666 AGGTGTAAGCTGGGCTGCTCGGG + Intronic
902535474 1:17117435-17117457 TGGTTCAAACTGGACTTTTCTGG + Intronic
904877127 1:33663737-33663759 AGTAGTAACCTGAATTTTTCTGG + Intronic
914446356 1:147753756-147753778 AGCTGTATTCTGGAATTTTCTGG + Intergenic
915304174 1:154968559-154968581 AGGAGTAACCTGAAATTTGCTGG - Exonic
920078585 1:203355181-203355203 TGGCTTAACCTGTACTTTTCTGG - Intergenic
923882663 1:238120489-238120511 AGGTGAAAACTGGATTTTTCAGG - Intergenic
1063631880 10:7741567-7741589 AGGTGTGAACTGAACATTTCTGG + Intronic
1064552160 10:16513954-16513976 AGCCTTAACCTGGAATTTTCTGG - Exonic
1066277566 10:33884075-33884097 AGGAGTAACTTGGAAATTTCTGG - Intergenic
1067562212 10:47312023-47312045 GGGTATTACCTGGACTTTACTGG - Intronic
1069580165 10:69560247-69560269 TGGTTTGTCCTGGACTTTTCCGG - Intergenic
1070634420 10:78112855-78112877 AGGTCTACCCTGGACTTTACTGG + Intergenic
1074189140 10:111121115-111121137 CACTGTAACCTTGACTTTTCAGG + Intergenic
1076326768 10:129629820-129629842 GTGTGTTTCCTGGACTTTTCCGG + Intronic
1080685928 11:34514740-34514762 CTGGGTAACCTGGACTTCTCTGG + Intergenic
1081397081 11:42599008-42599030 AAGTTTCACGTGGACTTTTCAGG - Intergenic
1081582845 11:44364498-44364520 AGGTGTATACTGGCCTTTTCTGG - Intergenic
1081974071 11:47220131-47220153 CTGTCTAACCTGGCCTTTTCTGG - Intronic
1084033431 11:66494092-66494114 CCGTGGAACCTGGGCTTTTCCGG + Intronic
1092909529 12:13134411-13134433 AAGTTTACCCTGGACTTTTGAGG + Intronic
1093211760 12:16316497-16316519 AAGAGTATCCTGGATTTTTCAGG + Intergenic
1097182245 12:57178158-57178180 AGGTGAAACCTGGACCTGTTGGG + Intronic
1099601536 12:84745527-84745549 AGATATAACCTAGACTTTCCTGG + Intergenic
1101041542 12:100760894-100760916 AGGTGGAACATGGTCCTTTCTGG + Intronic
1101440843 12:104703361-104703383 AAATGCAACCTGGTCTTTTCAGG + Intronic
1101964196 12:109271152-109271174 AAGTGGACCCTGGACATTTCTGG - Intergenic
1102234359 12:111285032-111285054 AGGTGTACCCTGGGCTTTCCCGG - Intronic
1107172251 13:37357026-37357048 ATGTGTTACCTGGACTTTAATGG + Intergenic
1109179388 13:59195641-59195663 AGGTGGAACCTGGGTTTTTGAGG + Intergenic
1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG + Intronic
1110617264 13:77554891-77554913 AGGTTTGTCCAGGACTTTTCTGG + Intronic
1112600660 13:100852260-100852282 AGTAGTAACATGGACTTTGCTGG - Intergenic
1114629374 14:24149354-24149376 AGATGTAGCCTGGTCTTTTTTGG + Intronic
1115196724 14:30808538-30808560 AGCTGTGTCCTGGACTTTGCTGG - Intergenic
1116343138 14:43752528-43752550 ATGTGTGACCTGAAATTTTCAGG + Intergenic
1122188085 14:100017254-100017276 AGGTATAACCAGCACCTTTCAGG - Intronic
1125775698 15:42211222-42211244 AGATGTAACCTTGACTTCCCAGG + Exonic
1130848194 15:87767206-87767228 AGGTGAAACTAGGACTCTTCTGG - Intergenic
1132214380 15:100051832-100051854 AGGGGTAACCAGCTCTTTTCTGG + Intronic
1132723660 16:1329344-1329366 AGCTGTAACCTGGCCTCATCTGG - Intergenic
1136361440 16:29782524-29782546 AGGTGGGACTTGAACTTTTCAGG - Exonic
1138331139 16:56216380-56216402 GGGTGTATCCTTGACTTTTAAGG - Intronic
1138339961 16:56282446-56282468 AGGTTTTATCTGCACTTTTCAGG + Intronic
1139810706 16:69614844-69614866 TGGTGTTTCCTGGACTTTTATGG + Intronic
1142551482 17:743114-743136 AGGTGTGAGCTAGACCTTTCTGG - Intergenic
1144848629 17:18232968-18232990 AGGTATACTCTGAACTTTTCAGG + Intronic
1146708388 17:35019298-35019320 AGGTGCAATCTGGAAATTTCTGG + Intronic
1147285506 17:39400468-39400490 AAATGTCACCTGGTCTTTTCTGG - Intronic
1147973030 17:44230037-44230059 AGGAGTAACCTGAAATTTGCTGG - Intergenic
1152160406 17:78665017-78665039 TGGTGTTGCCTGGTCTTTTCAGG - Intergenic
1152443849 17:80328685-80328707 AAGTGTCTCCTGGATTTTTCCGG + Intronic
1158322156 18:56275362-56275384 AGTTGTAAGCCGGACTTTTCTGG - Intergenic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
926668595 2:15552629-15552651 ATCTCTAAGCTGGACTTTTCAGG - Intronic
931243053 2:60469394-60469416 AGGGGAAACCTGGGCATTTCTGG + Intronic
933561194 2:83888245-83888267 ATCTGTAACTTGGACTTTTTGGG - Intergenic
939635168 2:144573323-144573345 AGATGTAACTTGATCTTTTCAGG + Intergenic
943562021 2:189475290-189475312 ACTTGTATCCTGGACTTTTTCGG - Exonic
946211212 2:218148877-218148899 CGATGCTACCTGGACTTTTCAGG + Intergenic
946803934 2:223451208-223451230 ATGAGCAACCTGGACTTTGCAGG - Intergenic
948511629 2:238470002-238470024 AGTTGTATCCTGGACATTTTGGG + Intergenic
948716855 2:239870748-239870770 AGGGGCAAGCTGGACCTTTCTGG - Intergenic
1171266835 20:23777824-23777846 AGGTGAAATCTGGGCTTTTAGGG + Intergenic
1171276384 20:23859468-23859490 AGGTGAAATCTGGGCTTTTAGGG + Intergenic
1173311875 20:41904122-41904144 AGTTCTAACCTGGAGTTGTCTGG + Intergenic
1173501782 20:43559138-43559160 AGCAGGAACCTGGAGTTTTCAGG + Intronic
1177584296 21:23069881-23069903 AGGTGAAATCTGGACTTTTTTGG + Intergenic
1178854098 21:36236683-36236705 AGGTCAAACCTGGAGGTTTCTGG - Intronic
1181671158 22:24426099-24426121 AGGCCTCACCTGGACTTTGCAGG - Intronic
1184277146 22:43415556-43415578 AGGTGTTCCGTGGCCTTTTCAGG + Intronic
950049874 3:9979795-9979817 AGGATTAAGCTGGACTCTTCAGG + Intronic
951149872 3:19276018-19276040 AGGGGTAACTTGGAGCTTTCTGG + Intronic
954453501 3:50584459-50584481 AGGAGTATCCTGGATTTTTCAGG + Exonic
955089630 3:55736855-55736877 AATTTTAACCTGGAATTTTCTGG + Intronic
960820792 3:121728951-121728973 AGTTGTGACCTGGACTTTCAGGG - Intronic
963853979 3:150235433-150235455 AGGTGTAAGCTGGACCTTGGAGG + Intergenic
964295528 3:155228857-155228879 AGGTGTCAGCTGGTCTCTTCTGG - Intergenic
970298045 4:14652468-14652490 ATGTGTTACCTGGAAGTTTCAGG - Intergenic
973612426 4:52648845-52648867 AGGTGTAATCTGAGCTATTCAGG - Intronic
974107421 4:57486005-57486027 AGATAAAACCTGGACTTTTGAGG - Intergenic
975376119 4:73648034-73648056 AGGAGTAACCAGCACTTATCTGG + Intergenic
976104303 4:81600614-81600636 CGGTGTCACCAGGACTGTTCTGG - Intronic
976707321 4:88033067-88033089 AGGTGTGCCATGGACTTTCCTGG + Intronic
976727377 4:88227884-88227906 AGGTGCATCCTGTGCTTTTCTGG - Intronic
978863558 4:113480451-113480473 AGGTGCAACATGGACTTTGTAGG - Intronic
979937535 4:126716476-126716498 AGGTGTCACCTGGTTTGTTCAGG - Intergenic
984136727 4:175950491-175950513 AGGTTTAACCATGACTTTCCAGG + Intronic
985192676 4:187393235-187393257 TTGTGTTACCTGGACTTTCCGGG + Intergenic
989817301 5:45751528-45751550 AGATGTGACCTGGCCTTTTCTGG - Intergenic
990863168 5:60350949-60350971 AGGTGTAAGCTGGAATTCTTTGG - Intronic
991666703 5:69006577-69006599 TGGTGCAACCTGGACCTTGCTGG - Intergenic
991966479 5:72096451-72096473 TTGTGCAACCTGGACTGTTCAGG + Intergenic
998962478 5:147503367-147503389 GGCTGCAACCTCGACTTTTCAGG + Intronic
999547087 5:152641628-152641650 CTATGTAACCTGGTCTTTTCTGG - Intergenic
1000105431 5:158054637-158054659 ATGGGTAACCTGGGCTGTTCAGG - Intergenic
1001113074 5:168914497-168914519 TGCCGTTACCTGGACTTTTCTGG + Intronic
1003121777 6:3324050-3324072 AGGTGCACCCAGGACTTCTCGGG - Intronic
1003646948 6:7920590-7920612 AGGTGTAAACTGGGATTGTCTGG - Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007746409 6:44046059-44046081 TTGTGGAACCTGGAGTTTTCGGG - Intergenic
1012931422 6:105321452-105321474 CGGTTTAACCTGGACATTCCAGG + Intronic
1013276590 6:108591134-108591156 AGGTGTAGCTGGGACTTATCGGG + Intronic
1015502731 6:133951265-133951287 TGCTGTAACGTTGACTTTTCAGG + Intergenic
1036405852 8:8454716-8454738 GGGTGTAGCCTTGACTTCTCAGG + Intergenic
1038063717 8:23939789-23939811 AGGTGCAACCTTGACTATTAAGG - Intergenic
1038891770 8:31733624-31733646 AGGTGTAACCTGGACTTTTCTGG - Intronic
1040979774 8:53234423-53234445 AGGTGTGTCCTGGACTTGCCAGG + Intronic
1041778393 8:61550533-61550555 AGATGTGGCCTGGGCTTTTCTGG - Intronic
1045866178 8:106868142-106868164 AGGTGGAGGCTGGACTGTTCTGG + Intergenic
1048314321 8:133350865-133350887 AGATGGATCCTGCACTTTTCAGG - Intergenic
1048773730 8:137922665-137922687 AGATGTCACCTGTATTTTTCAGG + Intergenic
1055185690 9:73450694-73450716 AGCTGTAACCTCTAGTTTTCTGG + Intergenic
1058617827 9:106852615-106852637 AGCTGTCACCTGGACATCTCAGG - Intergenic
1059256921 9:112939272-112939294 AGATGGAACCGGGAATTTTCAGG + Intergenic
1059639594 9:116203784-116203806 ACATGTAAGCTGGACTTTGCAGG + Intronic
1059930035 9:119251342-119251364 AGGAGGAACCTGAACTTTTCGGG + Intronic
1185782795 X:2863711-2863733 AGGTGTAAAATGCGCTTTTCTGG + Intronic
1187428842 X:19203362-19203384 AGGTGGCACCCGGACATTTCTGG - Intergenic
1195918703 X:109960800-109960822 AGTTGTTACCTGGATTTTTATGG - Intergenic
1200417881 Y:2931709-2931731 AGGTGTACAGTGGAGTTTTCTGG + Intronic