ID: 1038900088

View in Genome Browser
Species Human (GRCh38)
Location 8:31832418-31832440
Sequence CAAATTATGAAAAATTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1211
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 1155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038900088_1038900094 25 Left 1038900088 8:31832418-31832440 CCCAGTAAATTTTTCATAATTTG 0: 1
1: 0
2: 1
3: 54
4: 1155
Right 1038900094 8:31832466-31832488 CCAGGCTGGTCTCAAACTCCTGG 0: 18900
1: 39618
2: 57393
3: 52227
4: 33361
1038900088_1038900091 11 Left 1038900088 8:31832418-31832440 CCCAGTAAATTTTTCATAATTTG 0: 1
1: 0
2: 1
3: 54
4: 1155
Right 1038900091 8:31832452-31832474 TTTCGCCATGTTGTCCAGGCTGG 0: 395
1: 18748
2: 149230
3: 216339
4: 205335
1038900088_1038900090 7 Left 1038900088 8:31832418-31832440 CCCAGTAAATTTTTCATAATTTG 0: 1
1: 0
2: 1
3: 54
4: 1155
Right 1038900090 8:31832448-31832470 AGAGTTTCGCCATGTTGTCCAGG 0: 11
1: 617
2: 11260
3: 77305
4: 203308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038900088 Original CRISPR CAAATTATGAAAAATTTACT GGG (reversed) Intronic
901119796 1:6881804-6881826 AAAAATACGAAAAATTAACTGGG + Intronic
901409828 1:9074860-9074882 CAAATAATCAAAAATTATCTGGG + Intronic
901563103 1:10088838-10088860 CAAATAATAAAAAAATTAGTTGG - Intronic
901575673 1:10198885-10198907 AAAATTTTCAAAAATTAACTAGG - Intergenic
902538744 1:17137388-17137410 CAAATGTTGACAAATTTACCTGG + Intergenic
902980171 1:20116817-20116839 CAAAACATCAAAAATTAACTGGG + Intronic
903110087 1:21125260-21125282 CAACTTCTGATAAAGTTACTGGG + Intronic
903736760 1:25534772-25534794 GAAATTATGAAGAATTGGCTGGG + Intergenic
904069461 1:27782259-27782281 CAAAAAATTAAAAAATTACTTGG - Intronic
904125397 1:28234984-28235006 AAAAATATGAAAAATTAGCTGGG - Intergenic
904451600 1:30616414-30616436 CAAAATATAAAAAATTAGCTGGG - Intergenic
904790356 1:33015729-33015751 AAAAATATGAAAAATTTAGCTGG + Intronic
905236110 1:36550094-36550116 CAGATTATAAAAATATTACTAGG - Intergenic
905614053 1:39381667-39381689 CAAAAAATAAAAAATTAACTGGG + Intronic
905679235 1:39855475-39855497 CAAAATCTGAAACATTTCCTTGG - Intronic
905735246 1:40320552-40320574 CAAAATATAAAAAATTAGCTGGG - Intergenic
906007646 1:42490844-42490866 CAAATCATGCATATTTTACTGGG + Intronic
906486138 1:46236565-46236587 CAAATAATAAAAAATTAGCTAGG - Intergenic
907133361 1:52117054-52117076 AAAAATATGAAAAATTAGCTGGG - Intergenic
907605625 1:55814630-55814652 CAAATAAAGAAAAGTTTATTTGG - Intergenic
907657745 1:56361183-56361205 AAAAATATGAAAAATTAGCTGGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907804333 1:57803177-57803199 CAAAGAAGGAAAAATTTACAAGG + Intronic
908022284 1:59910544-59910566 AAAATTTTTAAAAATTTCCTTGG - Intronic
908091615 1:60691745-60691767 CAAATTATTAGCAATTAACTGGG + Intergenic
908094952 1:60727945-60727967 AAAATTAAAAAAAATTTATTTGG - Intergenic
908213940 1:61931601-61931623 AAAATTACAAAAAATTAACTGGG + Intronic
908782007 1:67699524-67699546 CACATTAGCATAAATTTACTTGG + Intergenic
908931654 1:69323591-69323613 AAAATTATCAAGACTTTACTGGG - Intergenic
908934283 1:69355968-69355990 CAATTTATGCAAAAATTCCTAGG + Intergenic
909151199 1:72007738-72007760 TAAATTGTGAAAAATTAAATTGG - Intronic
909232863 1:73114370-73114392 GAATTTATGGAATATTTACTGGG + Intergenic
909581763 1:77243891-77243913 CAAAAAATGAAAAATTAGCTGGG - Intergenic
909655762 1:78030996-78031018 AAAATTTTTAAAAATTCACTGGG + Intronic
909814807 1:79978285-79978307 CAAATTATGACAATTGTGCTTGG + Intergenic
909952810 1:81739389-81739411 CAAACCATGAATAATTTATTGGG - Intronic
910313826 1:85858894-85858916 AAAATTTTGTAAAATTTGCTGGG - Intronic
910390903 1:86742798-86742820 AAAAATATGAAAAATTAGCTGGG + Intronic
910938567 1:92507865-92507887 TAAATTAAAAAATATTTACTGGG + Intergenic
911247930 1:95539712-95539734 CAAATTTTAAAAAATTGATTTGG + Intergenic
911582497 1:99650371-99650393 CAAGTCAAGAAAAATTTATTTGG - Intronic
911760363 1:101607610-101607632 AAAATTATAAAATATTTATTAGG + Intergenic
912161394 1:106989240-106989262 CAAATTATGAAAAAAAATCTAGG + Intergenic
912256343 1:108062396-108062418 CAAATTAGGAAATATTTAGGTGG + Intergenic
912363715 1:109115577-109115599 CAATTTATAAAAAATATTCTGGG - Intronic
912794349 1:112682382-112682404 CAAAAAATGAAAAATTAGCTGGG - Intronic
913196044 1:116456895-116456917 AAAATTACACAAAATTTACTAGG + Intergenic
913404039 1:118468629-118468651 CTAATTTTTAAAAATCTACTTGG + Intergenic
913487449 1:119345446-119345468 AAAATTTTGAAAAAATTAATTGG - Intergenic
913679896 1:121179665-121179687 TAAAATATGAAAAATTAGCTGGG + Intronic
914031731 1:143967315-143967337 TAAAATATGAAAAATTAGCTGGG + Intronic
914157713 1:145100650-145100672 TAAAATATGAAAAATTAGCTGGG - Intronic
915005981 1:152636723-152636745 CAAATTTTTAAAAATATATTTGG - Intergenic
915157634 1:153891406-153891428 CAAAATATAAAAAATTAGCTAGG + Intronic
915403673 1:155643103-155643125 GAAATTATGAAAGTTTTATTAGG + Intergenic
915478669 1:156170160-156170182 CAAATAATAAAAAATTAGCTGGG + Intronic
915499659 1:156306657-156306679 AAAATTATGAAAAATTAGCCAGG + Intergenic
915616243 1:157041465-157041487 AAAATTTTGGAATATTTACTTGG - Intronic
915678453 1:157554496-157554518 CCAGTTATTAAAAATCTACTAGG - Intergenic
915866405 1:159504130-159504152 CAGATTTTTAAAAAATTACTTGG - Intergenic
916015279 1:160743848-160743870 CAAAAAATGAAAAAATTAGTTGG - Intronic
916159794 1:161898061-161898083 CGAATCAATAAAAATTTACTAGG - Intronic
916358756 1:163943532-163943554 CAAAATATTAAAAATTAGCTGGG + Intergenic
916693389 1:167212784-167212806 CAAAAAATAAAAAATTAACTGGG + Intergenic
916996976 1:170311576-170311598 TAAATTATGTAAAATCTGCTGGG - Intergenic
917147076 1:171904005-171904027 CAGCTTATTAAGAATTTACTAGG + Intronic
917356771 1:174133641-174133663 AAAAATATGAAAAATTATCTGGG + Intergenic
918229450 1:182514808-182514830 CAAATTATGAAGGATTGGCTTGG - Intronic
918770556 1:188553018-188553040 CAAATGATTAAAATTTCACTTGG - Intergenic
918805332 1:189033813-189033835 AAAATAATGAATAGTTTACTTGG - Intergenic
918861146 1:189827757-189827779 AAAAATATGAAAAATTAGCTGGG + Intergenic
918988678 1:191667782-191667804 CTTATCATGAAAAATTTACTGGG + Intergenic
918991662 1:191704310-191704332 CAAATTAAGATATATTTAATTGG - Intergenic
919213342 1:194517700-194517722 AAAAATATTTAAAATTTACTGGG + Intergenic
919526564 1:198659840-198659862 AAAATTAAGAAAAATATTCTTGG - Intronic
919933963 1:202239282-202239304 CAAATTCTTCAGAATTTACTTGG - Intronic
920205561 1:204288486-204288508 CACATTATGAAATATTTGCCTGG + Intronic
920467207 1:206198201-206198223 TAAAATATGAAAAATTAGCTGGG + Intronic
921009228 1:211124481-211124503 TAAAATATGAAAAATTAGCTGGG + Intronic
921085736 1:211790651-211790673 CAAAATAAAAAAAAATTACTTGG + Intronic
921507353 1:215988782-215988804 CAAATTAGGAAAAATTCTCAGGG + Intronic
922087036 1:222359710-222359732 CAAATTAAGAAAACATTACAGGG + Intergenic
922141463 1:222892115-222892137 CAAATGCTGAAAAATTTGGTGGG + Intronic
922321157 1:224488624-224488646 CAAATTTTGAAAAATTAGCCGGG - Intronic
923180618 1:231515229-231515251 CAAATAATTAAAAAATTAGTGGG - Intergenic
923315868 1:232779535-232779557 AAAATTACAAAAAATTGACTGGG + Intergenic
923329028 1:232905614-232905636 CAAATTATGACCATTTGACTTGG - Intergenic
923587380 1:235286193-235286215 CAAATTATCAAAAATTAGCTGGG - Intronic
923901651 1:238332734-238332756 CAAATTAACACAAATTTAGTTGG + Intergenic
923934433 1:238745796-238745818 TAAAATATGAAAAATTTAGCTGG + Intergenic
924204139 1:241693893-241693915 GAAATTCAGAAAAATTTATTAGG - Intronic
924358514 1:243210284-243210306 CAAATCATGAGAAAAATACTAGG - Intronic
924723199 1:246643048-246643070 AAAATTTTTAAAAATTAACTGGG - Intronic
1063727067 10:8648775-8648797 CAAATTGTGATAATGTTACTTGG - Intergenic
1063810371 10:9698069-9698091 CAAATAATGAACAAGTTTCTGGG + Intergenic
1064056482 10:12102120-12102142 CACCTTATAAAAAATTCACTTGG + Intronic
1064195586 10:13241607-13241629 CAAAATATCAAAAATTTAGCAGG - Intergenic
1064926354 10:20573404-20573426 CAAATTACCACAAACTTACTGGG - Intergenic
1065019142 10:21488351-21488373 TAAATTTTTAAAAATTAACTAGG + Intergenic
1065166523 10:22985031-22985053 AAAAAAATGAAAAATTAACTGGG - Intronic
1065244116 10:23740517-23740539 AAAATTTTAAAAAATTCACTGGG - Intronic
1065265933 10:23975477-23975499 TAAATAATGAAACATTTCCTTGG + Intronic
1065374204 10:25020465-25020487 GAAAAGATGAAAGATTTACTGGG + Intronic
1065537359 10:26728194-26728216 AAAATTATAAAAAATTAGCTGGG + Intronic
1065763629 10:29006876-29006898 CAAATTCTGACAAATGTGCTGGG - Intergenic
1065889140 10:30106268-30106290 AAAAATATAAAAAATTAACTGGG + Intronic
1065949508 10:30639179-30639201 AAAAATATGAAAAATTAGCTGGG + Intergenic
1066110451 10:32191180-32191202 CAAAGTAAGAAAAATCTATTTGG + Intergenic
1066195271 10:33093126-33093148 CAAAAAATAAAAAATTAACTGGG - Intergenic
1066352073 10:34645012-34645034 CAAAATATAAAAAATTAGCTGGG - Intronic
1066484806 10:35833210-35833232 CAAAAGTTGAAAAATTTGCTGGG - Intergenic
1066604005 10:37141407-37141429 CTAAATATGAAAAATTAGCTGGG + Intronic
1066761574 10:38759189-38759211 CACATTATGAAGAATTTTTTAGG + Intergenic
1066815593 10:39406375-39406397 CATATCATGAAGAATTTTCTTGG - Intergenic
1066960017 10:42213232-42213254 CACATTATGAAGAATTTCTTAGG - Intergenic
1067010404 10:42706654-42706676 AAAATTATGTTAAATTTACATGG + Intergenic
1067313351 10:45136917-45136939 AAAATTATGTTAAATTTACATGG - Intergenic
1067488028 10:46670769-46670791 CAAAAAATGAAAAATTAACCGGG - Intergenic
1067606777 10:47671259-47671281 CAAAAAATGAAAAATTAACCGGG + Intergenic
1068079153 10:52297812-52297834 CCAATGATGAAAAAGTCACTTGG + Exonic
1068140027 10:52994066-52994088 ACAATTATGAATAATTTAATTGG - Intergenic
1068170015 10:53381096-53381118 CTGTTTATGAAAATTTTACTGGG - Intergenic
1068623756 10:59216070-59216092 CAAATTATGAAATATAAAATTGG + Intronic
1068714876 10:60177111-60177133 CAAATTATGAAAAACTGTCAAGG - Intronic
1068758542 10:60681988-60682010 CAAAAAATGAAAAATTAGCTGGG + Intronic
1068808165 10:61224062-61224084 CAAAATACAAAAAATTAACTAGG - Intergenic
1069110027 10:64435741-64435763 AAAAATATGAAAAATTAGCTGGG + Intergenic
1069401598 10:68053463-68053485 CAAATAATTAAAAAATTAATGGG - Intronic
1069618731 10:69823237-69823259 CAGCTTATGAGAAATTTTCTAGG + Intronic
1069929272 10:71871671-71871693 CAAATAATCAAATATTTTCTTGG - Intergenic
1070043657 10:72808380-72808402 AAAATTATGAAATATTTCTTTGG - Intronic
1070281809 10:75054998-75055020 AAAATTTTTAAAAATTTTCTGGG - Intronic
1071046400 10:81384645-81384667 CAAAATATAAAAAATTAGCTGGG + Intergenic
1071083155 10:81837067-81837089 CAAATGATGAAAATCTTACTAGG - Intergenic
1071473066 10:86000398-86000420 CATATTATGAAAAATCCTCTTGG - Intronic
1071502675 10:86214706-86214728 AAAATACAGAAAAATTTACTGGG + Intronic
1071622342 10:87132611-87132633 CAAAAAATGAAAAATTAACCAGG + Intronic
1072073910 10:91949150-91949172 CAAAAAATAAAAAATTAACTGGG + Intronic
1072282792 10:93884324-93884346 CAAATTACAAAAAATTAGCTGGG - Intergenic
1072308946 10:94135935-94135957 AACATTAGGAAAAAATTACTGGG - Intronic
1072454863 10:95567001-95567023 TAAATTTTTAAAAATTAACTGGG + Intergenic
1072929571 10:99650336-99650358 AAAATTTTTAAAAATTTGCTGGG - Intergenic
1073304876 10:102495113-102495135 CAAAATATTTAAAAATTACTCGG + Intronic
1073492997 10:103867275-103867297 AAAAATACGAAAAATTAACTGGG - Intergenic
1073765163 10:106674165-106674187 AAAATTATAAAAAAATTACCCGG + Intronic
1073800513 10:107036839-107036861 CAAATTCTAAAACATTTAATTGG + Intronic
1073893675 10:108129098-108129120 CATGTTATGACAAATTTCCTGGG - Intergenic
1073973434 10:109072067-109072089 CAAATCCTGAAAAATTCATTGGG - Intergenic
1074277379 10:112016548-112016570 CACTTTATGAAAAATTTATGGGG - Intergenic
1074368598 10:112880309-112880331 AAAAATATGAAAAATTAGCTGGG - Intergenic
1074602239 10:114926699-114926721 CAATTTATGATGGATTTACTGGG - Intergenic
1075376974 10:121986294-121986316 TAACTTATGAAGAATTTACAGGG - Intergenic
1075501965 10:122983177-122983199 CAAATTATGACAATTATAGTAGG - Intronic
1075847827 10:125560014-125560036 AGAATTATGGGAAATTTACTGGG + Intergenic
1076254320 10:129009108-129009130 CAAATCCTTAAAAATTGACTTGG - Intergenic
1076398455 10:130159693-130159715 CATATGATTGAAAATTTACTAGG + Intronic
1076498961 10:130920137-130920159 AAAATTTTGAAAAATTAGCTTGG + Intergenic
1076966864 11:95713-95735 CAAATGATTAAAAATTTAAAGGG - Intergenic
1077030564 11:464142-464164 CAAAATATAAAAAAATTAGTGGG - Intronic
1077628472 11:3794479-3794501 AAAAATATGAAAAATTAGCTGGG - Intronic
1077634129 11:3830491-3830513 CAAAAAATGAAAAAATTACCAGG + Intronic
1077856384 11:6130382-6130404 CTAAATATGCAAAATTAACTGGG + Intergenic
1078281392 11:9904859-9904881 CAAATTATTAAAAATTAGTTGGG + Intronic
1078299417 11:10111714-10111736 AAAAATATGAAAAATTAGCTGGG + Intronic
1078500943 11:11875762-11875784 CAAATAATACAAAATTTGCTGGG - Intronic
1079000975 11:16755697-16755719 CAAATTATAAAAAGACTACTTGG - Exonic
1079637090 11:22756572-22756594 GAAATTAAGAAAACTTTACAAGG - Intronic
1079717208 11:23763561-23763583 AAATTTAAGAAAAATTAACTAGG - Intergenic
1079914755 11:26354912-26354934 CAAATTATGGAAGAATTACAAGG - Intronic
1080629428 11:34060033-34060055 AAAAATATGAAAAATTAGCTGGG + Intronic
1080926608 11:36763770-36763792 CAGATTAAGAATAATTAACTGGG - Intergenic
1081124273 11:39303206-39303228 CAAATTATAAAAAAATTAGCTGG + Intergenic
1081831164 11:46116577-46116599 TAAATTATGAGAAACTGACTAGG + Intronic
1081895458 11:46581953-46581975 CAAATAATCAAAAATTACCTAGG + Intronic
1081975257 11:47229989-47230011 AAAATTATTAAAAATTAGCTGGG - Intronic
1082292815 11:50400019-50400041 GAAATTATGAAAGTTTTATTTGG - Intergenic
1083422861 11:62565224-62565246 CAAATAATAAAAAATTAGCTGGG + Intronic
1083570437 11:63758607-63758629 TAACTTATGAAAAAATTATTTGG + Exonic
1083701380 11:64480595-64480617 CAAAAAATGAAAAAATTAATTGG - Intergenic
1084407716 11:68986237-68986259 AAAAATATGAAAAATTAGCTGGG - Intergenic
1084587336 11:70070225-70070247 CAAATTATGACAAAATCACCTGG + Intergenic
1085283162 11:75343974-75343996 AAAAATATGAAAAATTAGCTGGG - Intronic
1085610781 11:77946597-77946619 CAAAATATAAAAAAATTAGTCGG + Intronic
1085663731 11:78394125-78394147 AAAAATATAAAAAATTTGCTGGG + Intronic
1085787379 11:79465683-79465705 GAAATGATGAAAAAATTAGTAGG + Intergenic
1086187912 11:84041562-84041584 AAATGTATGATAAATTTACTGGG + Intronic
1086271340 11:85070454-85070476 GAAAATATGAAAAACCTACTCGG + Intronic
1087047485 11:93854901-93854923 AAAATTTTGAAAAAATTAATTGG - Intergenic
1087702515 11:101451591-101451613 CTACTTATGGAAAAGTTACTTGG - Exonic
1087778906 11:102282800-102282822 GAAAATATGAAAAATTAGCTGGG + Intergenic
1088131796 11:106500529-106500551 CAAATTTTAAAAAATGTACATGG + Intergenic
1088853664 11:113726695-113726717 CAACTTGTGAGAAATTAACTTGG - Intergenic
1089914219 11:122136673-122136695 AAAAATATAAAAAATTAACTAGG + Intergenic
1090302662 11:125658845-125658867 CAAAAAATAAAAAATTTGCTGGG - Intronic
1090586967 11:128223459-128223481 AAAAATATGAAAAATTAGCTGGG - Intergenic
1091421913 12:349179-349201 CTAAATATAAAAAATTAACTGGG - Intronic
1092276330 12:7063863-7063885 AAAAATATGAAAAATTAACCAGG + Intronic
1092858907 12:12701767-12701789 CAAAATATGAAAACTTTAGCTGG + Intergenic
1092878795 12:12871853-12871875 CAAAAAATAAAAAATTAACTGGG - Intergenic
1093232677 12:16567033-16567055 AAAAATATGAAAAATTAGCTGGG + Intronic
1093452800 12:19334935-19334957 AAAATTATTCAAAATGTACTGGG - Intronic
1093737912 12:22644385-22644407 CAAATTAATAAAATTTTAATAGG - Intronic
1093891867 12:24531360-24531382 CAAATTATGAAAAATGCACAGGG - Intergenic
1094057095 12:26278836-26278858 CAAAAAATGAAAAATTAGCTGGG + Intronic
1094149410 12:27266259-27266281 CACATTATGAAGAATTTTGTAGG + Intronic
1094302524 12:28981501-28981523 GAAATTATGAGCAAGTTACTTGG + Intergenic
1094439110 12:30455250-30455272 AAAAATATGAAAAATTAGCTGGG - Intergenic
1094667926 12:32539974-32539996 AAATTTAAAAAAAATTTACTGGG - Intronic
1095269363 12:40198677-40198699 CAAAAAATGAAAAATTAGCTAGG - Intronic
1095389731 12:41691279-41691301 CATAATTTGAAAAATTCACTGGG - Intergenic
1095722135 12:45412397-45412419 CAGATTTTAAAAAATTAACTTGG - Intronic
1095725140 12:45443918-45443940 CATATTTTAAAAAATTTAATTGG - Intergenic
1096211208 12:49767278-49767300 AAAAATATGAAAAATTAGCTGGG - Intergenic
1096295772 12:50382770-50382792 TAAATTCTGTAAAAATTACTTGG - Intronic
1096934779 12:55259491-55259513 CAAAGAATAAAAAATGTACTGGG - Intergenic
1097174462 12:57134864-57134886 AAAAATATGAAAAATTAGCTGGG - Intronic
1097453249 12:59763021-59763043 CTAATTTTTAAAAATTTTCTGGG + Intronic
1097652957 12:62325374-62325396 CAGATTATGTAGAATTTATTTGG - Intronic
1097815374 12:64068116-64068138 TAAAATATGAAAAATTAGCTGGG + Intronic
1097846635 12:64373293-64373315 AAAAATATGAAAAATTAGCTGGG + Intronic
1097974550 12:65670670-65670692 CAAATTGTTACAAATTTAGTGGG + Intergenic
1098010863 12:66049971-66049993 AAATTTTTGAAAAATTAACTGGG - Intergenic
1098236893 12:68426071-68426093 AAAATTTTGAAAAATTAGCTGGG + Intergenic
1098269804 12:68758900-68758922 AAAAATATAAAAAATTTGCTGGG - Intronic
1098532007 12:71552262-71552284 AAAATTAAAAAAAAATTACTCGG + Intronic
1098703612 12:73659873-73659895 CAAATGTTGAAAATTTGACTAGG + Intergenic
1098816247 12:75167758-75167780 CAAATAATAAAAAAATTATTGGG - Intronic
1098951122 12:76641494-76641516 CAAATAATACAAAATTAACTAGG - Intergenic
1098992825 12:77083948-77083970 CAAATTATGTAAAATGTAGAAGG - Intergenic
1099194028 12:79593861-79593883 AAAAATATGAAAAATTAGCTGGG - Intronic
1099316699 12:81092758-81092780 CAAATTATCAAAATGTTAATGGG + Intronic
1099322891 12:81173615-81173637 TAAATTAAGAAAAAATTAATAGG + Intronic
1100187513 12:92153667-92153689 CAAAAAATAAAAAATTTACCTGG + Intergenic
1100192613 12:92209058-92209080 CAAAATATAAAAAATTAACTGGG + Intergenic
1100470807 12:94891258-94891280 AAAAGTATGAAAAATTAGCTGGG + Intergenic
1100539130 12:95541416-95541438 CAAAATATGCAAAATTTACCTGG + Intronic
1100828746 12:98498743-98498765 AAAATTAAAAAAAATTAACTGGG - Intronic
1101335156 12:103790545-103790567 CAAATAATTAAAAAATTAGTTGG - Intronic
1101357180 12:103991345-103991367 AAAAATATGAAAAATTAGCTGGG - Intronic
1101766834 12:107708800-107708822 GAACTTATGAAAAATTAACATGG - Intronic
1101896079 12:108757950-108757972 CAGGTGATGAAATATTTACTGGG + Intergenic
1102069295 12:110003995-110004017 AAAAATATGAAAAATTAGCTGGG + Intronic
1102918403 12:116773120-116773142 AAAATTATGAAAAATTGGCCGGG - Intronic
1103354132 12:120307096-120307118 CCAATGCTGAAATATTTACTGGG + Intronic
1103368863 12:120403060-120403082 AAAAATATGAAAAATTAGCTGGG - Intergenic
1103515346 12:121504371-121504393 CAAATAATGAAAAAATTAACTGG + Intronic
1104269433 12:127269210-127269232 CAGAGTATTAAAAATTCACTGGG - Intergenic
1104770653 12:131361646-131361668 CACCTTATCAAAAATTGACTAGG + Intergenic
1104853275 12:131889099-131889121 CAAAATATGAAAAAATTAGCTGG + Intergenic
1105015027 12:132781396-132781418 AAAAATATGAAAAATTAGCTGGG + Intronic
1105036868 12:132931026-132931048 CAAATTTTTAAAAATTAGCTTGG + Intronic
1105369816 13:19792583-19792605 AAAATTACGAAAAATTAGCTGGG - Intergenic
1105375965 13:19844780-19844802 AAAAATATAAAAAATTTGCTTGG - Intronic
1105619459 13:22052890-22052912 CAAAATTTGAAAAATTATCTGGG + Intergenic
1105940675 13:25145505-25145527 GATATTATGAAATATATACTTGG + Intergenic
1106239352 13:27897801-27897823 CAAAAAATGAAAAGTTAACTGGG + Intergenic
1106653595 13:31718454-31718476 CATATTATAAAGAATTGACTGGG - Intergenic
1106953007 13:34905774-34905796 CAGAAACTGAAAAATTTACTAGG - Intergenic
1107371585 13:39756203-39756225 AAAATTATGAAAAACTTATTTGG + Intronic
1107373737 13:39779913-39779935 AAAATTAAGAAACATTTATTAGG + Intronic
1107484926 13:40816978-40817000 AAAAATATGAAAAATTAGCTGGG + Intergenic
1107973019 13:45662434-45662456 CATAAAATGACAAATTTACTTGG - Intergenic
1108033361 13:46260400-46260422 CAAATTATTTTAAATTAACTGGG + Intronic
1108193450 13:47967201-47967223 CAACTTTTTAAAAATTTAATGGG - Intronic
1108351741 13:49594395-49594417 AAAAATATGAAAAATTAGCTGGG + Intergenic
1108527022 13:51294069-51294091 AAAAATATGAAAAATTAACCGGG - Intergenic
1108792391 13:53987079-53987101 ATAATTATGAAAAATTAAATTGG + Intergenic
1109105629 13:58246556-58246578 AAAATCATGAAAAACTTAATAGG + Intergenic
1109137093 13:58665990-58666012 AAAAATATGAAAAATTAGCTGGG + Intergenic
1109191140 13:59325746-59325768 CAAAATATAAAAAATTAGCTAGG - Intergenic
1109271082 13:60255808-60255830 CAAATTTTAAAATATTTACTTGG - Intergenic
1109408322 13:61930931-61930953 AAAATGATGAATAATGTACTGGG - Intergenic
1109554131 13:63948345-63948367 AAAATTTTAAAAAATTAACTAGG - Intergenic
1109575892 13:64258220-64258242 CAAATTTTAAAAAATTAGCTAGG + Intergenic
1109855360 13:68119901-68119923 CAAATTTTTAACAATTTACCTGG - Intergenic
1109873189 13:68364334-68364356 TGTATTATGAAATATTTACTGGG + Intergenic
1110622851 13:77618339-77618361 AAAATTTTAAAAAATTTGCTGGG - Intronic
1110868835 13:80426422-80426444 TAAATTATGCAAAATGAACTGGG + Intergenic
1110936511 13:81296908-81296930 AAAATTGTAAAAAATTCACTGGG + Intergenic
1111088462 13:83408954-83408976 CAAATAATTAAAAATATATTAGG + Intergenic
1111280800 13:86021429-86021451 CAAATTCTTAAAAAATTACAAGG + Intergenic
1111507319 13:89209337-89209359 CAAATTATTAAAAACATACAAGG - Intergenic
1111764596 13:92512203-92512225 CAAAATAAAAAAAAATTACTAGG - Intronic
1111833449 13:93358183-93358205 CAAAAAATGAAAAATTACCTGGG + Intronic
1111834133 13:93366226-93366248 CAATTTATGTAAAGTTTATTGGG - Intronic
1111853224 13:93603168-93603190 CAAATAATAAAAAATTAGCTGGG - Intronic
1112282833 13:98077558-98077580 CAAAATATAAAAAATTAGCTGGG + Intergenic
1112346951 13:98597887-98597909 AAAAATATGAAAAATTAGCTGGG - Intergenic
1112453824 13:99539040-99539062 CAAAAAATGAAAAATTAGCTGGG + Intronic
1113286488 13:108854581-108854603 ATAATTATTAAAAATTTACTAGG + Intronic
1114324450 14:21574788-21574810 AAAAATAAAAAAAATTTACTGGG + Intergenic
1114542869 14:23475690-23475712 CAAATTTTGTAAAATTCATTGGG + Intronic
1114581621 14:23765617-23765639 CAATTTATGAAAACTTTATAGGG + Intergenic
1114622102 14:24102386-24102408 CAAATAATGAAATAGTTTCTGGG + Intronic
1114749089 14:25183406-25183428 CATATCATAAAAAATTTTCTCGG + Intergenic
1114986267 14:28232534-28232556 CAAAATATGTAGAATTTATTTGG - Intergenic
1115162935 14:30416191-30416213 CAAATTAGGACAATTTTCCTAGG + Intergenic
1115615886 14:35094330-35094352 CAAAAAATAAAAAAATTACTTGG - Intronic
1115616548 14:35100791-35100813 CAAAATACAAAAAATTAACTGGG - Intronic
1115732129 14:36282346-36282368 AATATCATGAAAAATTTATTTGG - Intergenic
1115994644 14:39183846-39183868 CAAAAAATAAAAAATTAACTGGG - Intergenic
1116160410 14:41260490-41260512 CAAATTATTAAAACTTTCCATGG - Intergenic
1116169739 14:41384858-41384880 TAAATTATCTACAATTTACTTGG - Intergenic
1116194976 14:41713879-41713901 CACATTAAGAAAAATTTATCTGG - Intronic
1116200792 14:41792875-41792897 CAAATTATAAAAGTATTACTTGG + Intronic
1116254799 14:42538419-42538441 TAAATTATGTGAAATTTGCTAGG + Intergenic
1116370088 14:44119596-44119618 CAAATTATAAAAAGACTACTTGG + Intergenic
1116399631 14:44490269-44490291 AAAATTATTAAAAATTTTCTGGG - Intergenic
1116499668 14:45605520-45605542 TAAATTATCACAAATTTAATGGG - Intergenic
1116638280 14:47426214-47426236 CAAATTAGCAAAAATTTAGGAGG - Intronic
1116643735 14:47499509-47499531 CAATTTATGAAATACTTTCTTGG - Intronic
1116843850 14:49846624-49846646 CAAATAATGAAAAAATTAGCTGG - Intronic
1117011509 14:51475182-51475204 GAAATAATGAAAAATATAATTGG - Intergenic
1117598657 14:57350784-57350806 CAAAATATGAAAAAGTAAGTTGG + Intergenic
1117827850 14:59722221-59722243 CAAATTTTGATAAATTAACATGG + Intronic
1117887268 14:60378498-60378520 CAAGTTATGAAAGACTGACTTGG - Intergenic
1118203300 14:63697769-63697791 CAAATGCTGTAACATTTACTTGG - Intronic
1118520445 14:66576866-66576888 CAAATTATGAATTATTTAAATGG - Intronic
1118802059 14:69199418-69199440 CAAATTATTTAAAATTTTTTTGG + Intronic
1118813295 14:69291130-69291152 CAAATTTTAAAAAGTTAACTGGG + Intronic
1119196266 14:72718929-72718951 AAAAATATGAAAAATTAGCTGGG - Intronic
1119280209 14:73400465-73400487 CAAATTATGAAACATATAATTGG + Intronic
1119505302 14:75167563-75167585 AAAATTATGAAGAAGTAACTTGG - Intronic
1120184357 14:81378374-81378396 GAAAATATGAAAAACTAACTAGG - Intronic
1120300255 14:82697341-82697363 TAATTTATTAATAATTTACTAGG + Intergenic
1120343382 14:83250979-83251001 CAAGTTAAGAAAGAATTACTGGG - Intergenic
1120437350 14:84497298-84497320 CAAAGTTTAAAAAATTTGCTGGG + Intergenic
1120495044 14:85224268-85224290 TAAATTAATACAAATTTACTTGG + Intergenic
1120623863 14:86800229-86800251 CAAAGAAGCAAAAATTTACTTGG + Intergenic
1120747235 14:88163531-88163553 CAAATTCTACAAAATTTTCTGGG - Intergenic
1120758984 14:88269596-88269618 CAAAATATTAAAAAATTAGTTGG - Intronic
1120928278 14:89820361-89820383 CAAATGATGAATATTTTGCTGGG - Intronic
1120999176 14:90439132-90439154 AAAAATTTAAAAAATTTACTGGG + Intergenic
1121206772 14:92175757-92175779 CACATTATGGAAAATTTAGAAGG + Intergenic
1121349034 14:93157932-93157954 AAAAATATAAAAAATTGACTGGG + Intergenic
1122521915 14:102350513-102350535 CAAATTAAAAAAAATTAGCTGGG - Intronic
1123140988 14:106078417-106078439 GAAATTATAAAAAACTTCCTTGG + Intergenic
1202932921 14_KI270725v1_random:55546-55568 CACATTATGAAGAATTTTTTAGG + Intergenic
1123865380 15:24513754-24513776 AAAATTATCAAAAAATTAGTTGG - Intergenic
1124481093 15:30080670-30080692 AAAATTAGGAAAAATTCATTAGG - Intergenic
1125106246 15:35974894-35974916 CAAATCATAAAAAATGTGCTTGG - Intergenic
1125123264 15:36188976-36188998 GAATTTATTGAAAATTTACTAGG - Intergenic
1125488985 15:40132629-40132651 CAGATTAGGAAAAATATACAAGG - Intergenic
1125505531 15:40265682-40265704 TAAATTATGGAAAAATTAATGGG + Intronic
1125597510 15:40896382-40896404 CAAATTTTTAAAAATTAGCTAGG + Intronic
1125914268 15:43471585-43471607 AAAAATATAAAAAATTAACTGGG - Intronic
1125924734 15:43553502-43553524 CAAAAAATTAAAAATTTAATTGG - Intronic
1127159606 15:56167500-56167522 CTAATTATGAAAAATGTAACTGG + Intronic
1127723483 15:61725548-61725570 CAAAGTAGGAAAAATATTCTGGG + Intergenic
1127738089 15:61865946-61865968 CAAATTCTAAATAATTTATTTGG - Intronic
1128121398 15:65150218-65150240 AAAAATATGAAAAATTAGCTGGG - Exonic
1128183928 15:65628117-65628139 CAAAATATTAAAAATTAGCTGGG - Intronic
1128290301 15:66473410-66473432 CAAAAAAAGAAAAAGTTACTTGG + Intronic
1128303102 15:66579691-66579713 AAAAATACAAAAAATTTACTAGG - Intergenic
1128492999 15:68169377-68169399 CAAATCATAAAAAATTGGCTGGG + Intronic
1128824282 15:70697209-70697231 CAAAATAGTAAAAAGTTACTAGG + Intronic
1129224746 15:74162481-74162503 CAAAAAATAAAAAATTTGCTGGG - Intergenic
1129345469 15:74915255-74915277 AAAAATACAAAAAATTTACTGGG - Intergenic
1130443843 15:83980497-83980519 CAAATTAGGGGAAATTTACATGG + Intronic
1130509605 15:84578379-84578401 CATATTATGAAAAATGTTCAGGG - Intergenic
1130864049 15:87916921-87916943 GAAAATATGAAAAATTAGCTGGG - Intronic
1130949909 15:88577886-88577908 CACATTAAGAAAAAATTCCTAGG - Intergenic
1131361777 15:91798865-91798887 AAAAATATAAAAAATTAACTGGG - Intergenic
1131525807 15:93151536-93151558 AAAATTATAAAAAAATTATTTGG - Intergenic
1131722901 15:95189930-95189952 GAAGTCATAAAAAATTTACTTGG - Intergenic
1131834567 15:96377177-96377199 CAAAAAATTAAAAATTAACTGGG - Intergenic
1131910306 15:97192176-97192198 AAAAATATAAAAAATTTGCTGGG - Intergenic
1131919747 15:97311667-97311689 AAAATTATGAATACTGTACTAGG - Intergenic
1132355988 15:101171671-101171693 AAAAATATGAAAAATTAACCTGG + Intergenic
1132388516 15:101420520-101420542 AAAATTTTGAAAAATTTAGCCGG - Intronic
1133201942 16:4209111-4209133 AAAAATATGAAAAATTAGCTGGG + Intronic
1133291013 16:4721142-4721164 AAAAATATGAAAAATTAGCTGGG + Intronic
1133320149 16:4908698-4908720 AAAAATATGAAAAATTTGCCAGG - Intronic
1133603160 16:7359821-7359843 GAAAATATGAAAAATTAGCTGGG + Intronic
1134071330 16:11261726-11261748 AAAAATATGAAAAAATTAGTTGG + Intronic
1134126042 16:11616749-11616771 AAAATTCTTAAAAATTTACCGGG + Intronic
1134147531 16:11778274-11778296 CAAAATACAAAAAATTTGCTGGG + Intronic
1134288065 16:12879572-12879594 AAAATTACGAAAAACTGACTGGG - Intergenic
1134392784 16:13834969-13834991 AAATTTATGACACATTTACTTGG + Intergenic
1134484178 16:14644000-14644022 AAAAATATGAAAAATTAGCTGGG + Intronic
1134595205 16:15490441-15490463 AAAATTTTGAAAAATTAGCTAGG - Intronic
1134654166 16:15934579-15934601 AAAAGTATAAAAAATTAACTGGG - Intergenic
1135270870 16:21068472-21068494 AAAAATATAAAAAATTAACTGGG - Intronic
1135285951 16:21193327-21193349 CAAATTATTACAAGTTTAGTGGG + Intergenic
1135413086 16:22249766-22249788 AAAATTTTTAAAAATTGACTGGG - Intronic
1135725360 16:24850096-24850118 CAAATTTTTAAAAATTAGCTGGG - Intronic
1135922034 16:26659565-26659587 CAAAATATATAAAATTTAATTGG + Intergenic
1136265162 16:29112262-29112284 TAAATTTTTAAAAATTGACTAGG + Intergenic
1136292910 16:29286529-29286551 CAAATTTTGAGAAATTGGCTGGG + Intergenic
1136424748 16:30162240-30162262 CAAAAAATGAAAAATTAGCTAGG + Intergenic
1136644500 16:31598832-31598854 CAAATTTTAAAAAATTAACCAGG - Intergenic
1136865846 16:33752468-33752490 CATATTATGAAATATGTATTTGG - Intergenic
1137455181 16:48612474-48612496 CAAAATATAAAAAATTAGCTGGG + Intronic
1138055514 16:53829049-53829071 AAAATTATAAAAAATTAGCTGGG - Intronic
1139016739 16:62698413-62698435 GAATTTAGGGAAAATTTACTAGG - Intergenic
1139083647 16:63558396-63558418 CAACTTATGATAAATTTATCAGG - Intergenic
1139213769 16:65107571-65107593 CAAATCCTGTAAAATTTCCTTGG + Intronic
1139455865 16:67075934-67075956 AAAATTTTTAAAAATTAACTGGG + Intronic
1139565115 16:67769902-67769924 CAAAAAATGAAAAATTAGCTGGG + Intronic
1139928732 16:70507699-70507721 AAAATTATAAAAAATTAGCTGGG + Intronic
1140299722 16:73745251-73745273 CATATTATGAAACAACTACTAGG - Intergenic
1140384501 16:74522842-74522864 AAAAATATGAAAAATTAGCTGGG - Intronic
1140440417 16:74983815-74983837 AAAAAAATGAAAAATTTAGTCGG + Intronic
1140847635 16:78905540-78905562 CAAAAAATAAAAAATTAACTAGG - Intronic
1141341253 16:83205763-83205785 TAAAATATAAAAAATTAACTGGG - Intronic
1142053962 16:87980237-87980259 TAAATTTTAAAAAATTGACTAGG + Intronic
1142098796 16:88260535-88260557 CAAATTTTGAGAAATTGGCTGGG + Intergenic
1203106307 16_KI270728v1_random:1363635-1363657 CATATTATGAAATATATATTTGG + Intergenic
1203127207 16_KI270728v1_random:1598733-1598755 CATATTATGAAATATATATTTGG - Intergenic
1142470390 17:160386-160408 CAAATTCTGCAAAAGTAACTGGG + Intronic
1142563507 17:825068-825090 CAAATAATAAAAAATTAGCTGGG + Intronic
1143312861 17:6007651-6007673 AAAAATATGAAAAATTAGCTGGG - Intronic
1143500905 17:7338174-7338196 CAAATTGTCACAAATTTAGTGGG + Intronic
1143533936 17:7524398-7524420 AAAAATATGAAAAATTAGCTGGG - Intergenic
1144044921 17:11446758-11446780 CACAAGATGAAAAATTTTCTGGG - Intronic
1144158370 17:12531383-12531405 CAAACTATTAAAAATATACAAGG - Intergenic
1144379056 17:14674731-14674753 CAAATTAGGAACAATTCTCTGGG + Intergenic
1144416011 17:15047954-15047976 CTAATTTTTAAAGATTTACTTGG + Intergenic
1144471991 17:15552090-15552112 CAAATTCTTAAAATTTTTCTGGG - Intronic
1144531763 17:16045972-16045994 CAAAATATAAAAAATTAGCTGGG - Intronic
1144696753 17:17309284-17309306 CAAAAAATGAAAAATTAGCTGGG - Intronic
1144818973 17:18057992-18058014 AAAAATATGAAAAAATTAGTTGG - Intronic
1144912871 17:18697696-18697718 AAAATTATAAAAAAATTAGTTGG + Intergenic
1144970370 17:19105288-19105310 AAAAATATGAAAAATTAATTGGG - Intergenic
1144990675 17:19231450-19231472 AAAAATATGAAAAATTAATTGGG - Intronic
1145417130 17:22726923-22726945 AAAATTATGTTAAATTTACATGG - Intergenic
1145729707 17:27167187-27167209 AAAAATACAAAAAATTTACTGGG + Intergenic
1145756135 17:27391396-27391418 GAAATTAAAAAAAATTTAATTGG - Intergenic
1145757230 17:27401521-27401543 AAAATTTTTAAAAATTTGCTGGG + Intergenic
1145827152 17:27885547-27885569 CAAAAAATAAAAAATTAACTGGG + Intronic
1145985241 17:29041577-29041599 AAAAATATGAAAAATTAGCTGGG + Intronic
1146026559 17:29326630-29326652 CAAATTTTAAAAAATTAACCAGG + Intergenic
1146814005 17:35927844-35927866 AAGATTATGAAACATTTACTTGG - Intronic
1146976154 17:37114024-37114046 CAAATAATAAAAAATTAGCTGGG + Intronic
1147224474 17:38966135-38966157 CAAATTAAGATTATTTTACTTGG - Intronic
1147367614 17:39969685-39969707 CAAATTATAAAGAATTTAGGTGG + Intronic
1147413975 17:40275078-40275100 AAAAATATAAAAAATTAACTGGG + Intronic
1147595337 17:41713074-41713096 AAAAATATGAAAAATTAGCTGGG - Intronic
1147610158 17:41797237-41797259 CAAAATATAAAAAATTAGCTGGG - Intergenic
1147834779 17:43322313-43322335 AAAAATAGGAAAAATTTGCTGGG + Intergenic
1147900648 17:43781489-43781511 AAAAATATGAAAAATTAGCTGGG - Intronic
1148162758 17:45460716-45460738 AAAAATATAAAAAATTTGCTGGG - Intronic
1148512977 17:48188837-48188859 AAAAATATGAAAAATTAGCTGGG + Intronic
1148514929 17:48207850-48207872 CAAATCAAGAAAAATTTATCTGG + Intronic
1148928725 17:51110526-51110548 CAAAATATCAAAAATTAGCTGGG + Intronic
1148972231 17:51493603-51493625 GAAATTATGAAAAACCTCCTTGG + Intergenic
1149742687 17:59062548-59062570 AGAAATATGAAAAACTTACTGGG + Exonic
1149750195 17:59138589-59138611 AAAAATACAAAAAATTTACTAGG - Intronic
1149802914 17:59587383-59587405 CAAAATATAAAAAAATTACCTGG - Intronic
1149804660 17:59604535-59604557 TAAATTATGACAAATGAACTAGG + Intronic
1149843572 17:59988095-59988117 CAAAATATAAAAAAATTACCTGG + Intergenic
1149947502 17:60946352-60946374 AAAATTATGAAACTTTTACAAGG + Intronic
1150036264 17:61802297-61802319 CAAAAAATAAAAAATTTTCTAGG + Intronic
1150393989 17:64807379-64807401 AAAAATATAAAAAATTTGCTGGG - Intergenic
1150800782 17:68280963-68280985 GAAAATACGAAAAATTAACTGGG + Intronic
1151044846 17:70907614-70907636 CAAACTATGAAATATTAATTGGG + Intergenic
1153187515 18:2501606-2501628 CAAATTTTAAAAAATTAGCTGGG - Intergenic
1153479567 18:5533818-5533840 GAAATTATGTAAAATTTAAAAGG - Intronic
1153883710 18:9443821-9443843 AAAATCATGAAATATTTAATAGG - Intergenic
1154061743 18:11068079-11068101 AAAAATATGAAAAATTAGCTGGG - Intronic
1154129878 18:11727436-11727458 CAAAAAATAAAAAATTTCCTGGG + Intronic
1155499784 18:26475689-26475711 AAAAATATGAAAAATTAGCTAGG + Intronic
1155644418 18:28060344-28060366 AAAAATATGAAAAATTAGCTGGG - Intronic
1155841153 18:30644022-30644044 GATATTATGAAAAATATATTTGG - Intergenic
1155860879 18:30897851-30897873 CAACTTCTGAATAATTTGCTTGG - Intergenic
1155978973 18:32161138-32161160 CAAAATAAAAAAAATTTACCAGG + Intronic
1156012935 18:32514955-32514977 CAGATTTTGAAAGATTTAATAGG + Intergenic
1156713880 18:39982752-39982774 AAAAATATGAAAAATTAGCTAGG - Intergenic
1156795387 18:41039101-41039123 TAAATTATAAAAAATATTCTGGG - Intergenic
1156813445 18:41280005-41280027 TAAATTTTGCAAAATTTATTTGG + Intergenic
1157063071 18:44315961-44315983 AAAAATATGAAAAATTAGCTGGG - Intergenic
1157380425 18:47209928-47209950 CAAAATAAAAAAAATTTGCTGGG + Intergenic
1157456649 18:47836511-47836533 CAAATTAAGAACATTTTACCAGG + Exonic
1158067771 18:53433717-53433739 GAAATTGTGAAAATTTTAGTGGG - Intronic
1158128439 18:54127001-54127023 CAAATAACTAAAAATTTGCTGGG - Intergenic
1158131732 18:54159576-54159598 CAAAATACAAAAAATTAACTGGG - Intronic
1158455623 18:57604726-57604748 CAAATAATAAAAAATTAGCTGGG + Intronic
1158476259 18:57782405-57782427 CGCATAATAAAAAATTTACTTGG - Intronic
1158737187 18:60095844-60095866 AACCTTATGAAAAATTTACAAGG + Intergenic
1159847492 18:73481055-73481077 CTAATTATTAAAAATTTATAAGG + Intergenic
1159916974 18:74196761-74196783 CAAATTTTTTAAAATTTAATTGG - Intergenic
1160028002 18:75234601-75234623 CAAAAGATGCAAAATTTAATGGG - Intronic
1160643667 19:165336-165358 CAAATGATTAAAAATTTAAAGGG - Intergenic
1161109072 19:2458940-2458962 CTAATTATTAAAAATTTTTTTGG - Intergenic
1161656288 19:5517361-5517383 AAAATTAGGAAAAAATTACCTGG + Intergenic
1161659691 19:5538368-5538390 CAAAAAATTAAAAATTAACTTGG - Intergenic
1161675320 19:5644221-5644243 CAATTCCTGAAGAATTTACTAGG + Intronic
1162617183 19:11811583-11811605 CAATCTATGAAAAATTAAATTGG + Intergenic
1162842432 19:13366121-13366143 AAAAATATGAAAAATTAGCTGGG - Intronic
1163010219 19:14420562-14420584 CAAATTTTTAAAAATTAGCTGGG - Intergenic
1163733470 19:18963839-18963861 CAAAAAATAAAAAATTAACTAGG + Intergenic
1164439694 19:28264256-28264278 CTAATTCTGACAATTTTACTTGG + Intergenic
1165010765 19:32844668-32844690 AAAAATATGAAAAATTAGCTGGG + Intronic
1165183860 19:33999815-33999837 CTAATTATTAAAATTTCACTTGG - Intergenic
1165210933 19:34235198-34235220 CTAATTTTTAAAAAATTACTTGG - Intergenic
1165442798 19:35840162-35840184 AAAAATATGAAAAATTAGCTGGG - Intronic
1165674125 19:37706848-37706870 CTAAATATGAAAAATTAGCTAGG - Intronic
1165674145 19:37706983-37707005 AAAAATATGAAAAATTAGCTAGG - Intronic
1167135328 19:47612251-47612273 CAAAAAATGAAAAAATTAGTTGG + Intronic
1167345292 19:48941832-48941854 CAAAAAATAAAAAATTTAGTTGG - Intronic
1167459565 19:49617468-49617490 CAAATTTTTAAAAATTAGCTGGG + Intronic
1167554480 19:50185415-50185437 AAAAATATAAAAAATTAACTGGG - Intergenic
1168350513 19:55673217-55673239 CAAACTATAAAAAATATCCTCGG - Intronic
925102531 2:1260381-1260403 CCATTTTTGAAAAATTTATTTGG + Intronic
925378949 2:3410225-3410247 CTGAATATGAAAGATTTACTTGG - Intronic
926524098 2:13954775-13954797 CAAATAATGAAAAATATCTTGGG - Intergenic
926593141 2:14760831-14760853 CAAATTTGAAAAAATTTAATGGG + Intergenic
926661855 2:15475760-15475782 AAAACTTTGAAGAATTTACTGGG - Exonic
927647969 2:24891028-24891050 TAAAATATGAAAAAATTGCTGGG - Intronic
927755180 2:25702519-25702541 CAAATGATGAAACTTCTACTGGG - Intergenic
928014223 2:27639682-27639704 CAAAATATAAAAAATTAGCTGGG - Intronic
928137503 2:28699094-28699116 AAAATAAAGAAAAATTAACTGGG + Intergenic
928404182 2:31001981-31002003 CAGATTATAAACAATTTTCTTGG - Intronic
928563335 2:32515510-32515532 CATATTATGAAAGATTGGCTTGG + Exonic
929160874 2:38830931-38830953 CAAAAAATTAAAAATTTAGTAGG + Intronic
930133089 2:47872958-47872980 CACATTAAAAAAAATCTACTGGG + Intronic
930441000 2:51405722-51405744 AAAAATATGAAAAATTTGCCAGG - Intergenic
930917472 2:56711164-56711186 AAAATTATAAAATATTTACAAGG + Intergenic
931129349 2:59316299-59316321 CAAATAATAAAAAAATTACCTGG - Intergenic
931504966 2:62915667-62915689 AAAATGATTAAAAATTTATTTGG + Intronic
931899978 2:66777568-66777590 TAAGTTATGAAAAAGTTACTGGG + Intergenic
932037558 2:68261932-68261954 AAAATTATGCAAAATTTTTTTGG + Intergenic
932040303 2:68292532-68292554 CCAATAATGTAATATTTACTTGG - Intronic
932753775 2:74390920-74390942 AGAATTTTGAAAATTTTACTAGG - Intronic
933359297 2:81258577-81258599 GAAAAGATGAAAAATTTAATGGG - Intergenic
933394561 2:81714440-81714462 GAAATTATAAAAAATTAGCTGGG + Intergenic
933540135 2:83629667-83629689 CAAAATATTTAAAATTAACTTGG - Intergenic
934324879 2:92003859-92003881 CACATTATGAAGAATTTTTTAGG + Intergenic
934463262 2:94234568-94234590 CACATTATGAAGAATTTTTTAGG + Intergenic
934628457 2:95886794-95886816 GAAATAATGAATTATTTACTTGG - Intronic
934634366 2:95969335-95969357 CATATTATGAAATATATATTTGG - Intronic
934799266 2:97135904-97135926 CATATTATGAAATATATATTTGG + Intronic
934805067 2:97214729-97214751 GAAATAATGAATTATTTACTTGG + Intronic
934832415 2:97542657-97542679 GAAATAATGAATTATTTACTTGG - Intronic
934834174 2:97567565-97567587 CATATTATGAAATATATATTTGG - Intronic
935012714 2:99150713-99150735 CAAATCAAGAAAACTTTACAAGG + Exonic
935217497 2:100986119-100986141 GAAATTAAGAAGAATTTTCTGGG - Intronic
936121028 2:109745276-109745298 AAAATTTTAAAAAATTAACTGGG - Intergenic
936139476 2:109926809-109926831 TAAATTAAAAAAAATCTACTTGG + Intergenic
936205220 2:110444677-110444699 TAAATTAAAAAAAATCTACTTGG - Intronic
936223667 2:110626195-110626217 AAAATTTTAAAAAATTAACTGGG + Intergenic
936436754 2:112514219-112514241 CAAAATATGCAAAATTAGCTGGG + Intronic
936872709 2:117151819-117151841 CACATCATGAATAATTTAATTGG + Intergenic
937148546 2:119669276-119669298 AAAAATATGAAAAATTAGCTGGG + Intergenic
937955845 2:127421418-127421440 CACATTTTGGAAAATTTCCTTGG - Exonic
938045137 2:128111974-128111996 CAAAATATACAAAATTTAGTTGG + Intronic
938393592 2:130924425-130924447 AAAATTATAAAAAATTAGCTGGG - Intronic
938713852 2:134000754-134000776 CAAATTTTTAAAAATTAGCTGGG + Intergenic
939049272 2:137288288-137288310 CATGTCATGAAAAATTTACATGG + Intronic
939173776 2:138726202-138726224 AAAAATATGAAAAAATTAGTTGG - Intronic
939764528 2:146229763-146229785 CAAATACTGAAGAATTTTCTGGG + Intergenic
939912967 2:148005812-148005834 CAAAATATGAAAAAATTAGCTGG + Intronic
939949857 2:148456740-148456762 GAAAATATCAAAAATTTACTGGG - Intronic
939978735 2:148752797-148752819 GAAATCATGAGAAATTTATTTGG + Intronic
940040675 2:149356981-149357003 CAACTCTTCAAAAATTTACTGGG + Intronic
940061400 2:149573962-149573984 TAAAATATCAAATATTTACTTGG + Intronic
940112204 2:150167291-150167313 AAAAATATAAAAAATTAACTAGG + Intergenic
940120786 2:150262788-150262810 CAAATTATTAAAAATTTGCATGG + Intergenic
940206249 2:151205065-151205087 CAATTCATTAAAAATTTACTTGG - Intergenic
940294353 2:152106818-152106840 TTAATTATGACAAATTTACCAGG + Intergenic
941030229 2:160502491-160502513 AAAAATACGAAAAATTAACTGGG + Intergenic
941191067 2:162382955-162382977 CTAATTTTTAAAAATTTACAGGG - Intronic
941579990 2:167284122-167284144 CAACTTATCAAAAATGTAATAGG - Intergenic
941663979 2:168225416-168225438 AAAATTCTGAAAAATATACCTGG - Intronic
941711933 2:168723947-168723969 CAAATAATCAAATATTTAGTGGG + Intronic
941911422 2:170768984-170769006 AAAAATATAAAAAATTAACTGGG - Intergenic
942481953 2:176398030-176398052 CAAAATAGGAATAATATACTTGG - Intergenic
942500230 2:176581565-176581587 CAGGTTATGTGAAATTTACTTGG - Intergenic
942656345 2:178217958-178217980 AAAGTTAGGAAGAATTTACTTGG - Intronic
943214144 2:185008943-185008965 GAAATTATGAAAATTCTAATGGG + Intergenic
943389993 2:187253720-187253742 CAATTTTTAGAAAATTTACTTGG + Intergenic
943418132 2:187634846-187634868 CAAAATATAAAAAATTAGCTGGG + Intergenic
943567869 2:189537889-189537911 CAAATTTTAATAAATTTACATGG - Intergenic
943876648 2:193074500-193074522 CAATTTATCAAGAATCTACTAGG + Intergenic
943981989 2:194565164-194565186 CAAATTATAAAAAAATTATATGG - Intergenic
944045504 2:195406829-195406851 AAAATTATGACAAATGTTCTGGG - Intergenic
944166916 2:196732766-196732788 CAAATTAACACAAATTTATTGGG - Exonic
944502739 2:200378615-200378637 AAAATTATTAAATGTTTACTAGG + Intronic
944577648 2:201105041-201105063 CAAATAATAAAAAATTAGCTGGG + Intergenic
944993957 2:205272226-205272248 CAAATTAAGCAAAATTTTATTGG - Intronic
945079398 2:206073672-206073694 AAAAATATGAAAAATTAGCTGGG - Intronic
945447846 2:209959462-209959484 GAAATTGTGAAAGATTAACTAGG - Intronic
945570027 2:211455554-211455576 CAAATTATGAGAGATTTATGTGG - Intronic
945627304 2:212226425-212226447 TAAATTATCACAAATTTAATGGG - Intronic
945661387 2:212689233-212689255 CAAAATATGAAAAATTAGCCAGG + Intergenic
945721129 2:213420520-213420542 CAAATTCTAAAATATTTTCTTGG - Intronic
946112235 2:217430125-217430147 CACATCAAGTAAAATTTACTTGG + Intronic
946620432 2:221555910-221555932 CAGATTATGAAAAAGTTTTTAGG + Intronic
946722904 2:222629900-222629922 CAAAAAATTAAAAAATTACTTGG - Intronic
946734743 2:222743098-222743120 CAAATAATGAAAAAATTAGCTGG + Intergenic
946925057 2:224618219-224618241 CAAAAAATGAAAAATTAACCAGG + Intergenic
946937022 2:224732827-224732849 CTAATTTTAAAAAATTTATTAGG - Intergenic
947209526 2:227695439-227695461 CAAAATACGAAAAATTAGCTAGG + Intronic
947615897 2:231556807-231556829 TAAAATATGAAAAATTAGCTGGG - Intergenic
947852165 2:233297117-233297139 CAAAATATAAAAAATTAGCTGGG - Intergenic
947969972 2:234315232-234315254 CAAAATATAAAAAATTAGCTGGG - Intergenic
948546298 2:238731405-238731427 AAAATAAAAAAAAATTTACTGGG + Intergenic
1168950760 20:1800040-1800062 CCAATTTTTAAAAATCTACTAGG + Intergenic
1169681473 20:8218730-8218752 AAAATTCTGAAATATTTTCTAGG - Intronic
1169797835 20:9484055-9484077 AAAATTAGGAAAAATTTCCAAGG + Intergenic
1169822231 20:9724180-9724202 CAAATTAAAAAAAATTTTTTTGG - Intronic
1169831654 20:9831806-9831828 CAAATTTTAAAAAATGTAGTAGG - Intronic
1170154807 20:13259443-13259465 AATATTATGAAAATTTTATTTGG - Intronic
1170168136 20:13382483-13382505 CAAAATATAAAAAATTATCTGGG + Intergenic
1170302527 20:14901090-14901112 CAAAATATGAAAAATGCATTTGG - Intronic
1170449642 20:16469089-16469111 CAAAAAATAAAAAATTAACTGGG + Intronic
1171562559 20:26138075-26138097 AAAATTACAAAAAATTTGCTGGG - Intergenic
1171751144 20:29050346-29050368 CAAAAATTGAAAAATTTGCTGGG + Intergenic
1172999526 20:39095583-39095605 CAAAAAATCAAAAATTGACTGGG - Intergenic
1173589420 20:44212553-44212575 AAAAATATGAAAAATTGGCTGGG + Intergenic
1173653141 20:44680315-44680337 CAATTTTTTAAAAATTTGCTGGG - Intergenic
1173673791 20:44816203-44816225 CAAAATATGTAAAATTTAAGGGG - Intergenic
1173778360 20:45731663-45731685 CAAAATATAAAAAATTATCTGGG - Intergenic
1173894992 20:46544047-46544069 AAAAATATTAAAAATTAACTGGG + Intronic
1174004085 20:47396418-47396440 CAAAATATGAAAAATTAGCAGGG + Intergenic
1174850219 20:53986734-53986756 CAAATAATAAAAAATTAGCTGGG + Intronic
1175025377 20:55896239-55896261 CAAATTTTAAAAAATTAGCTAGG - Intergenic
1176142152 20:63549485-63549507 CAAATAATAAAAAATTTATCTGG - Intronic
1176313631 21:5220583-5220605 CAAAAATTGAAAAATTTGCTGGG - Intergenic
1176362028 21:6006018-6006040 AAAAATGTGAAAAATTAACTGGG + Intergenic
1176594309 21:8677618-8677640 CACATTATGAAGAATTTTTTAGG + Intergenic
1177222505 21:18212639-18212661 TAAATTATAAAAAATTAACTGGG + Intronic
1177321578 21:19528383-19528405 GAAATTTTGAAGAATTTGCTTGG - Intergenic
1177353295 21:19973642-19973664 CAAATTACCAGAAACTTACTAGG + Intergenic
1177512052 21:22100168-22100190 GAAATTATGAAGAAAATACTAGG - Intergenic
1177743863 21:25187291-25187313 AAAATTTTTAAAAATTAACTGGG + Intergenic
1177775795 21:25564433-25564455 CACATTAACAAAAATTTTCTGGG - Intergenic
1178497941 21:33102591-33102613 AAAAATATGAAAAATTAGCTGGG + Intergenic
1178517992 21:33264828-33264850 CAAAATTAGAAAAATTAACTGGG + Intronic
1179102941 21:38371859-38371881 CAAATTTTAAAAATTTTATTGGG + Intergenic
1179201745 21:39229899-39229921 CAAATAATAAAAAATTAGCTTGG - Intronic
1179238770 21:39569961-39569983 AAAAATATGAAAAATTAGCTGGG + Intronic
1179424180 21:41260302-41260324 CAAAATACCAAAAATTTTCTGGG - Intronic
1179526840 21:41984223-41984245 CAAATTATCCTAAATTTAGTAGG - Intergenic
1179761490 21:43532527-43532549 AAAAATGTGAAAAATTAACTGGG - Intronic
1180277162 22:10654752-10654774 CACATTATGAAGAATTTTTTAGG + Intergenic
1180391454 22:12286689-12286711 CAAAAATTGAAAAATTTGCTGGG - Intergenic
1180408289 22:12578065-12578087 CAAAAATTGAAAAATTTGCTGGG + Intergenic
1180578078 22:16799250-16799272 AAAAATATGAAAAAATTAGTCGG + Intronic
1180584385 22:16873641-16873663 CACATTATGAAGAATTTTTTAGG + Intergenic
1180630792 22:17228397-17228419 AAAATTATGACAAATAGACTGGG + Intergenic
1180885170 22:19238248-19238270 TAAAATATAAAAAATTAACTGGG - Intronic
1182196243 22:28521245-28521267 AAAATTAAAAAAAATTAACTGGG + Intronic
1182587672 22:31354440-31354462 AAAAATATAAAAAATTAACTGGG + Intergenic
1183067531 22:35373318-35373340 CAAAATATAAAAAATTTGCCAGG + Intergenic
1183652697 22:39167672-39167694 CAAAATATCAAAAATTAGCTGGG + Intergenic
1183761486 22:39823504-39823526 AAAATTAAAAAAAATTTAGTCGG - Intronic
1183811874 22:40264715-40264737 CAAATTATGCAAATTCCACTTGG + Exonic
1183843122 22:40517081-40517103 CAAATAATGAAAAATTAGCCAGG - Intronic
949690541 3:6632176-6632198 TTATTTATGAAAAAATTACTTGG - Intergenic
949995860 3:9616657-9616679 AAAACTATGAAAAATTAGCTGGG + Intergenic
950059371 3:10057013-10057035 AAAATTATAAAAAATTAGCTGGG - Intronic
950753999 3:15157059-15157081 CCAATTAAGAACAATTTAGTTGG + Intergenic
950885653 3:16360329-16360351 CAAATAATAAAAAATTAGCTGGG - Intronic
951251338 3:20397229-20397251 TGAATTATAACAAATTTACTTGG - Intergenic
952061902 3:29521302-29521324 CAAGTAATGATAAATGTACTAGG - Intronic
952291248 3:32018201-32018223 AAAATTATGAAATAATTACAGGG + Intronic
952482135 3:33772399-33772421 CAAAAAATAAAAAATTAACTGGG + Intergenic
952614923 3:35259534-35259556 AAAATTATCAAAAATTAAGTGGG + Intergenic
952931232 3:38362397-38362419 CAAAAAATGAAAAATTTAGCTGG - Intronic
953094372 3:39760213-39760235 AAAATAATTAAAAATTAACTAGG - Intergenic
953779870 3:45858508-45858530 CAAATGATAAAAAATATATTAGG - Intronic
953963506 3:47284069-47284091 CAAATAATAAAAAATTGTCTGGG + Intronic
953999383 3:47543843-47543865 GAAAATATGAAAAATTAGCTGGG - Intergenic
954905003 3:54054015-54054037 CAAATTATGAAATCTTTCTTTGG - Intergenic
955187055 3:56724389-56724411 AAAAATATGAAAAATTAGCTGGG - Intergenic
955357641 3:58244601-58244623 CAAAAAATGAAAAATTAGCTGGG + Intronic
955700036 3:61672996-61673018 CAAAATATAAAAAATTAGCTGGG + Intronic
956410398 3:68973011-68973033 CAAAATATGAAAAATTATCCGGG + Intergenic
957143501 3:76392137-76392159 CTAATTATGAAGAATATCCTTGG + Intronic
957202298 3:77152247-77152269 TAAATCATTTAAAATTTACTAGG + Intronic
957375571 3:79353242-79353264 CAAATTATTAAGAATTTAATTGG + Intronic
957444860 3:80302958-80302980 AAAATTAAGAAAATTTTACCAGG - Intergenic
957828413 3:85482065-85482087 CATATTAAGAAAAAAATACTTGG + Intronic
957947306 3:87081500-87081522 CAAATTTTAAAAAATTAACCTGG - Intergenic
958034215 3:88150443-88150465 AAAATTTTAAAAAATTTTCTGGG + Intronic
958482256 3:94657635-94657657 CATATTATCAGAAATTTGCTTGG + Intergenic
958725463 3:97900185-97900207 AAAATTAAGCAAAATTAACTGGG + Intronic
958767512 3:98387512-98387534 CAAAATAAGAAAAATTGATTTGG + Intergenic
959011608 3:101083815-101083837 TAAATTATAAAAAATTTAAAAGG - Intergenic
959212666 3:103407942-103407964 CCAAGTAAGAATAATTTACTAGG - Intergenic
959350648 3:105258024-105258046 CAAATAATGAAAAAGTATCTGGG - Intergenic
959357197 3:105346988-105347010 AAAATTATGTAAAATTAAATGGG - Intergenic
959783040 3:110259117-110259139 AAAAATATAAAAAATTTAGTTGG - Intergenic
960400289 3:117189098-117189120 AAAATAATTAAAAATTCACTTGG + Intergenic
960489096 3:118289698-118289720 CAATTTATGATGAATTTATTAGG - Intergenic
960594354 3:119394509-119394531 ATCATTATGAAAAATTTCCTTGG - Intronic
960925186 3:122788404-122788426 TAAATTATCGAAAATTCACTTGG - Intronic
961113503 3:124306233-124306255 CAAAAAATGAAAAATTAGCTAGG - Intronic
961259054 3:125584934-125584956 AAAATAATTAAAAATTAACTGGG - Intronic
961623425 3:128242656-128242678 AAAATAATGAAAAACTTACAAGG - Intronic
961687277 3:128642855-128642877 AAAATTACAAAAAATTAACTGGG + Intronic
961706794 3:128793182-128793204 CTAAATATGAAAAATTAGCTGGG - Intronic
961758507 3:129146896-129146918 AAAAATATGAAAAATTAACTGGG + Intronic
961843397 3:129737788-129737810 GAAATTATGGTAAATTTAGTAGG - Intronic
962247819 3:133811741-133811763 AAAATTATGAAAAATTAGCAGGG - Intronic
963190189 3:142462282-142462304 CAGATTATTAAAAATGTCCTGGG + Intronic
963738528 3:149050562-149050584 TAAATTATTTAAAATTTACTTGG + Intronic
963855522 3:150249427-150249449 AAAATTATGAATAAATCACTTGG + Intergenic
964078762 3:152725311-152725333 CAGATTAGGAAAAATTAGCTGGG + Intergenic
964328777 3:155577097-155577119 CAGATTATTAAAAATTAGCTGGG + Intronic
964389821 3:156185350-156185372 CAAATTATCAACAATTTCCTGGG + Intronic
964942288 3:162173944-162173966 CAAATTATGCAAAAGGAACTGGG - Intergenic
965002603 3:162974791-162974813 TAAATTATGAAAAAGTGACAAGG + Intergenic
965148392 3:164937426-164937448 CACACTATCAAAAATTCACTAGG - Intergenic
965270920 3:166616306-166616328 CACATCAGGAAAAATATACTTGG - Intergenic
965354059 3:167652060-167652082 CAAAATATGCTAAATTTACTTGG + Intronic
965575085 3:170209836-170209858 CAAGTTATGATTATTTTACTGGG - Intergenic
965782488 3:172301695-172301717 CAAAAAATGAAAAATTAGCTGGG + Intronic
965894793 3:173562404-173562426 TAAAATATAAAAAATTGACTGGG + Intronic
966244505 3:177791539-177791561 GAAATTATGGAAAGTTTACTGGG + Intergenic
966513467 3:180790676-180790698 CAAAATATGAAGAAATTACATGG - Intronic
966663443 3:182443098-182443120 AAAATTATGAAAAAGTTAAGTGG + Intergenic
966750797 3:183320251-183320273 AAAAATATGAAAAATTAGCTGGG - Intronic
966856815 3:184199849-184199871 AAAAATATAAAAAATTAACTGGG + Intronic
967760093 3:193214307-193214329 CTAATTATGGACAATTTACAGGG - Intergenic
967804546 3:193703802-193703824 CAAATTATGATGAGTTTATTGGG - Intergenic
968420357 4:479066-479088 GAAATTTTTAAAAATTAACTTGG - Intronic
968475890 4:808106-808128 AAAATTATGAAAAATTCGCCAGG + Intronic
968678896 4:1902384-1902406 CAAAAAATAAAAAATTAACTGGG - Intronic
969909331 4:10428847-10428869 CAAATAATAAAAAATTGGCTGGG - Intergenic
970493617 4:16602704-16602726 CAAGTTATTAAAAATTTGGTAGG - Intronic
970876247 4:20873796-20873818 CAGATTTTGAAAACTTTCCTGGG - Intronic
970942675 4:21653649-21653671 CTACTTATTAAATATTTACTAGG + Intronic
971002152 4:22335681-22335703 ATAATAATAAAAAATTTACTTGG - Intergenic
971089699 4:23326935-23326957 CAAATTATGAAAAGTGTTCTAGG + Intergenic
971094190 4:23380177-23380199 CTAATTTTAAAAAATTTATTGGG + Intergenic
971256085 4:25014668-25014690 AAAATTAAGAAAAATTAGCTGGG + Intronic
971488026 4:27181188-27181210 AAAATTACAAAAAATTAACTGGG - Intergenic
971504347 4:27349871-27349893 TAAATTTTAAAAAATTTTCTAGG - Intergenic
971775046 4:30952331-30952353 GAAATTATGAAAATTATACATGG + Intronic
971844246 4:31897848-31897870 AAAAATATGAAAAATTAGCTGGG - Intergenic
971977289 4:33707191-33707213 AAAAATATAAAAAATTTTCTGGG + Intergenic
972353703 4:38260658-38260680 AAAAATATGAAAAATTAGCTGGG + Intergenic
972474214 4:39435276-39435298 CAAAATATAAAAAATTAGCTGGG - Intronic
972540226 4:40032580-40032602 CAAAATATGCAAAATTTACCTGG - Intergenic
972752230 4:42002144-42002166 CAAAGTAAAAAAAAATTACTTGG - Intronic
972960201 4:44445677-44445699 GAAATTTTGAAAATCTTACTTGG - Intronic
973633987 4:52845115-52845137 AAAATTAAAAAAAAATTACTGGG + Intergenic
973663686 4:53135579-53135601 AAAAATATGAAAAATTAGCTGGG + Intronic
973715724 4:53674083-53674105 CAAAAAATAAAAAATTTAGTTGG - Intronic
974008039 4:56579606-56579628 CAAATAATTAAAAAATTAATTGG + Intronic
974096033 4:57365418-57365440 TAAAAGATGAAAAATTTCCTTGG + Intergenic
974309923 4:60192052-60192074 CAAAATACAAAAAATTAACTGGG + Intergenic
974332371 4:60497116-60497138 CAAAATATAAAAAATTAGCTGGG + Intergenic
974500497 4:62694463-62694485 TAAATTATGAAATACTTACATGG + Intergenic
974662732 4:64915153-64915175 CAATGTATGAAAATTTTAATTGG + Intergenic
974699239 4:65417615-65417637 CAAATTAAGAAAAAATGACTTGG - Intronic
974938442 4:68435635-68435657 CAAATTTTCAAAAAAATACTTGG - Intergenic
975074537 4:70188755-70188777 CACTTTAAAAAAAATTTACTTGG - Intergenic
975102357 4:70528487-70528509 AAAAATATAAAAAATTAACTGGG + Intronic
975276745 4:72511159-72511181 CAAATTATGAAACTATTACAAGG + Intronic
975289961 4:72666104-72666126 AAAATCATCAAAAGTTTACTGGG + Intergenic
975814517 4:78203725-78203747 AAAAATATGAAAAATTATCTGGG - Intronic
975850883 4:78571170-78571192 CAAAATATTAAAAAATTACCAGG - Intronic
975876223 4:78840041-78840063 CATATTATCAAAAATTTAAATGG + Intronic
976089033 4:81435937-81435959 AAAATTTTTAAAAATTAACTGGG - Intronic
976090519 4:81452417-81452439 CAATTTTAGAAAAATTTACTGGG + Intronic
976199996 4:82568456-82568478 AAAAATATTAAAAATTAACTGGG - Intergenic
976480434 4:85537528-85537550 TAAATTTTGAAAATTTTCCTAGG + Intronic
976787158 4:88834968-88834990 CAAAATAAGTAAAATTCACTAGG - Intronic
977266273 4:94859353-94859375 TAAGTCATGAAAAATTAACTTGG - Intronic
977268722 4:94887845-94887867 CTATTTCTGAAAAATTTTCTTGG - Intronic
977532815 4:98220307-98220329 AAAAATAGGAAAAATTTGCTGGG + Intergenic
977543951 4:98352977-98352999 CAAATAATTAAAAATGTATTTGG - Intronic
977972711 4:103230074-103230096 CACATTAAGAAAAATTCATTTGG + Intergenic
978170146 4:105659963-105659985 CAACTTTTGAAAAATTAGCTTGG + Intronic
978441955 4:108742809-108742831 CATTTTATGAAAAGTTGACTCGG - Intronic
978466964 4:109018383-109018405 CTAAATATAAAAAATTTTCTGGG - Intronic
978475284 4:109121267-109121289 CAAACTATGAAAAATATAACTGG + Intronic
978562045 4:110043689-110043711 CAGATAATGAAAAATTAGCTAGG + Intergenic
978644060 4:110907504-110907526 GAAAATATGAAAAATTAGCTGGG + Intergenic
978753620 4:112280508-112280530 TAAAATATGAAAAATTAGCTGGG - Intronic
978763815 4:112383764-112383786 CAACTTATGATGGATTTACTGGG - Intronic
978803491 4:112777220-112777242 TAAATAAATAAAAATTTACTTGG - Intergenic
979364249 4:119801784-119801806 CAAAAAATGAAAAATTAGCTGGG - Intergenic
979872347 4:125839995-125840017 GAAATTATGAAAACTGTAATAGG - Intergenic
979892060 4:126110426-126110448 CAAAATACAAAAAATTTGCTGGG - Intergenic
980303344 4:131023202-131023224 CAAAATACGAAAAATTAGCTGGG + Intergenic
980589066 4:134859532-134859554 AAAATTATTAAAAGTTTACAAGG - Intergenic
980725827 4:136759034-136759056 CAAATAATGAAAAATTATCTGGG + Intergenic
980817219 4:137964163-137964185 CACATTAATAAAATTTTACTTGG - Intergenic
980945180 4:139312680-139312702 TAAAAAATGAAAAAGTTACTTGG + Intronic
981384335 4:144110249-144110271 CAAAATAGAAAACATTTACTTGG + Exonic
981467652 4:145092520-145092542 CAAATTATTAAAGTTATACTTGG - Intronic
981494536 4:145376662-145376684 TAACTTATGAAAAAATTATTTGG + Intergenic
981628248 4:146786617-146786639 CAAACTATGTAAAAATAACTAGG - Intronic
981769517 4:148291779-148291801 CAATTTATGATGAATTTATTAGG - Intronic
981873161 4:149510160-149510182 TAAATTTTTAACAATTTACTGGG + Intergenic
981976251 4:150732107-150732129 TAAATTATGAAAAAATTAAGAGG - Intronic
982151987 4:152469441-152469463 TAAAATATGAAAAATTTTGTAGG - Intronic
982322308 4:154090629-154090651 CAAGTTATAACAAATTTACAAGG - Intergenic
982426699 4:155271344-155271366 TCAATTTTTAAAAATTTACTAGG + Intergenic
982873684 4:160616705-160616727 CAAACTATGATAGATTTATTGGG + Intergenic
983003382 4:162449064-162449086 CAAATTATGTATCATTTAATAGG + Intergenic
983154923 4:164335419-164335441 AAAAATACGAAAAATTAACTGGG + Intronic
983317151 4:166146988-166147010 CAAATGATGACAAATATAATAGG - Intergenic
983331927 4:166340760-166340782 CAAATTATAAATAATTTTGTTGG + Intergenic
983389494 4:167111323-167111345 CAAATTATGAAAACCTTTCTAGG - Intronic
983737714 4:171084003-171084025 CAAATTAAGGAAAATGTACTAGG - Intergenic
983831422 4:172332770-172332792 CAACATATGAAAAAGATACTTGG - Intronic
984034337 4:174647245-174647267 AAAATTATGAAAAATTAGCCAGG + Intronic
984140452 4:175999082-175999104 GATATTATGAAAAGTTTAATGGG - Intronic
984214636 4:176895170-176895192 CAAATTTTAAAAAATTCACGGGG + Intergenic
984248126 4:177300241-177300263 CAAATTATCACAAATTCAGTGGG + Intergenic
984378062 4:178956985-178957007 AAAAATATGAAAAATTAGCTGGG - Intergenic
984404435 4:179309209-179309231 CAAGTGTTGAAAAATTAACTCGG - Intergenic
984679634 4:182592562-182592584 AAAAATATAAAAAATTCACTGGG + Intronic
985872457 5:2568359-2568381 CAAATAATAAAAAATTAGCTGGG + Intergenic
985873026 5:2573248-2573270 GAAACTAAGAAAAGTTTACTGGG + Intergenic
986210464 5:5666949-5666971 CACCTTATGTAAAATTCACTGGG - Intergenic
986519322 5:8596751-8596773 CTAATTATGAAAAATTTGCATGG - Intergenic
986936789 5:12898380-12898402 GAAATTTATAAAAATTTACTTGG + Intergenic
987442807 5:17977774-17977796 CATACTATGAAAAGATTACTTGG - Intergenic
987614924 5:20261033-20261055 CAAATTATCACAAATGTACTGGG - Intronic
987690603 5:21261843-21261865 AAAAATATGAAAAATTAGCTGGG + Intergenic
987947761 5:24635091-24635113 CAAAATGTGAAAAATTTAACAGG - Intronic
988058918 5:26140501-26140523 CCACTTTTGAAAAAATTACTTGG + Intergenic
988117124 5:26909354-26909376 CATATTTTGGAAAATTTAGTGGG - Intronic
988243442 5:28644540-28644562 CATATTAAGAAAAAATTACAAGG + Intergenic
988701530 5:33679827-33679849 CAAATTAAGAAAAATGGACATGG + Intronic
988783379 5:34543704-34543726 CAAAATATGAAAACTTGGCTGGG + Intergenic
989628370 5:43455260-43455282 CAAATAATAAAAAATTAGCTAGG + Intronic
989762118 5:45028465-45028487 AAAATTATGCAAAATCTATTTGG + Intergenic
989982403 5:50660116-50660138 CAACTTATGATGAGTTTACTGGG - Intergenic
990081260 5:51916245-51916267 CAAAATATAAAAAATTAGCTGGG - Intergenic
990747749 5:58978251-58978273 CAAATAATAAAAAATTATCTGGG + Intronic
990827558 5:59918938-59918960 CAACTATTCAAAAATTTACTGGG - Intronic
991049526 5:62257813-62257835 TAAATTTTAAAAAATTAACTGGG - Intergenic
991111594 5:62905814-62905836 AAAATTCTGTAAATTTTACTAGG + Intergenic
991196875 5:63944449-63944471 TAAAAAATGAAAAATTTAATTGG - Intergenic
991269153 5:64758785-64758807 CAAACTATGAAACTTTTTCTTGG + Intronic
991713402 5:69430064-69430086 CAAAAAATAAAAAATTAACTGGG - Intronic
991914818 5:71595057-71595079 AAAAATATGAAAAATTAGCTGGG - Intronic
992223735 5:74598089-74598111 CAAACCATGAAAAATTAACCAGG - Intergenic
992332789 5:75734548-75734570 AAAATTTTGGAAAATTTATTTGG + Intergenic
992890369 5:81198598-81198620 AAAAATATAAAAAATTTGCTGGG - Intronic
993064287 5:83078696-83078718 CAAATTAGCAAGTATTTACTGGG + Intronic
993272910 5:85818000-85818022 AAAATTATGAAATATTTGCGGGG + Intergenic
993521335 5:88905630-88905652 AAAATTAAGAAAAAATTCCTTGG + Intergenic
993662241 5:90652194-90652216 CAAACTATGAAGAATTTCATGGG - Intronic
993756621 5:91738572-91738594 CAAATTATGAAATATTTATGTGG + Intergenic
993763395 5:91824910-91824932 TAAATTATGAAAAATATCTTGGG + Intergenic
993932765 5:93961521-93961543 CAAATAATCAAAAATTAGCTAGG + Intronic
994172806 5:96676891-96676913 AAAAATATGAAAAATTATCTGGG + Intronic
994655078 5:102582583-102582605 AAAATGATTAAAAGTTTACTAGG + Intergenic
994814083 5:104561639-104561661 CAAATTAAGAATAATTTAATGGG - Intergenic
994921392 5:106048852-106048874 AAAAATATGAAAAATTAGCTGGG - Intergenic
995468658 5:112477344-112477366 TAAATTTTGAAAAATTAGCTGGG - Intergenic
995510005 5:112899466-112899488 TAAATTATGCAAAAATTTCTGGG + Intronic
995884128 5:116874475-116874497 AAAATTATGAGAAATTAAGTGGG - Intergenic
995912834 5:117208154-117208176 CAATTTTTAAAAACTTTACTTGG + Intergenic
996218686 5:120901030-120901052 CAAATTAGGAAAATTTTAAAAGG - Intergenic
996557463 5:124793742-124793764 CAATTTAACAAACATTTACTAGG - Intergenic
996663768 5:126034203-126034225 CAAGTTATACAAAACTTACTTGG + Intergenic
996669334 5:126098968-126098990 ACAATTATGGCAAATTTACTTGG - Intergenic
996862077 5:128079190-128079212 AAACTTATGAAAAATTTATCAGG - Intergenic
997324488 5:133008708-133008730 CAAATTTTGAAAAATTAGCCAGG + Intronic
997949924 5:138234298-138234320 CAAAACATGAAAAATTAGCTGGG - Intergenic
998429343 5:142057190-142057212 CAGATTATGAATAATTCACCAGG - Intergenic
998940370 5:147275483-147275505 CAAAAAATTAAAAATTTGCTAGG - Intronic
998973909 5:147623574-147623596 AAAATTAAGAAAAACTTACAAGG - Intronic
999595142 5:153194931-153194953 GAATTTCTGAAAAATATACTAGG - Intergenic
1000200231 5:159002247-159002269 CAAATTATGGAAAAAGTAATAGG - Intronic
1000327090 5:160180422-160180444 CAAAATATAAAAAATTAACTGGG + Intergenic
1000456652 5:161457604-161457626 AAAATTAAAAAAAATTTGCTGGG - Intronic
1000532909 5:162445427-162445449 CAAGTTATTAACAATTAACTTGG - Intergenic
1000870999 5:166577624-166577646 CAAATGAGTAAAAATATACTAGG + Intergenic
1001283247 5:170403256-170403278 CAAACTAGGAAAACTTTTCTAGG - Intronic
1001357293 5:171040988-171041010 AAAATTCTGAAAACTTGACTGGG + Intronic
1001945752 5:175776263-175776285 CAAAAAATGAAAAATTATCTGGG + Intergenic
1002028029 5:176408680-176408702 CAAAAAATGAAAAATTAGCTGGG - Intronic
1002255308 5:177953994-177954016 CAAAAAATGAAAAATTGGCTGGG + Intergenic
1002273717 5:178090023-178090045 AAAATTATAAAAAATTAGCTGGG - Intergenic
1003075280 6:2978532-2978554 GAAATTCTGAGAAATTTACAAGG - Intergenic
1003544043 6:7043599-7043621 CAAATTATTAAAAAGTTGCCGGG + Intergenic
1004163759 6:13237214-13237236 CAAATTCTTAAAAATTAACTGGG + Intronic
1004229201 6:13815611-13815633 CAAAATATTAAATATCTACTAGG + Intergenic
1004483552 6:16044095-16044117 TAAATTATACACAATTTACTGGG - Intergenic
1004658257 6:17685985-17686007 AAAATTAAAAAAAATTTGCTGGG + Intronic
1004849117 6:19677979-19678001 CAAATTATCAAAATTTCACTGGG + Intergenic
1004909417 6:20268499-20268521 GAAAATATGAAAAATTAGCTGGG + Intergenic
1004949611 6:20653904-20653926 AAAAATATAAAAAATTGACTAGG - Intronic
1004991693 6:21145737-21145759 CAAAATATCAAAAATTCACCGGG + Intronic
1005169227 6:22962711-22962733 TAAATTGAGAAAAATTTTCTTGG + Intergenic
1005248760 6:23919507-23919529 CATATTATGATAAATTTAACTGG + Intergenic
1005598627 6:27404488-27404510 TAAGTAATGAAATATTTACTGGG + Intergenic
1006099035 6:31674266-31674288 CTAAATATGAAAAATTAGCTGGG + Intergenic
1006132901 6:31879458-31879480 CAAAATAGAAAAAATTTGCTGGG - Intergenic
1006252572 6:32800634-32800656 AAAAATATGAAAAATTAGCTGGG - Intergenic
1006265647 6:32920208-32920230 CATATTAAGAAAATTTAACTTGG - Intergenic
1007603638 6:43100220-43100242 AAAAATATGAAAAATTAGCTGGG + Intronic
1007766568 6:44163996-44164018 AAAATTAAAAAAAATTAACTGGG - Intronic
1008119512 6:47596023-47596045 AAAATTAGGTAAAACTTACTTGG - Exonic
1008228696 6:48956266-48956288 ACAATTTTGAAAAGTTTACTTGG - Intergenic
1008372097 6:50744557-50744579 CCATTTCTTAAAAATTTACTTGG + Intronic
1008620522 6:53266844-53266866 AAAATTTTTAAAAATTAACTGGG - Intergenic
1008823815 6:55666779-55666801 AAAATTTTGAAAAATTTAACTGG - Intergenic
1009240330 6:61178397-61178419 CAAATTATCAAAACTTTAGGGGG + Intergenic
1009325467 6:62343844-62343866 AAAAATATCAAAAATTAACTGGG - Intergenic
1009334184 6:62465147-62465169 CATATTATGTCACATTTACTTGG - Intergenic
1009436853 6:63628712-63628734 GACATTATGAACAATTTCCTAGG + Intergenic
1009561222 6:65246456-65246478 CAAATTAAGAGAACTTTATTTGG + Intronic
1009569860 6:65370803-65370825 CAAATTATGCCAAATGTAGTTGG - Intronic
1009630712 6:66196501-66196523 AAAAATATAAAAAATTCACTGGG + Intergenic
1009725415 6:67531229-67531251 CAAATTATGAAGGATTTTATTGG - Intergenic
1010009169 6:71030010-71030032 AAAATAATGAAAGAATTACTTGG - Intergenic
1010204224 6:73308656-73308678 AAAAATATGAAAAATTAGCTGGG - Intronic
1010387681 6:75301351-75301373 GAAATAATGAATAATGTACTGGG + Intronic
1010724524 6:79318141-79318163 ACAATTATGATAAATCTACTTGG - Intergenic
1010881292 6:81177063-81177085 TAAATGATGAAAAGCTTACTAGG - Intergenic
1011102496 6:83738704-83738726 CAAACTATGAAACATTGGCTTGG - Intergenic
1011308889 6:85959427-85959449 CAAAGTATGAAAAATTAGCTGGG + Intergenic
1011684990 6:89816833-89816855 AAAAATATGAAAAATTAGCTGGG - Intronic
1011878680 6:91995373-91995395 CAAAATATGAATACTTTTCTAGG + Intergenic
1011973574 6:93261524-93261546 CAAAATATTAAGAATTTACCAGG + Intronic
1012113157 6:95261547-95261569 CAAATTATAAAAGATTGGCTTGG - Intergenic
1012818552 6:104055612-104055634 CAAATTGTGAAAAATCTTATTGG + Intergenic
1013051739 6:106542578-106542600 CATATTTTAAAAAATTAACTAGG - Intronic
1013051776 6:106542947-106542969 CATATTTTAAAAAATTAACTAGG - Intronic
1013172693 6:107651104-107651126 AAAAATATGAAAAATTAGCTGGG + Intronic
1013181835 6:107723196-107723218 TAACTTATGATAAATTTATTGGG - Intronic
1013438768 6:110139951-110139973 AATATTATGAAATATTTATTTGG + Intronic
1013492609 6:110663690-110663712 CAAAAAATAAAAAATTAACTGGG - Intronic
1013544771 6:111145241-111145263 CAAAAATTGAAAAATTAACTGGG + Intronic
1013711144 6:112900484-112900506 AAAATTTTGAAAAATTCACCTGG - Intergenic
1013736546 6:113233915-113233937 AAAATTTTGAAAAATTAACCGGG + Intergenic
1013802811 6:113967087-113967109 CAAATTATAGAAATTCTACTTGG - Intronic
1014006979 6:116430151-116430173 CTAATAATGAAAAATCAACTAGG - Intronic
1014055511 6:117010210-117010232 CAACTTTTAAAAAATTTACCTGG - Intergenic
1014077689 6:117255410-117255432 CAAATTATGAAATATTATATAGG - Intergenic
1014102197 6:117523701-117523723 AAAATTATGGAATATTTATTTGG + Intronic
1014512672 6:122343606-122343628 GAAATAATTAAAAATTTACAGGG + Intergenic
1014605341 6:123466970-123466992 TAAATTATGTGAAATTTACAGGG - Intronic
1014638018 6:123872950-123872972 CACTTTTTGAAAAATTTAATAGG - Intronic
1015298877 6:131630419-131630441 TAAATTATAATAACTTTACTAGG - Intronic
1015331677 6:131987139-131987161 TAAATTTTGCAAAATTTACTGGG + Intergenic
1017103745 6:150868901-150868923 AAAATTTTAAAAAATTAACTGGG + Intronic
1017160454 6:151360770-151360792 CAAAATATAAAAAATTATCTGGG - Intergenic
1017548215 6:155474439-155474461 CCAATGATGATAAATTTCCTAGG - Intergenic
1017707784 6:157139881-157139903 AAAAATATGAAAAATTAGCTGGG - Intronic
1018018385 6:159733459-159733481 AAAATTACAAAAAATTAACTGGG + Intronic
1018143381 6:160861813-160861835 AAAATTTTGAAAAATTTATTTGG + Intergenic
1018621099 6:165730590-165730612 AAAAATATAAAAAATTAACTGGG + Intronic
1018856139 6:167676777-167676799 AAAAGTATGAAAAAATTAGTGGG + Intergenic
1019066428 6:169303049-169303071 AAAATAAAGAAAAATTTCCTGGG - Intergenic
1019510076 7:1413423-1413445 CAAATAAAGATGAATTTACTAGG - Intergenic
1019862290 7:3670613-3670635 CAAATAATCTAACATTTACTGGG - Intronic
1019925409 7:4188623-4188645 AAAATTATGAAAAAATATCTGGG - Intronic
1020031079 7:4933198-4933220 CAAAATATTAAAAAATTACCTGG + Intronic
1020133400 7:5572300-5572322 AAAAATATGAAAAATTAGCTGGG - Intergenic
1020447237 7:8282182-8282204 CAAATATTAAAAAATTTACCAGG + Intergenic
1020572145 7:9877500-9877522 CAAAGTATGAGAAAATTATTTGG + Intergenic
1020725848 7:11813550-11813572 AAAATTACAAAAAATTAACTGGG + Intronic
1021183831 7:17539322-17539344 AAAAATATGAAAAATTAGCTGGG + Intergenic
1021635544 7:22688909-22688931 AAAAATATGAAAAATTAGCTGGG + Intergenic
1021829320 7:24587838-24587860 AATATTATGAAACATTTAGTAGG + Intronic
1022330992 7:29378802-29378824 GAAAATATGAAAAATTAGCTGGG + Intronic
1023530150 7:41144679-41144701 CAAAATATGAAAAATTCAACAGG + Intergenic
1024394668 7:48851960-48851982 AAAATTATGAAGAATTGAGTAGG + Intergenic
1024400592 7:48920681-48920703 AAAATTATGAAGAATTGAGTAGG - Intergenic
1024706738 7:51969732-51969754 AAAAATATGAAAAATTAGCTGGG - Intergenic
1025025265 7:55511456-55511478 CAAATTTTTAATAATTCACTTGG - Intronic
1025101220 7:56136751-56136773 AAAAATATGAAAAATTAGCTGGG - Intergenic
1025214443 7:57044038-57044060 AAAAGTATAAAAAATTCACTAGG + Intergenic
1025240151 7:57265174-57265196 CAAATTTTTAAAAATTTACTAGG - Intergenic
1025657512 7:63532775-63532797 AAAAGTATAAAAAATTCACTAGG - Intergenic
1025748056 7:64263250-64263272 CAAATAATTAAAAATTAGCTGGG - Intronic
1025842325 7:65162456-65162478 CAAAATATAAAAAAATTAGTCGG - Intergenic
1025880719 7:65533514-65533536 CAAAATATAAAAAAATTAGTCGG + Intergenic
1025892718 7:65669090-65669112 CAAAATATAAAAAAATTAGTCGG - Intergenic
1025950938 7:66144989-66145011 AAAAATACCAAAAATTTACTGGG + Intronic
1025970377 7:66318453-66318475 AAAATTCTGAAGAATGTACTTGG - Intronic
1026048811 7:66927595-66927617 CAAATTAAAAAAAATTAGCTGGG - Intronic
1026094622 7:67334376-67334398 AAAATTAAGAAAAAATTCCTTGG - Intergenic
1026372188 7:69711641-69711663 TAAATTATGGAAAATTTGTTAGG - Intronic
1026411016 7:70123034-70123056 AAAAATATGAAAAATTAGCTGGG - Intronic
1026538897 7:71263196-71263218 AAAAATATAAAAAATTAACTGGG + Intronic
1026582671 7:71631352-71631374 CAAAATATTAAAAATTAGCTGGG - Intronic
1026789730 7:73323877-73323899 CAAAATATGAAAAATGAGCTGGG + Intronic
1026884811 7:73934051-73934073 AAAAATACGAAAAATTAACTGGG - Intergenic
1027222267 7:76221521-76221543 AAAAATATGAAAAATTAGCTGGG - Intronic
1027952762 7:84838967-84838989 CAAAATACGAAAAATTCACCAGG + Intergenic
1027956340 7:84883395-84883417 AAAATTATGAAAAATATAAAAGG - Intergenic
1028015266 7:85702251-85702273 TAAACTATTAATAATTTACTTGG - Intergenic
1028016558 7:85721467-85721489 CAAATAATCGAAAATTTATTTGG + Intergenic
1028075004 7:86502043-86502065 AAAAATATGAAAAATTAGCTGGG - Intergenic
1028082128 7:86590543-86590565 AAAACTATTAAAAATTTACATGG - Intergenic
1028546607 7:92008823-92008845 AAAAATATGAAAAATTAGCTGGG + Intronic
1029029247 7:97451067-97451089 AAAAATATGAAAAATTAGCTGGG - Intergenic
1029709561 7:102292226-102292248 CAAAATATCAAAAAATTACCTGG + Intronic
1029968381 7:104764327-104764349 CAAATACAGAAAAATTCACTGGG - Intronic
1030024941 7:105314169-105314191 AAAAATATGAAAAATTAACCGGG + Intronic
1030031733 7:105376153-105376175 CAAAATACAAAAAATTTGCTGGG - Intronic
1030539151 7:110807524-110807546 GAAATTATCAAATATTTACTTGG - Intronic
1030632382 7:111909798-111909820 CAAATAATAAAAAATTAGCTGGG + Intronic
1030737497 7:113067098-113067120 AAAAATATGAAAAATTAGCTGGG - Intergenic
1030810484 7:113966642-113966664 AAAACTATGAGAAATTAACTGGG + Intronic
1031143637 7:117973402-117973424 AAAATTATAAAAAATTTGCCAGG + Intergenic
1031229844 7:119092274-119092296 CAAAATATGAAAAATTAGCTGGG + Intergenic
1031250149 7:119369804-119369826 AAAAAAATGAAAAATTTGCTGGG - Intergenic
1031304837 7:120113592-120113614 TAAATTATTTTAAATTTACTTGG + Intergenic
1031347069 7:120681036-120681058 CAAATTATGAAAACAGTTCTTGG - Intronic
1031583685 7:123507450-123507472 CAATTTATGACAGGTTTACTGGG + Intronic
1031795535 7:126169562-126169584 CAAAATATAATAAATTTTCTTGG + Intergenic
1032130047 7:129220480-129220502 TAAAATATGAAAAATTAGCTCGG + Intergenic
1032178133 7:129649912-129649934 CAAAAAATGAAAAATTAGCTGGG - Intronic
1032200258 7:129816492-129816514 AAAAATATGAAAAATTAGCTGGG + Intergenic
1032450380 7:132025368-132025390 AAAATTTTGAAAAATTTAAAAGG - Intergenic
1032602330 7:133311060-133311082 AAAATAATAAAAATTTTACTTGG + Intronic
1032678715 7:134159173-134159195 CAAAAAATAAAAAATTTGCTGGG + Intronic
1032772829 7:135076752-135076774 AAAACTAAGAAAAATTAACTGGG + Intronic
1032860355 7:135872375-135872397 CAAATAATGAAAAATTAGCCAGG - Intergenic
1033085459 7:138337400-138337422 AAAATTATAAAAAGTTAACTTGG - Intergenic
1033323268 7:140359180-140359202 GAAATTATAAAAAATTAGCTAGG + Intronic
1033612262 7:142974947-142974969 CAAAATATAGAAAATTTAGTTGG + Intergenic
1033640401 7:143258021-143258043 CAAATTTTTAAAAATCTGCTTGG - Intronic
1033755015 7:144391199-144391221 CAAAATATCAAAAATTTAGCCGG + Intergenic
1033762709 7:144453206-144453228 CAAATTAAAAACAATTTTCTAGG + Exonic
1033771883 7:144561514-144561536 CCAATTTTGAAAACTTTACAAGG - Intronic
1033784445 7:144713980-144714002 CAATATATAAAAAAATTACTTGG + Intronic
1033809891 7:145000551-145000573 AAAATTTTAAAAAATTAACTGGG - Intergenic
1035517008 8:242586-242608 CTAATTATGAAATCTGTACTTGG - Intronic
1036148567 8:6276929-6276951 AAAAATACGAAAAATTAACTGGG - Intergenic
1036175398 8:6533078-6533100 CATGTTAGGAAAAATTTAATAGG - Intronic
1036734331 8:11296922-11296944 CAAATAATAGAAATTTTACTTGG + Intronic
1036764630 8:11541103-11541125 CAAAAAATAAAAAATTTAGTAGG + Intronic
1037243285 8:16802761-16802783 CAAATCAAGAAAAATTCAGTAGG + Intergenic
1038047271 8:23776149-23776171 CATTTTTTGAAAAATTAACTAGG - Intergenic
1038251510 8:25909331-25909353 CAAATTTTCAAACATTAACTAGG - Intronic
1038331665 8:26613967-26613989 CAAAAAATTAAAAATTAACTGGG + Intronic
1038547608 8:28437710-28437732 CAAAATTTGAAAAATTAACCAGG + Intronic
1038900088 8:31832418-31832440 CAAATTATGAAAAATTTACTGGG - Intronic
1038942933 8:32325538-32325560 CAAAATATAAAAAATTAACCAGG - Intronic
1039183169 8:34889010-34889032 GAAATTATGAAAGTATTACTTGG + Intergenic
1039263707 8:35801954-35801976 AAAATTTTTAAAAATTTAGTTGG - Intergenic
1039426447 8:37490295-37490317 AAAAATATGAAAAATTAGCTGGG + Intergenic
1039467115 8:37792484-37792506 CAAAAAATTAAAAATTTAGTCGG + Intronic
1039497898 8:37994948-37994970 CAAAATATAAAAAATTAGCTAGG - Intergenic
1039535135 8:38303550-38303572 CTCATTATGAAAACATTACTTGG - Intronic
1039592744 8:38763655-38763677 CCATTTTTGAAAAATATACTTGG - Intronic
1039972829 8:42334937-42334959 AAAAATAAGAAAAATGTACTGGG - Intergenic
1041516314 8:58702512-58702534 AAAAATATAAAAAATTGACTGGG - Intergenic
1041551673 8:59109638-59109660 CACATTATGTGAACTTTACTAGG + Intronic
1041919202 8:63164210-63164232 AAAAATATGAAAAATTAGCTGGG + Intergenic
1042296217 8:67221238-67221260 CAAATTTTTAAAAAGTTAATTGG + Intronic
1042616102 8:70651256-70651278 CAATATATGAAATATATACTTGG - Intronic
1043235151 8:77855451-77855473 CAAACTATGAATAATATGCTAGG - Intergenic
1043306268 8:78800455-78800477 CAAATTTTAAAAAATTAGCTGGG - Intronic
1043450639 8:80362604-80362626 CAAATCATTAAAAAATTACCTGG + Intergenic
1043478632 8:80630085-80630107 CAAATTATTCAAAATAAACTTGG - Exonic
1043575466 8:81651377-81651399 CAATTTATGAAGAATTCTCTTGG + Intergenic
1043687709 8:83108232-83108254 CATATTTTTAAAAATTTAGTGGG + Intergenic
1043771806 8:84211872-84211894 AACATTATCAAAAATTTATTTGG + Intronic
1043783741 8:84370079-84370101 AAAATTATTCAAAATTTACGTGG - Intronic
1043791645 8:84475378-84475400 TAAATTACAAAAAATTAACTGGG - Intronic
1043936140 8:86144560-86144582 CTAATCATTAAAATTTTACTTGG + Intronic
1043942373 8:86210323-86210345 CAAATTATCACAAATTCAATTGG - Intergenic
1044036340 8:87308170-87308192 CACACAATGAACAATTTACTTGG + Intronic
1044066035 8:87701372-87701394 AAAAATATGAAAAATTAGCTGGG + Intergenic
1044136212 8:88589026-88589048 AAAAATATGAAAAATTATCTGGG + Intergenic
1044412603 8:91901458-91901480 AAAAATATTAAAAATTCACTAGG + Intergenic
1044547846 8:93479363-93479385 AAAAAAATGAAAAATTAACTGGG - Intergenic
1044679452 8:94762739-94762761 AAAATTTTTAAAAATTAACTGGG + Intronic
1044800635 8:95950572-95950594 AAAATTATAAAAAATTAGCTGGG - Intergenic
1045070494 8:98499337-98499359 CAAATTATGACAGACTTACTTGG - Intronic
1045473605 8:102534982-102535004 CAAATTAGAAAAAATTGGCTGGG + Intronic
1045586101 8:103539014-103539036 TAACTTATGAAAAATTAACTTGG - Intronic
1045853094 8:106727045-106727067 CAAAATATTAAAATTTTAATAGG + Intronic
1046038821 8:108877732-108877754 AAAAATATAAAAAATTAACTAGG - Intergenic
1046082840 8:109393514-109393536 CAAATTAGCAACAATTGACTGGG - Intronic
1046170774 8:110502291-110502313 CAAAATATGAAAAAATTAGCCGG + Intergenic
1046277056 8:111975832-111975854 CAATTTATGTTAAATATACTTGG - Intergenic
1047049168 8:121091168-121091190 GAAATTATGCTAAATCTACTTGG - Intergenic
1047067374 8:121300453-121300475 AAAAATATGAAAAATTAGCTGGG - Intergenic
1047125749 8:121958526-121958548 AAAATAATGCAAAATATACTTGG + Intergenic
1047385794 8:124408074-124408096 CAAAAAATGAAAAATTAGCTGGG + Intergenic
1047721637 8:127645570-127645592 CAAGGTATGAAAAATTGACCAGG + Intergenic
1047945755 8:129877486-129877508 AAAAATATGAAAAATTAGCTGGG + Intronic
1048015483 8:130492823-130492845 CAAATTAGAAAAAAATTATTGGG - Intergenic
1048153992 8:131924315-131924337 CAAAGGATAAAAAAATTACTTGG - Intronic
1048483987 8:134831352-134831374 TAAATGATAAAAAAGTTACTTGG - Intergenic
1048739282 8:137536729-137536751 AAAAATATAAAAAATTCACTGGG - Intergenic
1049057727 8:140251985-140252007 CAAATTATGAAGCATTCATTTGG - Intronic
1049066394 8:140319625-140319647 GAAAATATGAAAAATTAGCTGGG - Intronic
1049985043 9:942432-942454 CAAAATATTAAAAATTAGCTGGG - Intronic
1050065605 9:1756385-1756407 ATCATTCTGAAAAATTTACTAGG + Intergenic
1050593304 9:7181798-7181820 CGAGTTATGAAAATTTTCCTGGG - Intergenic
1050730418 9:8703103-8703125 CAAATTATGAAAAAGTACTTGGG + Intronic
1050955155 9:11647701-11647723 CAATTTATGGAACATTTAGTAGG + Intergenic
1051067844 9:13126293-13126315 CAAATTATTCAATATTCACTGGG - Intronic
1051157881 9:14170923-14170945 CAATATATTAAAATTTTACTTGG + Intronic
1051189069 9:14492200-14492222 AAAAATATGAAAAATTAGCTGGG + Intergenic
1051590796 9:18775642-18775664 CAAAATATGAGAAATTTGCTTGG - Intronic
1051792885 9:20828009-20828031 AAAAATATGAAAAATTAGCTGGG + Intronic
1052194703 9:25697028-25697050 GAAATTATTAAATATTTATTTGG - Intergenic
1052242062 9:26285077-26285099 CTAATTATAAAAAATTTAACTGG - Intergenic
1052321750 9:27174854-27174876 CAAACTATGAACACTTTGCTAGG + Intronic
1052759417 9:32574548-32574570 CACAATATGAAATATTTACTTGG - Intergenic
1053026821 9:34736465-34736487 CAAAAAATAAAAAATTAACTGGG - Intergenic
1053181902 9:35979934-35979956 CAAAAAATAAAAAATTAACTAGG - Intergenic
1053316157 9:37053528-37053550 CAAAAAATAAAAAATTAACTGGG + Intergenic
1053330254 9:37199490-37199512 AAAATTACAAAAAATTAACTGGG - Intronic
1053491552 9:38508461-38508483 CAGATTATGAAAAATTTGGTAGG - Intergenic
1053640590 9:40072856-40072878 GAGATCATGAAAATTTTACTGGG + Intergenic
1053765548 9:41392610-41392632 GAGATCATGAAAATTTTACTGGG - Intergenic
1054317549 9:63611217-63611239 CAAATTAAAAAAAAATTACATGG + Intergenic
1054321281 9:63668844-63668866 GAGATCATGAAAATTTTACTGGG + Intergenic
1054544161 9:66303769-66303791 GAGATCATGAAAATTTTACTGGG - Intergenic
1054722336 9:68616694-68616716 AAAAATATGAAAAATTAGCTGGG - Intergenic
1054882283 9:70156877-70156899 CAACTTATGAGAAAATTACTGGG + Intronic
1055008861 9:71540868-71540890 GAAATTATGAAATATATATTTGG - Intergenic
1055361738 9:75498236-75498258 CAAATTAGACAAAATTTAATTGG + Intergenic
1055852073 9:80643876-80643898 AGAATTATCAAAAAATTACTTGG + Intergenic
1055984186 9:82039433-82039455 CAAGTTCTTGAAAATTTACTTGG + Intergenic
1056145347 9:83723450-83723472 CAAAGTTCTAAAAATTTACTTGG + Intergenic
1057377353 9:94537123-94537145 CAAATTATAACAAATTAACCGGG + Intergenic
1057387373 9:94615986-94616008 AAAATTACAAAAAATTAACTGGG - Intronic
1057635571 9:96762732-96762754 CACATTTTCAAAGATTTACTGGG + Intronic
1057777737 9:98024592-98024614 CAAACTAAAAAAAATTCACTGGG - Intergenic
1057846900 9:98532865-98532887 CAAATTCAGGAAAATTAACTTGG + Intronic
1057957010 9:99418212-99418234 TAAATTTTTAAAAATTAACTGGG + Intergenic
1058154714 9:101502353-101502375 CAAATGATGAAAACTTTAAATGG + Intronic
1058279292 9:103091443-103091465 CAAACTATGAAAGATTTTTTTGG - Intergenic
1058446510 9:105060033-105060055 AAAAATATAAAAAATTAACTGGG - Intergenic
1058534700 9:105946595-105946617 CAAAATATAAAAAATTAACCAGG - Intergenic
1058576562 9:106409880-106409902 CAATTTTTTAAAAACTTACTTGG + Intergenic
1058900048 9:109434301-109434323 AAAAATATGAAAAATTAGCTGGG - Intronic
1058900072 9:109434466-109434488 AAAAATATGAAAAATTAGCTGGG - Intronic
1058992523 9:110268401-110268423 AAAATTAGGAAATATTTAATAGG + Intergenic
1059026671 9:110641434-110641456 CAAATGATGAAAACTTAACGGGG + Intergenic
1059191535 9:112332720-112332742 CAAATGCTCAAAAATTTAATGGG - Intronic
1059482749 9:114604416-114604438 GAAAATACAAAAAATTTACTGGG + Intergenic
1059780657 9:117522753-117522775 CAAATTATGATAGATTTATCAGG + Intergenic
1059815712 9:117911186-117911208 AATATTATTAAAAATCTACTGGG + Intergenic
1060494641 9:124109386-124109408 CACTTTATGAAGGATTTACTGGG + Intergenic
1060715453 9:125923724-125923746 GAAATTATTAAAAATTAGCTGGG - Intronic
1062757660 9:138311767-138311789 CAAATGATTAAAAATTTAAAGGG + Intergenic
1203624440 Un_KI270749v1:157879-157901 CACATTATGAAGAATTTTTTAGG + Intergenic
1185433764 X:25281-25303 TAAATTAAGAAAAATTTAAAAGG + Intergenic
1185442970 X:237348-237370 TAAATTAAGAAAAATTTAAAAGG + Intergenic
1186071965 X:5831279-5831301 CAAAATATGATCAATTTATTCGG - Intergenic
1186491752 X:9979304-9979326 AAAAATATGAAAAATTAGCTGGG + Intergenic
1186713378 X:12224511-12224533 CACATTATGAAGAATTTAGAGGG + Intronic
1186764075 X:12753059-12753081 CAAATTATTTAAATTTTACTGGG - Intergenic
1186815410 X:13232765-13232787 GAAATCATGAAAAATGAACTTGG - Intergenic
1186951691 X:14633332-14633354 CAAAAAATAAAAAATTAACTGGG + Intronic
1187019755 X:15368709-15368731 GAAATTAGGAGCAATTTACTTGG - Intronic
1187435358 X:19262970-19262992 AATATTAGGAAAAAATTACTAGG + Intergenic
1187483291 X:19677927-19677949 GAATTTAAGAAAAATATACTGGG + Intronic
1187490035 X:19742809-19742831 GAAAATGTGAAAACTTTACTTGG - Intronic
1187789285 X:22931721-22931743 AAAACTATGAAAAATATATTTGG - Intergenic
1187798301 X:23029711-23029733 CAAAATATGAAATACTTAGTAGG - Intergenic
1188272186 X:28153505-28153527 CAAAAAATAAAAAATTTACCTGG + Intergenic
1188518050 X:31008797-31008819 CAAATAATAAAAAAATAACTGGG + Intergenic
1188786080 X:34348048-34348070 AATATTATTGAAAATTTACTGGG - Intergenic
1188831343 X:34901603-34901625 TAAACTATGAAAAATATCCTGGG + Intergenic
1188966191 X:36555371-36555393 AAAATTTTAAAAAATATACTTGG + Intergenic
1189552525 X:42108030-42108052 CAAATCATCAAAAATTTTCCTGG - Intergenic
1189649207 X:43171127-43171149 CACATAATTAAAACTTTACTTGG - Intergenic
1189814433 X:44810702-44810724 AAAAGTATGAAAAATTAGCTGGG - Intergenic
1189884898 X:45532686-45532708 CAAATGAGGAAACATTTATTCGG + Intergenic
1189891525 X:45607905-45607927 AAAATTCTTAAAAATATACTAGG - Intergenic
1190147842 X:47913353-47913375 CAAATTATGTAAAAATTAGCTGG + Intronic
1190855525 X:54290489-54290511 CAAATTATCAAAAAGGTGCTAGG + Intronic
1191120852 X:56902927-56902949 CATTTTATGAAAAATTTAGGAGG - Intergenic
1191165901 X:57391772-57391794 CTTTTTATGAAAAATTTATTTGG + Intronic
1191857522 X:65639302-65639324 AAAAATATGAAAAATTAGCTGGG - Intronic
1192274133 X:69612854-69612876 CCACTTATGAAACATTTCCTGGG - Intergenic
1192384697 X:70655515-70655537 CAACTTATGATCAATTTATTGGG + Intronic
1192978220 X:76309330-76309352 TAAATTGTAAAAAATTTAATTGG + Intergenic
1193614294 X:83668876-83668898 GATATTATAAAAAATTTGCTCGG + Intergenic
1193702515 X:84780293-84780315 AAAAATATGAAAAATTAGCTGGG - Intergenic
1193815950 X:86105123-86105145 CAAAACATTAAAAAGTTACTGGG + Intergenic
1194077905 X:89419481-89419503 CAAATAATCAAAAATTAACTAGG - Intergenic
1194148520 X:90293297-90293319 AAAATTATGAAAAATTCAAATGG - Intergenic
1194319856 X:92431928-92431950 TAAAATATGTAAAAATTACTAGG - Intronic
1194381671 X:93199853-93199875 CAAATTTTTAAAAATTTTCAAGG - Intergenic
1194651248 X:96517152-96517174 CAATTTCTGAAAACTTGACTGGG - Intergenic
1194653172 X:96539874-96539896 CAAATTATGATTAAATTCCTGGG - Intergenic
1195593983 X:106666971-106666993 CAATTTAAGAAATATTTACTGGG + Intronic
1195715155 X:107811324-107811346 CAAATAATAAAAAAGTAACTGGG - Intergenic
1195719574 X:107853459-107853481 CAAAAAATGCAAAATTTAGTTGG - Intronic
1195726845 X:107926453-107926475 AAAATAATGGAAAATATACTGGG + Intronic
1195912448 X:109902270-109902292 CAAGAAATGAAAAATTTGCTGGG - Intergenic
1195949081 X:110248223-110248245 AAAATTATAAAAATTTTGCTGGG + Intronic
1196325965 X:114402957-114402979 CAAATGATGAAAATTTTCTTTGG - Intergenic
1196482906 X:116170828-116170850 CAATTTATATATAATTTACTTGG + Intronic
1196776231 X:119340282-119340304 CACATTTTAAAAAATCTACTTGG - Intergenic
1196847458 X:119907617-119907639 AAAAAAATAAAAAATTTACTCGG - Intronic
1197212629 X:123840868-123840890 CAAAATACGAAAAATTGGCTGGG - Intergenic
1197628577 X:128831829-128831851 GAAATTATGAAAATATTATTTGG - Intergenic
1197684898 X:129428337-129428359 TAAATCATGAATAATTTCCTGGG + Intergenic
1198187526 X:134268025-134268047 CAAAAAATAAAAAATTAACTGGG - Intergenic
1198195470 X:134356271-134356293 AAAAATTTGAAAAATTAACTTGG + Intergenic
1198838243 X:140827794-140827816 CACATTTTGAAAAACTCACTAGG + Intergenic
1198965199 X:142221237-142221259 AAAATAATAAAAAATTTCCTTGG - Intergenic
1199019600 X:142862035-142862057 AAAAATATGAAAAATTAGCTGGG - Intergenic
1199835852 X:151590037-151590059 CAAAACATGAAAAATCTACTGGG + Intronic
1200230082 X:154439514-154439536 CAAAATACGAAAAATTAGCTGGG + Intronic
1200430554 Y:3075042-3075064 CAAATAATCAAAAATTAACTAGG - Intergenic
1200494897 Y:3870035-3870057 AAAATTATGAAAAATTCAAAAGG - Intergenic
1200627982 Y:5545061-5545083 TAAAATATGTAAAAATTACTAGG - Intronic
1200834035 Y:7715412-7715434 CAAATAATAAAAAATTAGCTAGG - Intergenic
1201368236 Y:13232519-13232541 CACATTATGAGAATTTTACGTGG - Intergenic
1201429015 Y:13886995-13887017 CAAAATATAAAAAATTAGCTGGG - Intergenic
1201476015 Y:14381328-14381350 GAAATTATGAAAAAATTATTTGG + Intergenic
1201687633 Y:16725019-16725041 CAAATTTTAAAAAATTAGCTAGG - Intergenic
1201784084 Y:17754929-17754951 AAAAATATGAAAAATTAGCTAGG + Intergenic
1201817469 Y:18151058-18151080 AAAAATATGAAAAATTAGCTAGG - Intergenic
1202586143 Y:26430109-26430131 CATATTATGAAATATATATTTGG + Intergenic