ID: 1038897930

View in Genome Browser
Species Human (GRCh38)
Location 8:31807474-31807496
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038897926_1038897930 11 Left 1038897926 8:31807440-31807462 CCTGGGGGTATCACAGTGCTTGA 0: 1
1: 0
2: 0
3: 26
4: 165
Right 1038897930 8:31807474-31807496 GCTCACTAAATATTTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr