ID: 1038892329

View in Genome Browser
Species Human (GRCh38)
Location 8:31739572-31739594
Sequence TGTGTGCTAAAACATTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038892327_1038892329 24 Left 1038892327 8:31739525-31739547 CCGACTTCTCCAGGTTCATAAAT 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1038892329 8:31739572-31739594 TGTGTGCTAAAACATTGTTGTGG No data
1038892328_1038892329 15 Left 1038892328 8:31739534-31739556 CCAGGTTCATAAATATTAATAAT 0: 1
1: 0
2: 5
3: 62
4: 786
Right 1038892329 8:31739572-31739594 TGTGTGCTAAAACATTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038892329 Original CRISPR TGTGTGCTAAAACATTGTTG TGG Intronic
No off target data available for this crispr