ID: 1038896888

View in Genome Browser
Species Human (GRCh38)
Location 8:31793882-31793904
Sequence ATGGAGAGATGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8635
Summary {0: 1, 1: 8, 2: 94, 3: 1009, 4: 7523}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038896888 Original CRISPR ATGGAGAGATGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr